Abstract: An object of the present invention is to suppress nonspecific extension reaction of the primer in the primer extension method.The primer extension reaction to form a nucleic acid strand complementary to a nucleic acid template strand with the use of a primer according to the present invention is characterized in that the reaction between the primer and the template strand is carried out in the presence of a nucleic acid or a derivative thereof which is complementary to said primer and has an affinity for said primer is equivalent to or less than that of said primer for the nucleic acid template strand.

Abstract: An objective of the present invention is to provide a packaging cell for preparing a retrovirus having a high viral titer. The cell producing a recombinant retrovirus is constructed by introducing, the Polyoma virus early region gene together with a recombinant plasmid or a recombinant retrovirus free from any replication origin derived from Polyoma virus into a packaging cell for preparing a recombinant retrovirus.

Abstract: Described is a process for producing an N-biphenyl-methylthiadiazoline derivative (7) in accordance with the reaction formula described below. According to the process of the present invention, it is possible to produce a compound (7) advantageously from the industrial viewpoint.

Abstract: A nucleic acid differentiation method utilizing complementary strand-exchange reaction in competitive hybridization can clearly differentiate a site of gene mutation or a difference between genes in a target nucleic acid even when the gene mutation or difference is located near the primer binding site of the target nucleic acid.

Abstract: A probe set is provided which can assay larger amounts of samples in a simpler manner and enables typing of all HLA-DR types currently known to be present in Japanese. The probe set comprises part or all of oligonucleotides having the following sequences 1 to 16 or complementary strands thereof:sequence 1: CGGTTGCTCGGAAAGATGCATCsequence 2: ACACTCCCTCTTTGGCTGsequence 3: GGCCGGGTGGACAACTACsequence 4: ATGTTTAACCTGCTCCAAsequence 5: CCTGATGAGGAGTACTGGAAsequence 6: AGCTACTGCGCTTCGACsequence 7: CGTAGAGTACTCCAAGAAsequence 8: CTTATACTTACCCTGCCAsequence 9: AGACAGGCGGGCCCTsequence 10: TCAAACTTATCCTGCTTCsequence 11: AAACTTAACCTCCTCCAAsequence 12: ACTCTACGTCTGAGTGTCsequence 13: ACGGGTGAGTGTTATTTCsequence 14: GACCTCCTGGAAGACAGGsequence 15: ACATCCTGGAAGACGAGCsequence 16: CCCGTAGTTGTGTCTGCA.

Abstract: Efficient methods for cultivating garlic plants are disclosed. Bulbils, which are smaller but available in a larger number per plant than cloves, are used in: a first method for cultivating garlic plant, wherein bulbils of a garlic plant are planted in spring for cultivation after stored for wintering at a temperature not inducing fleshy clove formation; a second method of cultivating garlic plants, wherein a garlic plant in which fleshy clove formation may have been induced (e.g., one which has been exposed to a low temperature in winter) is warmed to negate the state of fleshy clove formation, then the bulbils thereof are planted in spring for cultivation; and a third method of cultivating garlic plants, wherein a garlic plant which has been harvested in the Southern Hemisphere and has not wintered is transported to the Northern Hemisphere, and the bulbils thereof are planted in spring for cultivation.

Abstract: The present invention relates to a process for producing a tetrazolylated biphenylmethane derivatives (6) or salts thereof in accordance with the below-described reaction scheme wherein R.sup.1 represents an alkyl; R.sup.2 represents H, etc.; Z represents a halogen, etc.; and A represents a cycloalkene, etc. According to the above process, a tetrazolylated biphenylmethane derivative can be industrially and advantageously produced with short steps.

Abstract: The invention provides a pyridonecarboxylic acid derivative of the following general formula (1): ##STR1## wherein R.sup.1 is a hydrogen atom or carboxy protecting group, R.sup.2 is a nitro or substituted or unsubstituted amino group, R.sup.3 is a halogen atom, each of R.sup.4 and R.sup.5, which may be the same or different, is a hydrogen atom, halogen atom, lower alkyl group or lower alkoxy group, A is a nitrogen atom or --CX.dbd. wherein X is a hydrogen atom, halogen atom, lower alkyl group or lower alkoxy group, and Z is a halogen atom or a saturated cyclic amino group which may have a substituent, or a salt thereof and an antibacterial agent comprising the same.

Abstract: A microtiter well in which a single stranded nucleic acid including a plurality of sequences specifically hybridizalbe with a target nucleic acid is immobilized is disclosed. The single stranded nucleic acid is derived from a phage or a phage-plasmid. The microtiter well enables a target nucleic acid to be specifically detected with a high sensitivity and high efficiency and further enables the detection procedure to be automated.

Abstract: A method and a kit for detecting methicillin-resistant Staphylococcus aureus which use, as primers in a gene amplification reaction, the four oligonucleotides represented by the following nucleotide sequences (1) through (4):5'AGAAATGACTGAACGTCCG3' (SEQ ID NO:1) (1)5'GCGATCAATGTTACCGTAG3' (SEQ ID NO:2) (2)5'TACATGTCGTTAAACCTGGTG3' (SEQ ID NO:3) (3)5'TACAGTTGTACCGATGAATGG3' (SEQ ID NO:4) (4)wherein A, G, C, and T denote adenine, guanine, cytosine, and thymine, respectively, and any T may be substituted by uracil (U). According to the method and kit of the present invention, it is possible to detect MRSA accurately and rapidly while distinguishing it from MR-CNS. Thus, proper treatment and prevention can be achieved against MRSA infections.

Abstract: A nucleic acid differentiating method is provided which involves using a primer having a detectable label introduced therein and a primer having a solid matrix-binding site introduced therein, amplifying a particular region of a target nucleic acid in a sample to thereby produce a labeled sample DNA, adding to this labeled sample DNA at least an equimolar amount of an unlabeled standard DNA to be evaluated for its sequence matching with the sample DNA, effecting competitive hybridization, and at the end of reaction, determining the label intensity of the hybridization product, for thereby determining the presence/absence of a mutant gene in the nucleic acid, the ratio of normal to mutant genes, or the sequence matching of a particular gene among a plurality of samples.

Abstract: This invention relates to a biphenylmethane derivative represented by the formula (1): ##STR1## wherein A represents a group ##STR2## in which R.sup.1, X, Y, Z and B are as defined in the Specification. The compounds have potent angiotensin II antagonist activity and anti-hypertensive effect. They have therapeutic utility for circulatory diseases such as hypertension, heart diseases and cerebral apoplexy.

Abstract: An intended nucleic acid is determined in a sample by a method in which at least one of the nucleic acid strands of the intended nucleic acid is subjected to hybridization with a primer and to chain-extension reaction over the primer to form a synthesized nucleic acid which is complementary to and in hybridization with the strand; a copy of the intended nucleic acid is obtained, which copy is (a) the nucleic acid of the double-stranded double produced by the chain-extension reaction, or (b) the synthesized nucleic acid freed from the double-stranded nucleic acid, or (c) a double stranded nucleic acid form from a pair of the synthesized nucleic acids complementary with each other; and it is determined whether the copy is present in the sample thereby to know whether the intended nucleic acid is in present in the sample.

Abstract: The present invention discloses a primer for detecting methicillin-resistant or toxic shock syndrome toxin-1 Staphylococcus spp. comprising any one of nucleotide fragments of sequences (1) to (4):5'GAAATGACTGAACGTCCGAT (1)5'GCGATCAATGTTACCGTAGT (2)5'AGTATGGGCCAAAGTTCGAT (3)5'CACTTTGATATGTGGATCCG (4)a method and kit for detecting these bacteria using the primer. The present invention makes direct and rapid detection of MRS and/or TPS from samples possible, and enables patients with infections caused by these bacteria to be treated at an early stage.

Abstract: A quinolone derivative represented by the below-described formula (1), or a salt thereof: ##STR1## wherein R.sup.1 represents a hydrogen atom, or a carboxyl protective group, R.sup.2 represents a hydrogen atom, halogen atom or a lower alkyl group, X represents a hydrogen atom or a halogen atom, Y represents a halogen atom, a cyclic amino group which may have a substituent, a cyclo- lower alkenyl group which may have a substituent, or a group R.sup.3 --(CH.sub.2).sub.m --A-- (wherein R.sup.3 represents a hydrogen atom or an amino group which may have a substituent, A represents an oxygen atom or a sulfur atom and m represents a number of 0 to 3), Z represents a nitrogen atom or a group C--R.sup.4 (wherein R.sup.

Abstract: Antibacterial quinolone derivatives represented by the following formula [I] and salts thereof are disclosed. ##STR1## wherein R.sup.1 means a hydrogen atom or a carboxyl-protecting group;R.sup.2 denotes a hydrogen or halogen atom or a hydroxyl, lower alkoxyl, amino, aralkylamino, or mono- or di-(lower alkyl)amino group;A represents an oxygen or sulfur atom or N-R.sup.3 in which R.sup.3 is a hydrogen atom or an amino-protecting group;X is a hydrogen or halogen atom;Y means a nitrogen atom or C-R.sup.4 in which R.sup.4 is a hydrogen or halogen atom or a lower alkyl or lower alkoxyl group; andZ denotes a halogen atom or a substituted or unsubstituted heterocyclic group having at least one nitrogen atom as a hetero atom.

Abstract: A tricyclic compound represented by the general formula (1) and salts thereof are disclosed. ##STR1## A method for producing the tricyclic compound and salts thereof, and an antimicrobial agent containing the tricyclic compound and salts thereof as an active ingredient are also disclosed.

Abstract: Aromatic compositions which comprise perfumes included in cyclodextrins whose inclusion ability depends on a pH of a solution containing the perfumes and cyclodextrins and pH-adjusting substances whereby a release rate of the perfume can be controlled, are described. Aromatic compositions are also disclosed, which comprise perfumes coated or covered with materials whose solubility depends on the pH of a solution containing the coated perfumes, and a pH-adjusting substance to change the pH as desired. Methods for controlling the release rate of the perfumes are also described.

Abstract: Disclosed are the novel microorganisms HF8815 and HF8835 belonging to Genus Fusarium oxysporum which are non-pathogenic to garlic and capable of suppressing mycotic infection in garlic. A suppressant for mycotic infection in garlic comprising said microorganisms or its culture medium as an effective ingredient and a method for suppressing mycotic infection in garlic utilizing said suppressant are also disclosed. The use of the microorganism can effectively suppress the mycotic infection in garlic effectuating a biological means involving cross defense mechanism without giving any adverse effects to the soil nor deteriorating the environment.

Abstract: The present invention provides dihydropyridine derivatives represented by the following formula (I) ##STR1## and salts thereof. They have extremely strong, slow and long-acting vasodilating action and antihypertensive action with less adverse effects so that they are useful as therapeutic agents for cardiovascular diseases.