Abstract: Aspects of the invention provide single stranded oligonucleotides for activating or enhancing expression of APOA1 or ABCA1. Further aspects provide compositions and kits comprising single stranded oligonucleotides for activating or enhancing expression of APOA1 or ABCA1. Methods for modulating expression of APOA1 or ABCA1 using the single stranded oligonucleotides are also provided. Further aspects of the invention provide methods for selecting a candidate oligonucleotide for activating or enhancing expression of APOA1 or ABCA1.

Abstract: Aspects of the invention provide single stranded oligonucleotides for activating or enhancing expression of ATP2A2. Further aspects provide compositions and kits comprising single stranded oligonucleotides for activating or enhancing expression of ATP2A2. Methods for modulating expression of ATP2A2 using the single stranded oligonucleotides are also provided. Further aspects of the invention provide methods for selecting a candidate oligonucleotide for activating or enhancing expression of ATP2A2.

Abstract: Aspects of the invention provide single stranded oligonucleotides for activating or enhancing expression of PTEN. Further aspects provide compositions and kits comprising single stranded oligonucleotides for activating or enhancing expression of PTEN. Methods for modulating expression of PTEN using the single stranded oligonucleotides are also provided. Further aspects of the invention provide methods for selecting a candidate oligonucleotide for activating or enhancing expression of PTEN.

Abstract: Aspects of the invention provide single stranded oligonucleotides for activating or enhancing expression of MECP2. Further aspects provide compositions and kits comprising single stranded oligonucleotides for activating or enhancing expression of MECP2. Methods for modulating expression of MECP2 using the single stranded oligonucleotides are also provided. Further aspects of the invention provide methods for selecting a candidate oligonucleotide for activating or enhancing expression of MECP2.

Abstract: Aspects of the invention provide single stranded oligonucleotides for activating or enhancing expression of a target gene. Further aspects provide compositions and kits comprising single stranded oligonucleotides for activating or enhancing expression of a target gene. Methods for modulating expression of a target gene using the single stranded oligonucleotides are also provided. Further aspects of the invention provide methods for selecting a candidate oligonucleotide for activating or enhancing expression of a target gene.

Abstract: Aspects of the invention provide single stranded oligonucleotides for activating or enhancing expression of BDNF. Further aspects provide compositions and kits comprising single stranded oligonucleotides for activating or enhancing expression of BDNF. Methods for modulating expression of BDNF using the single stranded oligonucleotides are also provided. Further aspects of the invention provide methods for selecting a candidate oligonucleotide for activating or enhancing expression of BDNF.

Abstract: Aspects of the invention provide single stranded oligonucleotides for activating or enhancing expression of hemoglobin genes (HBB, HBD, HBE1, HBG1 or HBG2). Further aspects provide compositions and kits comprising single stranded oligonucleotides for activating or enhancing expression of hemoglobin genes. Methods for modulating expression of hemoglobin genes using the single stranded oligonucleotides are also provided. Further aspects of the invention provide methods for selecting a candidate oligonucleotide for activating or enhancing expression of hemoglobin genes.

Abstract: Aspects of the invention provide methods for selecting a candidate oligonucleotide for activating expression of a target gene. Further aspects of the invention provide methods of selecting a set of oligonucleotides that is enriched in oligonucleotides that activate expression of a target gene. Further aspects provide single stranded oligonucleotides that modulate gene expression and compositions and kits comprising the same. Methods for modulating gene expression using the single stranded oligonucleotides are also provided.

Abstract: Aspects of the invention provide single stranded oligonucleotides for activating or enhancing expression of UTRN. Further aspects provide compositions and kits comprising single stranded oligonucleotides for activating or enhancing expression of UTRN. Methods for modulating expression of UTRN using the single stranded oligonucleotides are also provided. Further aspects of the invention provide methods for selecting a candidate oligonucleotide for activating or enhancing expression of UTRN.

Abstract: A class of immunostimulatory nucleic acids having at least two functionally and structurally defined domains is provided. This class of combination motif immunostimulatory nucleic acids activates an immune response and is useful for treating a variety of immune related disorders such as cancer, infectious disease, and allergic disorders. The nucleic acids also stimulate activation of natural killer cells and production of type 1 interferon.

Abstract: Oligonucleotides containing unthylated CpG dinucleotides and therapeutic utilities based on their ability to stimulate an immune response in a subject are disclosed. Also disclosed are therapies for treating diseases associated with immune system activation that are initiated by unthylated CpG dinucleotides in a subject comprising administering to the subject oligonucleotides that do not contain unmethylated CpG sequences (i.e. methylated CpG sequences or no CpG sequence) to outcompete unmethylated CpG nucleic acids for binding. Further disclosed are methylated CpG containing dinucleotides for use antisense therapies or as in vivo hybridization probes, and immunoinhibitory oligonucleotides for use as antiviral therapeutics.

Abstract: The invention relates to a class of soft or semi-soft CpG immunostimulatory oligonucleotides that are useful for stimulating an immune response.

Abstract: The invention relates to a class of soft or semi-soft CpG immunostimulatory oligonucleotides that are useful for stimulating an immune response.

Abstract: Nucleic acids containing unmethylated CpG dinucleotides and therapeutic utilities based on their ability to stimulate an immune response and to redirect a Th2 response to a Th1 response in a subject are disclosed. Methods for treating atopic diseases, including atopic dermatitis, are disclosed.

Abstract: Immunostimulatory oligonucleotides, which contain a CpG immunostimulatory motif and a second motif that is capable of forming secondary structure, including duplex and higher order structures in vitro and in vivo, are disclosed. They include nucleic acids, or pharmaceutically acceptable salts thereof, having base sequences that include 5? TCGTCGTTTTCGGCGCGCGCCGT 3? (SEQ ID NO: 1), in which each C is unmethylated and 3? refers to the 3? end of the nucleic acid. The oligonucleotides activate B cells and NK cells and induce expression of type I interferon and interferon-?. The oligonucleotides are useful for treating a variety of disorders and conditions, including allergy, asthma, infection, and cancer. In addition to their use as single agents and as combination therapies, the disclosed oligonucleotides are useful as adjuvants in vaccines.

Abstract: The present invention relates generally to adjuvants, and in particular to methods and products utilizing a synergistic combination of immunostimulatory oligonucleotides having at least one unmethylated CpG dinucleotide (CpG ODN) and a non-nucleic acid adjuvant. Such combinations of adjuvants may be used with an antigen or alone. The present invention also relates to methods and products utilizing immunostimulatory oligonucleotides having at least one unmethylated CpG dinucleotide (CpG ODN) for induction of cellular immunity in infants.

Abstract: Immunostimulatory oligonucleotides, which contain a CpG immunostimulatory motif and a second motif that is capable of forming secondary structure, including duplex and higher order structures in vitro and in vivo, are disclosed. They include nucleic acids, or pharmaceutically acceptable salts thereof, having base sequences that include 5? TCGTCGTTTTCGGCGCGCGCCGT 3? (SEQ ID NO: 1), in which each C is unmethylated and 3? refers to the 3? end of the nucleic acid. The oligonucleotides activate B cells and NK cells and induce expression of type I interferon and interferon-?. The oligonucleotides are useful for treating a variety of disorders and conditions, including allergy, asthma, infection, and cancer. In addition to their use as single agents and as combination therapies, the disclosed oligonucleotides are useful as adjuvants in vaccines.

Abstract: The invention relates to a class of CpG immunostimulatory oligonucleotides containing a CpG immunostimulatory motif and a second motif which is capable of forming secondary structure, including duplex and higher order structures, in vitro and in vivo. The oligonucleotides of the invention are useful as adjuvants in vaccination. The oligonucleotides are also useful for inducing an immune response, inducing expression of a type I interferon (IFN), inducing expression of gamma interferon (IFN-?), and for treating a variety of conditions, including allergy, asthma, infection, and cancer.

Abstract: Nucleic acids containing unmethylated CpG dinucleotides and therapeutic utilities based on their ability to stimulate an immune response and to redirect a Th2 response to a Th1 response in a subject are disclosed. Methods for treating atopic diseases, including atopic dermatitis, are disclosed.

Abstract: Oligonucleotides containing unthylated CpG dinucleotides and therapeutic utilities based on their ability to stimulate an immune response in a subject are disclosed. Also disclosed are therapies for treating diseases associated with immune system activation that are initiated by unthylated CpG dinucleotides in a subject comprising administering to the subject oligonucleotides that do not contain unmethylated CpG sequences (i.e. methylated CpG sequences or no CpG sequence) to outcompete unmethylated CpG nucleic acids for binding. Further disclosed are methylated CpG containing dinucleotides for use antisense therapies or as in vivo hybridization probes, and immunoinhibitory oligonucleotides for use as antiviral therapeutics.