Patents by Inventor Ajit Kumar Shasany
Ajit Kumar Shasany has filed for patents to protect the following inventions. This listing includes patent applications that are pending as well as patents that have already been granted by the United States Patent and Trademark Office (USPTO).
-
Publication number: 20210403827Abstract: The present invention relates to the development of high viridiflorol containing variety for enhancing the aroma as well as medicinal properties of Mentha piperita by overexpressing MPTPS4 gene through genetic transformation. This transgenic plant possesses better growth and able to produce essential oil with good quality contains high viridiflorol maximum of about 25% and proportionate decrease in menthone, menthofuran and menthol of Mentha piperita as compared to other control genotype. Mentha piperita (CIM-madhuras) that produces viridiflorol, a molecule of potential demand in perfumery, cosmetics, toiletries, drugs and sanitation products.Type: ApplicationFiled: April 9, 2021Publication date: December 30, 2021Inventors: Ajit Kumar SHASANY, Pallavi YADAV, Shubhra RASTOGI, Syed Uzma JALIL, Rajendra Singh BHAKUNI
-
Publication number: 20160366805Abstract: The present invention relates to the development of a novel, morphologically and genetically distinct khusinol rich essential oil producing clone of vetiver [Vetiveria zizaniodes (L.) Nash. syn. Chrysopogon zizanioides (L.) Roberty; family Poacaeae} named ‘CIMAP-Khusinolika’. The plant of this clone is characterized by spreading type clump canopy in the initial stage, white feathery stigma and capable of producing >1% (v/w) essential oil containing 45-50% Khusinol (v/v) obtained after hydro-distillation from fresh roots harvested from 6 month old plantations. This clone has unique ISSR profiles that serve as DNA-fingerprints. The clone was obtained through recurrent selection in polycrossed population generated from the bulk of wild collection, and can be propagated through vegetative slips (3 to 6 month old stem with few roots) for commercial plantation as a short duration crop.Type: ApplicationFiled: June 15, 2015Publication date: December 15, 2016Inventors: Harmesh Singh Chauhan, Hemendra Pratap Singh, Chandan Singh Chanotiya, Ajit Kumar Shasany, Umesh Chandra Lavania, Virendra Kumar Singh Tomar, Alok Kalra, Ashok Kumar Singh
-
Patent number: 7510836Abstract: The present invention relates to an alpha-arteether resistance domain (ADR) of Sequence ID No.1 and a method of identifying ADR in alpha-arteether resistant pathogens and lastly, it relates to set three pairs of primers of sequence ID Nos. 3 to 8.Type: GrantFiled: March 26, 2004Date of Patent: March 31, 2009Assignee: Council of Scientific & Industrial ResearchInventors: Suman Preet Singh Khanuja, Suchi Srivastava, Ajit Kumar Shasany, Tiruppadiripuliyur Ranganathan Santha Kumar, Mahendra Pandurang Darokar, Preeti Chand, Sushil Kumar
-
Patent number: 7473768Abstract: The present invention relates to a pair of primers with forward primer of SEQ ID NO. 1 having sequence of CCAAGCTTGCTGAACGCATCGG, and reverse primer of SEQ ID No. 2 having sequence of CCAAGCTTGCCACGCAGGATTATC, and a screening method for early identification of plants Artemisia annua having high content of artemisinin and thereby helping generation of plant population with further high content of artemisinin.Type: GrantFiled: March 31, 2004Date of Patent: January 6, 2009Assignee: Council of Scientific & Industrial ResearchInventors: Suman Preet Singh Khanuja, Shilpi Paul, Ajit Kumar Shasany, Mahendra Pandurang Darokar, Ashutosh Kumar Shukla, Madan Mohan Gupta, Anuruddha Kumar
-
Patent number: 7446243Abstract: The present invention relates to a cultivar of Phyllanthus amarus ‘CIM-Jeevan’, producing high amount of herb, phyllanthin and hypophyllanthin, wherein said cultivar is developed through ?-irradiation of superior germplasm, the said plant produces high amount of herbage yield ranging between 1.0-1.15 kg per sqm fresh total plant herb, possesses high vegetative erect growth with a height ranging between 60 to 65 cm, produces phyllanthin ranging between 0.70-0.77% in dry herb, produces hypophyllanthin ranging between 0.32-0.37% in dry herb, and shows seed germination of about 90%.Type: GrantFiled: August 25, 2003Date of Patent: November 4, 2008Assignee: Council of Scientific and Industrial ResearchInventors: Anil Kumar Gupta, Suman Preet Singh Khanuja, Madan Mohan Gupta, Ajit Kumar Shasany, Neeraj Jain, Ram Kishor Verma, Mahendra Pandurang Darokar, Guru Das Bagchi, Sushil Kumar
-
Patent number: 7435877Abstract: Indian basil, Ocimum basilicum, belongs to the family of Lamiaceae. The essential oil of Indian basil extracted via hydro or steam distillation from the leaves or whole plants is used to flavor foods, dental and oral products, in fragrances, and in traditional rituals and medicines. Extracted essential oil has also been shown to contain biologically active constituents that are insecticidal, nematicidal, fungistatic or which have antimicrobial properties. The present invention relates to the development of an early, short duration, dwarf, high essential oil, methy chavicol and linalool yielding variety of Indian basil (Ocimum basilicum). Family—Lamiaceae) named as ‘CIM-SAUMYA’. This new variety of Indian basil was developed through open pollination in the germplasm followed by half-sib progeny selection and evaluation for the yield characters of selected population for 3 years in field conditions.Type: GrantFiled: August 6, 2004Date of Patent: October 14, 2008Assignee: Council of Scientific & Industrial ResearchInventors: Suman Preet Singh Khanuja, Raj Kishori Lal, Arun Kumar Agnihotri, Ajit Kumar Shasany, Ali Arif Naqvi, Samresh Dwivedi, Hari Om Misra, Om Prakesh Dhawan, Alok Kalra, Aparbal Singh, Janak Raj Bahl, Saudan Singh, Dharani Dhar Patra, Shilpi Agarwal, Mahendra Pandurang Darokar, Anil Kumar Gupta, Moti Lal Gupta, Ram Chandra
-
Patent number: 7375260Abstract: The present invention is related to the development of a novel, distinct high herb and artemisinin yielding genotype of Artemisia annua obtained through systematic marker assisted breeding followed by selection of uniform population in a methodical way wherein the genotype is distinct, uniform and stably maintainable by continuous rouging of off types in the population using DNA marker at early seedling stage from nursery itself and suitable for commercial cultivation.Type: GrantFiled: January 18, 2006Date of Patent: May 20, 2008Assignee: Council of Scientific and Industrial ResearchInventors: Suman Preet Singh Khanuja, Shilpi Paul, Ajit Kumar Shasany, Anil Kumar Gupta, Mahendra Pandurang Darokar, Madan Mohan Gupta, Ram Kishor Verma, Govind Ram, Anuraddha Kumar, Raj Kishori Lal, Ravi Prakash Bansal, Anil Kumar Singh, Rajendra Singh Bhakuni, Sudeep Tandon
-
Patent number: 7291349Abstract: The present invention provides an improved preparation based on the synergistic action of garlic extract and essential oil of M. spicata var. Ganga or cinnamon oil against dermatophytic fungus. More particularly, the present invention relates to the synergistic enhancement of activity of a combination by menthyl acetate or Geraniol. The invention also provides a method of preparation of the synergistic combination and the shelf life observed to be more than one year. The cream based preparation is a potent anti-dermatophytic as described and illustrated by in vitro and in vivo evaluations.Type: GrantFiled: January 21, 2004Date of Patent: November 6, 2007Inventors: Suman Preet Singh Khanuja, Pushplata Chaturvedi, Anil Kumar Singh, Ajit Kumar Shasany, Vinay Kumar Agarwal, Vivek Kumar Gupta, Subhash Chandra Gupta, Arun Kumar Tripathy, Anirban Pal, Dharmendra Saikia, Mahendra Pandurang Darokar, Krishna Kumar Aggarwal, Ravi Prakash Bansal
-
Patent number: 7262004Abstract: An in vitro screening method for identifying insect tolerant genotypes or clones is described. The method comprises growing plantlets in an in vitro system, screening the plantlets for molecular variation of somaclones using RAPD analysis in vitro, selecting the somaclones having molecular variation, exposing the somaclones to insect larvae or nymphs and identifying the surviving somaclones.Type: GrantFiled: January 18, 2000Date of Patent: August 28, 2007Assignee: Council of Scientific and Industrial ResearchInventors: Suman Preet Singh Khanuja, Ajit Kumar Shasany, Sunita Dhawan, Mahendra Pandurang Darokar, Sarita Satapathy, Tiruppadiripuliyur Ranganathan Santha Kumar, Dharmendra Saikia, Nirmal Kumar Patra, Janak Raj Bahl, Arun Kumar Tripathy, Sushil Kumar
-
Patent number: 7262003Abstract: The present invention relates to a method of testing Bacopa monnieri response to abiotic stress factors and for testing bioactivity of natural, synthetic and semisynthetic compounds using Bacopa monnieri plant, which comprises growing the said plant and plant parts aseptically in MS 0 basal medium with agar in microcentrifuge tubes by adding the compounds to be tested either to the culture media or by spraying the said compounds on the plant or plant parts or on the said medium to detect the distinct morphological and cytological responses.Type: GrantFiled: December 13, 2002Date of Patent: August 28, 2007Assignee: Council of Scientific and Industrial ResearchInventors: Sushil Kumar, Suman Preet Singh Khanuja, Mahendra Pandurang Darokar, Tiruppadiripuliyur Ranganathan Santha Kumar, Anita Gangwar, Ajit Kumar Shasany, Srilekha Mishra, Shalini Mathur, Dharmendra Saikia
-
Patent number: 7235262Abstract: The invention relates to a novel pharmaceutical composition comprising an effective amount of bio-active fraction from cow urine distillate as a bioavailability facilitator and pharmaceutically acceptable additives selected from anticancer compounds, antibiotics, drugs, therapeutic and nutraceutic agents, ions and similar molecules which are targeted to the living systems.Type: GrantFiled: April 13, 2004Date of Patent: June 26, 2007Assignee: Council of Scientific and Industrial ResearchInventors: Suman Preet Singh Khanuja, Sushil Kumar, Ajit Kumar Shasany, Jai Shankar Arya, Mahendra Pandurang Darokar, Monika Singh, Prachi Sinha, Soumya Awasthi, Subhash Chandra Gupta, Vivek Kumar Gupta, Madan Mohan Gupta, Ram Kishore Verma, Sweta Agarwal, Sunil Balkrishna Mansinghka, Suresh Haribhau Dawle
-
Patent number: 7211428Abstract: The present invention relates to the selection and development of superior strain of Bacillus spp for improving plant growth and health by inhibiting pathogenic fungi.Type: GrantFiled: May 18, 2004Date of Patent: May 1, 2007Assignee: Council of Scientific and Industrial ResearchInventors: Abdul Sattar, Mansoor Alam, Abdul Khaliq, Suman Preet Singh Khanuja, Alok Kalra, Abdul Samad, Ajit Kumar Shasany, Mahendra Pandurang Darokar, Ashutosh Kumar Shukla, Togarati Padmapriya, Mohammad Yaseen, Om Parkash Dhawan, Mohammad Zaim, Poovappallivadakethil Viswanathan Nair Ajaya Kumar
-
Publication number: 20070089211Abstract: The present invention is related to the development of a novel, distinct high herb and artemisinin yielding genotype of Artemisia annua obtained through systematic marker assisted breeding followed by selection of uniform population in a methodical way wherein the genotype is distinct, uniform and stably maintainable by continuous rouging of off types in the population using DNA marker at early seedling stage from nursery itself and suitable for commercial cultivation.Type: ApplicationFiled: January 18, 2006Publication date: April 19, 2007Inventors: Suman Khanuja, Shilpi Paul, Ajit Kumar Shasany, Anil Gupta, Mahendra Darokar, Madan Gupta, Ram Verma, Govind Ram, Anuraddha Kumar, Raj Lal, Ravi Bansal, Anil Singh, Rajendra Bhakuni, Sudeep Tandon
-
Patent number: 7135590Abstract: This invention provides a plant growth regulatory activity of a new biologically active synthetic molecule methanone-(3?,4?,5?-trimethoxy) phenyl, 1-naphthyl, 2-O-4?-ethyl but-2?-enoate. More particularly, the invention relates to the potent plant growth promoting activity of a gallic acid derivative having a structure represented by Formula 1 and a molecular formulae C26H26O7. This invention also provides a novel process for preparation of said molecule from a naturally occurring compound and testing it for growth regulating activity using Bacopa test system developed at CIMAP (Khanuja et al.Type: GrantFiled: August 17, 2004Date of Patent: November 14, 2006Assignee: Council of Scientific and Industrial ResearchInventors: Suman Preet Singh Khanuja, Mahendra Pandurang Darokar, Ankur Garg, Togarrati Padmapriya, Ajit Kumar Shasany, Arvind Singh Negi, Sunia Kumar Chattopadhyay, Kachin Srivastava, Asish Kumar Bhattacharya
-
Publication number: 20060057234Abstract: The invention relates to a new use of a non-alkaloid compound that is plant derived glycoside ‘glycyrrhizin’ as a highly potent bio-enhancer of activity and availability of antibiotics and other drugs including anti-infective and anticancer agents. The molecule of invention facilitates the absorption/uptake of antibiotics and other molecules across the cell membrane in plant and animal cells as well as Gram-positive and Gram-negative bacteria and therefore can be used as a drug facilitator or bioenhancer molecule to increase the affectivity of drugs and nutraceutical agents. The compound having no antimicrobial or cytotoxic activity of its own, is a safe candidate to reduce the drug dosage towards circumventing the problem of drug resistance and the other side effects in anti-infective and anti-cancer therapies.Type: ApplicationFiled: November 9, 2005Publication date: March 16, 2006Inventors: Suman Preet Singh Khanuja, Sushil Kumar, Jai Shankar Arya, Ajit Kumar Shasany, Monika Singh, Soumya Awasthi, Subhas Chandra Gupta, Mahendra Pandurang Darokar, Laiq-Ur Rahman
-
Patent number: PP16474Abstract: The present invention relates to a new and distinct mint plant of Mentha piperita ‘Cim Indus’, selected through screening, field trial and analysis of monoterpene constituents of the essential oil of the germplasm, possessing the characters of producing high amount of menthofuran ranging between 22 to 30% of total oil content, high amount pulegone ranging between 9.0 to 18% of total oil content, with essential oil content ranging between 0.32 to 0.40% of the total oil content.Type: GrantFiled: December 29, 2003Date of Patent: April 25, 2006Assignee: Council of Scientific and Industrial ResearchInventors: Suman Preet Singh Khanuja, Nirmal Kumar Patra, Ajit Kumar Shasany, Birendra Kumar, Soni Gupta, Rakesh Kumar Upadhyay, Togarrati Padma Priya, Anil Kumar Singh, Mahendra Pandurang Darokar, Virendra Kumar Singh Tomar, Janak Raj Bahal, Raj Kishori Lal
-
Patent number: PP16566Abstract: The present invention was related to the development of a novel, distinct high yielding plant with rapid regeneration ability obtained through screening of the somaclones in a methodical way for fast regeneration in the tissue culture stage itself which was achieved by inventing the plant ‘Kushal’. The plant yield higher herbage with corresponding high essential oil when evaluated with available superior varieties of mint in late planting condition during April when the fields are vacated after the harvest of Rabi crop like wheat, chickpea, coriander etc. Further the suckers required for commercial vegetative planting can be produced even in low land condition as the plant is reasonably tolerant to water logging compared to the best check ‘Kosi’.Type: GrantFiled: March 31, 2003Date of Patent: May 23, 2006Assignee: Council of Scientific and Industrial ResearchInventors: Suman Preet Singh Khanuja, Ajit Kumar Shasany, Usha Yadav, Sunita Dhawan, Mahendra Pandurang Darokar, Janak Raj Bahl, Soni Gupta, Sweta Pandey, Anil Kumar Singh, Ravi Prakash Bansal, Raj Kishori Lal, Om Parkash Dhawan, Ali Arif Naqvi, Alok Kaira, Alok Krishna, Virendra Kumar Singh Tomar, Anil Kumar Singh
-
Patent number: PP16712Abstract: A new and distinct high essential oil variety of lemongrass (Cymbopogon flexuosus) is named ‘Nima’. Further, the invention relates to the high content of the monoterpene citral in the essential oil. This novel variety ‘Nima’ of lemongrass is a selection from the open pollinated seedlings of the seeds obtained from another Cymbopogon flexuosus variety OD 19 from the germ plasm collection of CIMAP. This variety is propagated through vegetative means using the slips and is stable for commercial cultivation.Type: GrantFiled: March 31, 2003Date of Patent: June 27, 2006Assignee: Council of Scientific & Industrial ResearchInventors: Raj Kishori Lal, Hari Om Misra, Jawahar Ram Sharma, Nilakshi Singh, Ajit Kumar Shasany, Ali Arif Naqvi, Janak Raj Bahl, Arun Prasad, Suman Preet Singh Khanuja
-
Patent number: PP17505Abstract: This invention relates to a new distinct early maturing, high seed and husk yielding variety of psyllium (Plantago ovata) designated as var. ‘Mayuri’ with the distinct pigment marker of the panicles relatable to the maturity thereby indicating the right harvesting stage to prevent the seed shattering, a problem in psyllium. This variety was developed by mutation breeding (gamma rays irradiation) and propagated by seeds for commercial cultivation. The new variety could be differentiated from the other variety through unique RAPD profile and has been tested for uniformity and stability of characters defined. Psyllium plant ‘Mayuri’ with stage marker and early maturity.Type: GrantFiled: March 31, 2003Date of Patent: March 20, 2007Assignee: Council of Scientific Industrial ResearchInventors: Raj Kishori Lal, Nilakshi Singh, Hari Om Misra, Jawahar Ram Sharma, Janak Raj Bahl, Ajit Kumar Shasany, Suman Preet Singh Khanuja
-
Patent number: PP28388Abstract: The present invention relates to the development of a novel, morphologically and genetically distinct khusinol rich essential oil producing clone of vetiver [Vetiveria zizaniodes (L.) Nash. syn. Chrysopogon zizanioides (L.) Roberty; family Poacaeae} named ‘CIMAP-Khusinolika’. The plant of this clone is characterized by spreading type clump canopy in the initial stage, white feathery stigma and capable of producing >1% (v/w) essential oil containing 45-50% Khusinol (v/v) obtained after hydro-distillation from fresh roots harvested from 6 month old plantations. This clone has unique ISSR profiles that serve as DNA-fingerprints. The clone was obtained through recurrent selection in polycrossed population generated from the bulk of wild collection, and can be propagated through vegetative slips (3 to 6 month old stem with few roots) for commercial plantation as a short duration crop.Type: GrantFiled: June 15, 2015Date of Patent: September 12, 2017Assignee: Council of Scientific and Industrial ResearchInventors: Harmesh Singh Chauhan, Hemendra Pratap Singh, Chandan Singh Chanotiya, Ajit Kumar Shasany, Umesh Chandra Lavania, Virendra Kumar Singh Tomar, Alok Kalra, Ashok Kumar Singh