Abstract: A probe that is a labelled segment of RNA complementary to and capable of specifically hybridizing with denatured HCV RNA, and prepared from 5' sense, GGCGACACTCCACCATGAAT and 3' antisense, ccagagcatctggcacgtgg primers, from the 5' untranslated region of the HCV genome, is employed for detecting and identifying the presence of hepatitis C virus (HCV) in tissue.

Abstract: The invention provides methods for detecting the presence of a nucleic molecule encoding a muscarinic acetylcholine receptor 6 ("mACHR-6") family member.

Abstract: A method for the enzymatic sequencing of DNA is disclosed which uses dideoxythio-nucleotides or dideoxyamino-nucleotides as terminators that are labeled with one or two fluorescent dyes coupled to the terminators either before or after polymerization. The dye labeled DNA fragments are separated in a single lane of a separation system and then the terminal bases of each of the fragments are identified by measuring the fluorescent lifetime of the dye attached to the terminators.

Abstract: This invention provides methods of (a) diagnosing; (b) determining the stage of; and (c) monitoring the effect of a therapeutic intervention for a renal cell carcinoma in a human subject which comprises detecting the expression of the MN gene. In one embodiment, the method is directed to detection of the renal cell carcinoma known as clear cell carcinoma. In another embodiment, the method is used as a peripheral blood assay. In another embodiment, the method is a polymerase chain reaction assay for amplifying and detecting the presence of the cDNA molecule encoding the MN protein.

Abstract: A novel method of primer walking using octamer oligonucleotides to prime DNA sequencing reactions is described. Octamer sequencing is compatible with isotopic and fluorescent sequencing chemistry, reaction conditions are optimized such that the samples can be processed in parallel and the procedures are automated. This strategy is faster than the traditional primer walking sequencing strategy as the existence of a primer library allows immediate access to a primer for the next sequencing reaction, eliminating delays associated with designing and synthesizing gene specific primers. The octamer library is comprised of optimized sequencing primers, such that octamer sequencing yields results equivalent to or better than traditional primer walking.

Abstract: The present invention provides a human cytochrome b5 (HCB5) and polynucleotides which encode HCB5. The invention also provides genetically engineered expression vectors and host cells and a method for producing HCBS. The invention also provides for agonists, antisense molecules, antibodies, or antagonists of HCB5, and their use in the prevention and treatment of diseases associated with expression of HCB5. The invention also provides a method for detecting polynucleotides which encode HCB5.

Abstract: A rapid assay for infection in immunodeficient patients such as neonates or immunocompromised patients (e.g. HIV or transplant patients) allows diagnosis at initial evaluation, such that antibiotic treatment and confinement to an intensive care unit can be avoided for uninfected patients. The assay can be used for detecting bacterial, viral, or fungal colonization of the blood stream, cerebrospinal fluid (CSF), or urinary tract. The method is particularly useful for sepsis diagnosis. Polymorphonuclear leukocyte (PMN, neutrophil) CD11b (Mac-1, CR3) levels are measured by flow cytometry or laser scanning microscopy in low volume (0.1 ml) whole blood samples. A dual-laser FACS identifies neutrophils by FITC-conjugated anti-CD15 fluorescent antibodies, and identifies surface neutrophil CD11b marked with PE-conjugated anti-CD11b antibodies. Spontaneous upregulation of CD11b is prevented by handling samples at 4.degree. C. or adding a stabilizing compound such as anti-CD14 antibody or adenosine to the samples.

Abstract: A test method and test kit for determining a risk of diabetic complications based upon abnormal aldose reductase genetic material expression is described. Cells isolated from a patient which exhibit elevated levels of aldose reductase genetic material expression at pathophysiologic levels of glucose (about 20 mM) which can occur commonly in the cells of diabetic patients are evaluated based upon a level of expression of DNA or RNA in the cells with the glucose at the pathophysiologic level. The cells can be used to isolate DNA or RNA for a probe which detects the abnormal aldose reductase gene expression. The method can be used to determine when particular aldose reductase inhibitors can be effective for a particular patient.

Abstract: A hybrid polypeptide is disclosed, comprising a polypeptide for attachment of a prosthetic group to avidin fused to at least one polypeptide of interest, and a method of making the same. The hybrid polypeptide is produced by recombinant DNA techniques, using a DNA expression vector composed of a DNA fragment coding for the polypeptide for attachment to avidin fused to DNA coding for one or more polypeptides of interest. The hybrid polypeptide may also contain linking amino acid sequences for cleavage of the polypeptide of interest from the polypeptide for attachment using an appropriate proteolytic or chemical reagent. The hybrid polypeptide is expressed in appropriate host cells transformed with the DNA expression vector encoding the hybrid polypeptide, and may be recovered from crude cell extracts in high yield and high purity using avidin affinity chromatography.

Abstract: Disclosed are methods for detecting mammalian genes encoding proteins which can function in microorganisms, particularly yeast, to modify, complement, or suppress a genetic defect associated with an identifiable phenotypic alteration or characteristic in the microorganism. Disclosed also are mammalian DNA sequences cloned by the above method, as well as polypeptide products of the expression of the DNA sequences in procaryotic or eucaryotic host cells and antibody substances which are specifically immunoreactive with said expression products. More specifically, the present invention relates to methods for cloning mammalian genes which encode products which modify, complement or suppress a genetic defect in a biochemical pathway in which cAMP participates or in a biochemical pathway which is controlled, directly or indirectly, by a RAS-related protein, to products (RNA, proteins) encoded by the mammalian genes cloned in this manner, and to antibodies which can bind the encoded proteins.

Abstract: The present invention provides methods of diagnosis of certain disease states, such as osteoporosis, that are associated with polymorphisms in an IL-6 gene, comprising determining the genotype of an IL-6 gene. The invention is also directed to methods of identifying an individual predisposed or susceptible to certain disease states, such as osteoporosis, associated with polymorphisms of an IL-6 gene, comprising determining the genotype of an IL-6 gene in the affected individual. The invention is further directed to compositions useful for determining the genotype of an IL-6 gene, to kits and diagnostic apparatuses comprising such compositions, and to methods of treatment of diseases associated with IL-6 genetic polymorphisms.

Abstract: The chemically-inducible 27 kD subunit of the enzyme glutathione-S-transferase, isoform II (GST-II-27) and sequences encoding it are provided. In particular, a genomic DNA sequence encoding the gene promoter for the GST-II-27 subunit is provided. Then linked to an exogenous gene and introduced into a plant by transformation, and GST-II-27 promoter provides a means for the external regulation of expression of that exogenous gene. Transformation with DNA encoding glutathione-S-transferase polypeptides produces herbicide resistance transgenic plants.

Abstract: The present invention provides nucleotide and amino acid sequences that identify and encode novel cellubrevins (cb). The present invention also provides for antisense molecules to the nucleotide sequences which encode cbs, expression vectors for the production of purified CBs, antibodies capable of binding specifically to CBs, hybridization probes or oligonucleotides for the detecting the induction of CB encoding nucleotide sequences, genetically engineered host cells for the expression of CBs, diagnostic tests for activated, inflamed or diseased cells and/or tissues based on CB-encoding nucleic acid molecules and antibodies capable of binding specifically to CBs.

Abstract: A method for detecting the presence of an assayed nucleic acid sequence in a sample is an essentially two stage-procedure. As illustrated, in a first stage the sample is reacted in a manner which gives rise to the production of a triggering oligonucleotide where the sample contains the assayed sequence. In the second stage, the reaction product is incubated under appropriate conditions with an amplification system whereby, in the presence of triggering oligonucleotide, a large amount of a nucleic acid product is obtained. The detection of this product thus indicates the presence of the assayed sequence in the sample.

Abstract: New mutations have been found in the BRCA2 gene. The mutations are located at nucleotide numbers 2192, 3772, 5193, 5374, 6495 or 6909 of the published nucleotide sequence of BRCA2 gene. A process for identifying a sequence variation in a BRCA2 polynucleotide sequence is disclosed. The identification process includes allele specific sequence-based assays of known sequence variations. The methods can be used for efficient, and accurate detection of a mutation in a test BRCA2 gene sample.

Abstract: A novel Pseudomonas fluorescens is disclosed which has an antagonist property against pathogenic fungi of the genera Pythium, Rhizoctonia, Sclerotinia and Gaeumannomyces and which has a DNA that forms a PCR product band at about 800 bp when replicated and amplified by PCR using a primer DNA having the base sequence of 5'-GGCAACTGCACAAGCGCCA (SEQ ID NO: 1) and a primer DNA having the base sequence of 5'-GCCAATCACGCCCTCAAGCT (SEQ ID NO: 2) and then electrophoresed on agarose gel. This microorganism can also promote the growth of plants. A material for controlling pathogenic fungi of plants, particularly, lawn grass, a plant growth promoting material and a compost comprising the microorganism are also disclosed.

Abstract: The invention relates to a process for the controlled amplification of at least one part of a starting DNA containing a plurality of restriction sites for a determined specific restriction endonuclease, and of which at least part of its nucleic acid is unknown.Application of this process to human, animal or plant DNA fingerprinting, to identification of restriction fragment length polymorphisms.Kit for the application of the process.

Abstract: An improved method of extracting nucleic acids from a sample comprising mixing the sample with a carrier which is at least one member selected from the group consisting of dextran, acrylamide and carboxymethyl cellulose to form a liquid mixture; mixing said liquid mixture with reagent C to render the nucleic acids and the carrier insoluble, said reagent C containing at least one reagent A selected from the group consisting of guanidinium thiocyanate, guanidinium hydrochloride, potassium thiocyanate and sodium thiocyanate and at least one reagent B selected from the group consisting of n-propyl alcohol, isopropyl alcohol, n-butyl alcohol, sec-butyl alcohol, tert-butyl alcohol, and tert-amyl alcohol; and separating the insolubilized nucleic acids and carrier from the liquid phase.

Abstract: A method for determining whether an individual is at increased risk for thrombosis, comprising detecting the presence or absence of a genetic mutation located in the 3' untanslated region of the prothrombin gene (G to A mutation at position 20210) that is correlated with elevated prothrombin levels in individuals with the mutation, wherein the elevated prothrombin levels are associated with increased risk for thrombosis. Also provided are kits and primers that specifically hybridize adjacent to the region of the prothrombin gene that contains the G to A mutation at position 20210.

Abstract: The disclosure describes a new method for intermolecular recognition between two molecules, where complementary oligonucleotide strands bind in aqueous solution, where these strains contain non-standard nucleobases that can pair to fit the Watson-Crick geometry in that they involve a monocyclic six membered ring pairing with a fused bicyclic heterocyclic ring system composed of a five member ring fused with a six membered ring, with the orientation of the heterocycles with respect to each other and with respect to the backbone chain analogous to that found in DNA and RNA, but with a pattern of hydrogen bonds holding the base pair together different from that found in the AT and GC base pairs (a "non-standard base pair").