Abstract: The present invention provides a method for inhibiting the RAS-ERK pathway by upregulation of RASA1 and SPRED1 mRNAs in tumor cells by anti-miR treatment. The method includes wherein an anti-miR-206 binds to a nucleotide comprising the sequence UAGCUUAUCAGACU (SEQ ID NO: 21), or to a nucleotide comprising the sequence UGGAAUGUAAGGAAGUGUGUGG (SEQ ID NO: 9). A method of re-expression of RAS-ERK pathway inhibitory proteins in triple negative cancer cells by administering to a patient having cancer an effective amount of an antagonist of KLF4-dependent microRNAs.

Abstract: A method for producing elemental carbon and hydrogen gas directly from a hydrocarbon (for example, natural gas or methane) using a chemical reaction or series of reactions. In an aspect, other materials involved such as, for example, elemental magnesium, remain unchanged and function as a catalyst.

Abstract: A dual modality probe is disclosed having both a gamma probe sensor and an ultrasound sensor. A dual imaging system is provided having the probe and at least one external gamma imaging detector and a data acquisition computer system for collecting data simultaneously from the gamma probe sensor, the gamma imaging detector, and the ultrasound sensor of the probe. A method for evaluating a target organ of a patient utilizing the probe and imaging system, and performing a biopsy of the organ is disclosed.

Abstract: The disclosure provides for methods of oxidizing carbide anions, or negative ions, from salt like carbides at low temperatures below about 600° C. In another aspect, the disclosure provides for reactions with intermediate transition metal carbides. In yet another aspect, the disclosure provides for a system of reactions where salt-like carbide anions and intermediate carbide anions are oxidized to produce pure carbon of various allotropes.

Abstract: The invention provides plants having desirable levels of sugar release and/or lignin synthesis. The invention further provides methods of selecting plants with such desirable levels of sugar release and/or lignin synthesis; methods of genetically modifying plants to modulate lignin synthesis, sugar release, and modulating phenylalanine, tyrosine, tryptophan and flavonoid production; and uses of such plants.

Abstract: The disclosed technology is a system and a method for strengthening one or more joints of a structure having a plurality of structural members forming a vacuous area at each joint. The method includes computing limit load bearing capacity for the structure, at a joint, securing a filler module to the joint, at the vacuous area, the filler module having a plurality of surfaces so that when secured within the vacuous area, some of the surfaces are tangential to the members of the structure at its joint, and one or more of the surfaces are non-tangential to the members of the structure, and applying at least one layer of continuous fiber reinforced polymer wrap about the filler module and the members at the joint. The filler module of the disclosed technology is designed and configured to dissipate energy from a load applied to the structure, and at least doubling the load bearing capacity for the structure, at the joint.

Abstract: A process for incorporating a nanocatalyst on the surface of and within the pores of an electrode comprising subjecting an electrode to a singular template impregnation to form a treated electrode having a bio-template layer; and then subjecting the treated electrode to a singular nano-catalyst impregnation for tethering the nano-catalyst to the treated electrode; and then removing the bio-template layer by performing thermolysis upon the treated electrode for forming a nano-catalyst bonded on the surface and within the pores of the electrode. A modified electrode or product made by this process is provided.

Abstract: A system and method for quantitatively assessing the changes in control of asymmetric locomotor behavior of an animal comprising analyzing the phase modulation in response to imposed asymmetric stepping tasks for quantitatively assessing changes in control of asymmetric locomotor behavior. A walkway gait device is provided comprising an elevated grid having at least one platform having a face and at least two or more pegs located in front or back of said platform, wherein each peg has a pressure sensor or switch in communication with a detection unit for capturing the pressure detected by one or more of the pressure sensors or switches. Preferably, the grid of the walkway gait device has at least three platforms to form a closed path loop.

Abstract: The disclosure provides for methods of oxidizing carbide anions, or negative ions, from salt like carbides at temperatures from about 150° C. to about 750° C. In another aspect, the disclosure provides for reactions with intermediate transition metal carbides. In yet another aspect, the disclosure provides for a system of reactions where salt-like carbide anions and intermediate carbide anions are oxidized to produce pure carbon of various allotropes.

Abstract: The invention provides for the use of carbonic anhydrase activators; protein kinase C activators and FGF-18 to treat depressive disorders. The invention also relates to improved animal models and methods for screening and identifying compounds to treat depressive disorders.

Abstract: A wind turbine is disclosed. The wind turbine includes a shaft rotatable about an axis, a plurality of hubs fixedly attached to the shaft, and a plurality of vanes. The vanes are releasably engaged with each of the plurality of hubs. The vanes disengage from the hubs once the shaft rotates about the axis at a cut-out speed of the wind turbine. In another embodiment, the vanes are releasably engaged with the shaft.

Abstract: A quarter wave coaxial cavity resonator for producing corona discharge plasma from is presented. The quarter wave coaxial cavity resonator has a folded cavity made of opposing concentric cavity members that are nested together to form a continuous cavity ending in a aperture. A center conductor with a tip is positioned in the cavity. The folded cavity advantageously permits the coaxial cavity resonator to resonate at a lower operating frequency than an unfolded quarter wave coaxial cavity resonator of the same length. Embodiments of the quarter wave coaxial cavity resonator use narrower apertures to reduce radiative losses, and include center conductors that are reactive load elements, such as helical coils. When a radio frequency (RF) oscillation is produced in the quarter wave coaxial cavity resonator, corona discharge plasma is formed at the tip of the center conductor. The corona discharge plasma can be used to ignite combustible materials in combustion chambers of combustion engines.

Abstract: Provided herein are devices, systems, and methods of CTD mass spectrometry analysis of biomolecules.

Abstract: Aspects of a low power memory buffer are described. In one embodiment, a sampling rate of a signal is adjusted to identify extrema of a signal. An extrema pulse is generated and, in response to the extrema pulse, a time segment and potential value of the signal are stored in a memory. In other aspects, rising and falling slopes of the signal are tracked to identify a local maximum and a local minimum of the signal. In this scenario, an extrema pulse is generated for each of the local maximum and minimum, and time segment and potential values are stored for the local maximum and minimum. Generally, the storage of analog values of the signal at an adjusted sampling rate is achieved with low power, and the signal may be reconstructed at a later time.

Abstract: Various methods and apparatuses are provided for calibrating a three-axis IMU sensor package using a single-axis rate table. In one embodiment, a method includes adjusting an x-axis position of a sensor by rotating an inner assembly along the circumference of the inner surface of the circular frame, adjusting a y-axis position of the sensor by rotating a portion of the inner assembly, spinning the single-axis rate table to generate z-axis rotation of the apparatus which results in simultaneous stimulation of all three axes of the sensor assembly, and obtaining measurements from the sensor corresponding to the x-axis position, the y-axis position, and the z-axis rotation of the apparatus.

Abstract: The present disclosure describes novel PKC-? activators chosen from halogenated esters of unsaturated fatty acids derivatives thereof, including halogenated esters of both polyunsaturated and monunsaturated fatty acids and derivatives thereof. The disclosure further relates to compositions, kits, and methods for treatment using the halogenated esters.

Abstract: A compound that is selected from the group consisting of 3-(3,4-dichloroanilino)-3-oxopropanoic acid (hereinafter “DCOPA”); N-methyl-DCOPA; N,2-dimethyl-DCOPA; 2-methyl-DCOPA; isobutyl-DCOPA; N-methyl-isobutyl DCOPA; 3-(3,4-bibromoanilino)-3-oxopropanoic acid; and analogs of DCOPA; and analogs of 3-(3,4-bibromoanilino)-3-oxopropanoic acid; and pharmaceutically acceptable salts of these compounds, are disclosed. A method of controlling bone erosion in a patient comprising administering to the patient a therapeutically effective amount of at least one of these compounds, or a pharmaceutically acceptable salt of at least one of these compounds, is provided. A method of reducing inflammation in a patient having an inflammatory condition comprising administering to the patient a therapeutically effective amount of at least one of these compounds, or a pharmaceutically acceptable salt of at least one of these compounds is provided.

Abstract: This invention provides a compound that is 4,4?-(4?-Carboxy)-4-nonyloxy-[1,1?-biphenyl]-3,5-diyl)dibutanoic acid (CNBDA), derivative compounds of CNBDA, and pharmaceutical compositions thereof. The derivative compounds of CNBDA have one or more of the following substitutions (a) replacement of one or both of the carboxylic acid groups of the CNBDA compound with an organic acid group having 1-3, or 5-30, or more carbon atoms in chain length, wherein the carbon atom chains are either saturated, partially saturated, or unsaturated with respect to the carbon to carbon bonding, (b) replacement of the carboxylic groups of (a) with a phosphate, a sulphate, an amide, a hydroxyl, an aldehyde, or a halide group, and (c) replacement of the nonane group with an alkane having a carbon chain length of 1-8 or 10-30, or more carbon atoms. A method of treating a patient having cancer is provided.

Abstract: Various methods, systems and apparatus are provided for brain imaging during virtual reality stimulation. In one example, among others, a system for virtual ambulatory environment brain imaging includes a mobile brain imager configured to obtain positron emission tomography (PET) scans of a subject in motion, and a virtual reality (VR) system configured to provide one or more stimuli to the subject during the PET scans. In another example, a method for virtual ambulatory environment brain imaging includes providing stimulation to a subject through a virtual reality (VR) system; and obtaining a positron emission tomography (PET) scan of the subject while moving in response to the stimulation from the VR system. The mobile brain imager can be positioned on the subject with an array of imaging photodetector modules distributed about the head of the subject.

Abstract: Method comprising providing at least one solid carbide chemical compound and reducing a metal cation with use of the solid carbide chemical compound. A method comprising producing elemental carbon material from the oxidation of carbide in at least one carbide chemical compound (e.g., calcium carbide) in at least one anode of an electrochemical cell apparatus, such as a galvanic cell apparatus. The cathode can be a variety of metals such as zinc or tin. The reaction can be carried out at room temperature and normal pressure. An external voltage also can be applied, and different forms of carbon can be produced depending on the reactants used and voltage applied. For carrying out the method, an apparatus comprising at least one galvanic cell comprising: at least one anode comprising at least one carbide chemical compound, and at least one cathode.