Patents by Inventor Arthur M. Krieg

Arthur M. Krieg has filed for patents to protect the following inventions. This listing includes patent applications that are pending as well as patents that have already been granted by the United States Patent and Trademark Office (USPTO).

  • Patent number: 8283328
    Abstract: The invention relates to a class of soft or semi-soft CpG immunostimulatory oligonucleotides that are useful for stimulating an immune response.
    Type: Grant
    Filed: August 19, 2003
    Date of Patent: October 9, 2012
    Assignees: Coley Pharmaceutical Group, Inc., Coley Pharmaceutical GmbH
    Inventors: Arthur M. Krieg, Grayson Lipford, Ulrike Samulowitz, Jörg Vollmer, Eugen Uhlmann, Marion Jurk, Robert Rankin
  • Patent number: 8258106
    Abstract: Nucleic acids containing unmethylated CpG dinucleotides and therapeutic utilities based on their ability to stimulate an immune response and to redirect a Th2 response to a Th1 response in a subject are disclosed. Methods for treating atopic diseases, including atopic dermatitis, are disclosed.
    Type: Grant
    Filed: November 10, 2006
    Date of Patent: September 4, 2012
    Assignees: University of Iowa Research Foundation, Coley Pharmaceutical Group, Inc., The United States of America, as represented by the Department of Health and Human Services
    Inventors: Arthur M. Krieg, Joel N. Kline, Dennis Klinman, Alfred D. Steinberg
  • Publication number: 20120219571
    Abstract: Immunostimulatory oligonucleotides, which contain a CpG immunostimulatory motif and a second motif that is capable of forming secondary structure, including duplex and higher order structures in vitro and in vivo, are disclosed. They include nucleic acids, or pharmaceutically acceptable salts thereof, having base sequences that include 5? TCGTCGTTTTCGGCGCGCGCCGT 3? (SEQ ID NO: 1), in which each C is unmethylated and 3? refers to the 3? end of the nucleic acid. The oligonucleotides activate B cells and NK cells and induce expression of type I interferon and interferon-?. The oligonucleotides are useful for treating a variety of disorders and conditions, including allergy, asthma, infection, and cancer. In addition to their use as single agents and as combination therapies, the disclosed oligonucleotides are useful as adjuvants in vaccines.
    Type: Application
    Filed: May 14, 2012
    Publication date: August 30, 2012
    Applicants: COLEY PHARMACEUTICAL GMBH, PFIZER INC, COLEY PHARMACEUTICAL GROUP, INC.
    Inventors: JORG VOLLMER, EUGEN UHLMANN, ARTHUR M. KRIEG, DOUGLAS C. HANSON, ULRIKE SAMULOWITZ
  • Patent number: 8202688
    Abstract: The present invention relates generally to adjuvants, and in particular to methods and products utilizing a synergistic combination of immunostimulatory oligonucleotides having at least one unmethylated CpG dinucleotide (CpG ODN) and a non-nucleic acid adjuvant. Such combinations of adjuvants may be used with an antigen or alone. The present invention also relates to methods and products utilizing immunostimulatory oligonucleotides having at least one unmethylated CpG dinucleotide (CpG ODN) for induction of cellular immunity in infants.
    Type: Grant
    Filed: November 20, 2002
    Date of Patent: June 19, 2012
    Assignees: University of Iowa Research Foundation, Coley Pharmaceutical GmbH, Ottawa Health Research Institute
    Inventors: Heather L. Davis, Joachim Schorr, Arthur M. Krieg
  • Patent number: 8198251
    Abstract: Immunostimulatory oligonucleotides, which contain a CpG immunostimulatory motif and a second motif that is capable of forming secondary structure, including duplex and higher order structures in vitro and in vivo, are disclosed. They include nucleic acids, or pharmaceutically acceptable salts thereof, having base sequences that include 5? TCGTCGTTTTCGGCGCGCGCCGT 3? (SEQ ID NO: 1), in which each C is unmethylated and 3? refers to the 3? end of the nucleic acid. The oligonucleotides activate B cells and NK cells and induce expression of type I interferon and interferon-?. The oligonucleotides are useful for treating a variety of disorders and conditions, including allergy, asthma, infection, and cancer. In addition to their use as single agents and as combination therapies, the disclosed oligonucleotides are useful as adjuvants in vaccines.
    Type: Grant
    Filed: August 12, 2008
    Date of Patent: June 12, 2012
    Assignees: Coley Pharmaceutical GmbH, Coley Pharmaceutical Group, Inc., Pfizer Inc
    Inventors: Jorg Vollmer, Eugen Uhlmann, Arthur M. Krieg, Douglas C. Hanson, Ulrike Samulowitz
  • Patent number: 8188254
    Abstract: The invention relates to a class of CpG immunostimulatory oligonucleotides containing a CpG immunostimulatory motif and a second motif which is capable of forming secondary structure, including duplex and higher order structures, in vitro and in vivo. The oligonucleotides of the invention are useful as adjuvants in vaccination. The oligonucleotides are also useful for inducing an immune response, inducing expression of a type I interferon (IFN), inducing expression of gamma interferon (IFN-?), and for treating a variety of conditions, including allergy, asthma, infection, and cancer.
    Type: Grant
    Filed: October 29, 2004
    Date of Patent: May 29, 2012
    Assignees: Coley Pharmaceutical GmbH, Coley Pharmaceutical Group, Inc.
    Inventors: Eugen Uhlmann, Jörg Vollmer, Arthur M. Krieg, Bernhard O. Noll
  • Patent number: 8158592
    Abstract: Nucleic acids containing unmethylated CpG dinucleotides and therapeutic utilities based on their ability to stimulate an immune response and to redirect a Th2 response to a Th1 response in a subject are disclosed. Methods for treating atopic diseases, including atopic dermatitis, are disclosed.
    Type: Grant
    Filed: January 7, 2005
    Date of Patent: April 17, 2012
    Assignees: Coley Pharmaceutical Group, Inc., The United States of America, as represented by the Department of Health and Human Services, University of Iowa Research Foundation
    Inventors: Arthur M. Krieg, Joel Kline, Dennis Klinman, Alfred D. Steinberg
  • Patent number: 8148340
    Abstract: Oligonucleotides containing unthylated CpG dinucleotides and therapeutic utilities based on their ability to stimulate an immune response in a subject are disclosed. Also disclosed are therapies for treating diseases associated with immune system activation that are initiated by unthylated CpG dinucleotides in a subject comprising administering to the subject oligonucleotides that do not contain unmethylated CpG sequences (i.e. methylated CpG sequences or no CpG sequence) to outcompete unmethylated CpG nucleic acids for binding. Further disclosed are methylated CpG containing dinucleotides for use antisense therapies or as in vivo hybridization probes, and immunoinhibitory oligonucleotides for use as antiviral therapeutics.
    Type: Grant
    Filed: July 9, 2004
    Date of Patent: April 3, 2012
    Assignees: The United States of America as represented by the Department of Health and Human Services, University of Iowa Research Foundation, Pfizer Inc.
    Inventors: Arthur M. Krieg, Dennis Klinman, Alfred D. Steinberg
  • Patent number: 8129351
    Abstract: Nucleic acids containing unmethylated CpG dinucleotides and therapeutic utilities based on their ability to stimulate an immune response and to redirect a Th2 response to a Th1 response in a subject are disclosed. Methods for treating atopic diseases, including atopic dermatitis, are disclosed.
    Type: Grant
    Filed: February 25, 2005
    Date of Patent: March 6, 2012
    Assignees: The University of Iowa Research Foundation, Coley Pharmaceutical Group, Inc., The United States of America as represented by the Secretary of the Department of Health and Human Services
    Inventors: Arthur M. Krieg, Dennis Klinman, Alfred D. Steinberg
  • Patent number: 8114848
    Abstract: Oligonucleotides containing unthylated CpG dinucleotides and therapeutic utilities based on their ability to stimulate an immune response in a subject are disclosed. Also disclosed are therapies for treating diseases associated with immune system activation that are initiated by unthylated CpG dinucleotides in a subject comprising administering to the subject oligonucleotides that do not contain unmethylated CpG sequences (i.e. methylated CpG sequences or no CpG sequence) to outcompete unmethylated CpG nucleic acids for binding. Further disclosed are methylated CpG containing dinucleotides for use antisense therapies or as in vivo hybridization probes, and immunoinhibitory oligonucleotides for use as antiviral therapeutics.
    Type: Grant
    Filed: May 11, 2005
    Date of Patent: February 14, 2012
    Assignees: The United States of America as represented by the Department of Health and Human Services, University of Iowa Research Foundation, Coley Pharmaceutical Group, Inc.
    Inventors: Arthur M. Krieg, Dennis Klinman, Alfred D. Steinberg
  • Patent number: 8114419
    Abstract: The invention provides an immunostimulatory nucleic acid comprising CpG motifs, and methods of use thereof in stimulating immunity.
    Type: Grant
    Filed: May 26, 2009
    Date of Patent: February 14, 2012
    Assignee: Coley Pharmaceutical Group, Inc.
    Inventor: Arthur M. Krieg
  • Publication number: 20120003179
    Abstract: The invention relates to administration of an anti-CTLA-4 antibody, particularly human antibodies to human CTLA-4, such as those having amino acid sequences of antibodies 3.1.1, 4.1.1, 4.8.1, 4.10.2, 4.13.1, 4.14.3, 6.1.1, 11.2.1, 11.6.1, 11.7.1, 12.3.1.1, 12.9.1.1, and MDX-010, in combination with an immunostimulatory nucleotide, i.e., CpG ODN PF3512676, for treatment of cancer. The invention relates to administering a combination of an anti-CTLA-4 antibody and CpG ODN PF3512676 as neoadjuvant, adjuvant, first-line, second-line, and third-line therapy of cancer, whether localized or metastasized, and at any point(s) along the disease continuum (e.g., at any stage of the cancer).
    Type: Application
    Filed: June 24, 2011
    Publication date: January 5, 2012
    Applicants: Coley Pharmaceutical Group, Inc., PFIZER INC
    Inventors: David Robert John READETT, Jarl Ulf Birger Jungnelius, Jesus Gomez-Navarro, Douglas Hanson, Arthur M. Krieg
  • Patent number: 8058249
    Abstract: Nucleic acids containing unmethylated CpG dinucleotides and therapeutic utilities based on their ability to stimulate an immune response and to redirect a Th2 response to a Th1 response in a subject are disclosed. Methods for treating atopic diseases, including atopic dermatitis, are disclosed.
    Type: Grant
    Filed: July 16, 2004
    Date of Patent: November 15, 2011
    Assignees: University of Iowa Research Foundation, United States of America as represented by the Department of Health and Human Services, Coley Pharmaceutical Group, Inc.
    Inventors: Arthur M. Krieg, Joel Kline, Dennis Klinman, Alfred D. Steinberg
  • Publication number: 20110244025
    Abstract: The invention provides immunostimulatory compositions and methods for their use. In particular, the immunostimulatory compositions of the invention include RNA-like polymers that incorporate an immunostimulatory sequence motif and at least one chemical modification to confer improved stability against nuclease degradation and improved activity. Specific modifications involving phosphate linkages, nucleotide analogs, and combinations thereof are provided. Compositions of the invention optionally include an antigen and can be used to stimulate an immune response. Also provided are compositions and methods useful for treating a subject having an infection, a cancer, an to allergic condition, or asthma. Modified oligoribonucleotide analogs of the invention are believed to stimulate Toll-like receptors TLR7 and TLR8.
    Type: Application
    Filed: November 15, 2010
    Publication date: October 6, 2011
    Inventors: Eugen Uhlmann, Arthur M. Krieg, Grayson B. Lipford
  • Patent number: 8008266
    Abstract: Nucleic acid sequences containing unmethylated CpG dinucleotides that modulate an immune response including stimulating a Th1 pattern of immune activation, cytokine production, NK lytic activity, and B cell proliferation are disclosed. The sequences are also useful as a synthetic adjuvant.
    Type: Grant
    Filed: November 21, 2003
    Date of Patent: August 30, 2011
    Assignees: University of Iowa Foundation, The United States of America as represented by the Department of Health and Human Services, Coley Pharmaceutical Group, Inc.
    Inventors: Arthur M. Krieg, Alfred D. Steinberg, Dennis Klinman
  • Publication number: 20110201672
    Abstract: The invention relates to specific C-Class semi-soft CpG immunostimulatory oligonucleotides that are useful for stimulating an immune response. In particular the oligonucleotides are useful for treating allergy, such as allergic rhinitis and asthma, cancer and infectious disease, such as hepatitis B and hepatitis C.
    Type: Application
    Filed: September 14, 2010
    Publication date: August 18, 2011
    Inventors: Arthur M. Krieg, Ulrike Samulowitz, Jörg Vollmer, Eugen Uhlmann
  • Patent number: 7956043
    Abstract: The invention relates to a class of CpG immunostimulatory oligonucleotides containing a 5?TCG motif or a CG at or near the 5? end that are useful for stimulating an immune response.
    Type: Grant
    Filed: December 11, 2003
    Date of Patent: June 7, 2011
    Assignees: Coley Pharmaceutical Group, Inc., Coley Pharmaceutical GmbH
    Inventors: Arthur M. Krieg, Marion Jurk, Jorg Vollmer, Eugen Uhlmann
  • Patent number: 7935675
    Abstract: Nucleic acid sequences containing unmethylated CpG dinucleotides that modulate an immune response including stimulating a Th1 pattern of immune activation, cytokine production, NK lytic activity, and B cell proliferation are disclosed. The sequences are also useful a synthetic adjuvant.
    Type: Grant
    Filed: June 21, 1999
    Date of Patent: May 3, 2011
    Assignee: University of Iowa Research Foundation
    Inventors: Arthur M. Krieg, Joel N. Kline
  • Publication number: 20110081366
    Abstract: Nucleic acid sequences containing unmethylated CpG dinucleotides that modulate an immune response including stimulating a Th1 pattern of immune activation, cytokine production, NK lytic activity, and B cell proliferation are disclosed. The sequences are also useful as a synthetic adjuvant.
    Type: Application
    Filed: November 15, 2010
    Publication date: April 7, 2011
    Applicant: University of Iowa Research Foundation
    Inventor: Arthur M. Krieg
  • Patent number: 7888327
    Abstract: Nucleic acids containing unmethylated CpG dinucleotides and therapeutic utilities based on their ability to stimulate an immune response and to redirect a Th2 response to a Th1 response in a subject are disclosed. Methods for treating atopic diseases, including atopic dermatitis, are disclosed.
    Type: Grant
    Filed: March 25, 2009
    Date of Patent: February 15, 2011
    Assignee: University of Iowa Research Foundation
    Inventors: Arthur M. Krieg, Joel N. Kline