Patents by Inventor Eugen Uhlmann

Eugen Uhlmann has filed for patents to protect the following inventions. This listing includes patent applications that are pending as well as patents that have already been granted by the United States Patent and Trademark Office (USPTO).

  • Publication number: 20100022016
    Abstract: The present invention relates to PNA derivatives which carry, at the C terminus, or at both the C and N termini of the PNA backbone, one or more phosphoryl radicals. The phosphoryl radicals carry, where appropriate, one or more labeling groups, groups for crosslinking, groups which promote intracellular uptake, or groups which increase the binding affinity of the PNA derivative for nucleic acids. The invention furthermore relates to a process for preparing the above-mentioned PNA derivatives and to their use as pharmaceuticals or diagnostic agents.
    Type: Application
    Filed: May 29, 2009
    Publication date: January 28, 2010
    Applicant: SANOFI-AVENTIS DEUTSCHLAND GMBH
    Inventors: Eugen UHLMANN, Gerhard Breipohl, David W. Will
  • Patent number: 7635769
    Abstract: The present invention relates to oligoribonucleotide derivatives which have a 2?5?-linked oligoribonucleotide residue without a 5?-phosphate residue on the 3? end and to the use thereof for specific inhibition of gene expression.
    Type: Grant
    Filed: September 22, 2005
    Date of Patent: December 22, 2009
    Assignee: Sanofi-Aventis Drutschland
    Inventors: Eugen Uhlmann, Jochen Huber, Niki Gunkel, Sandra Neumann
  • Publication number: 20090306177
    Abstract: Double-stranded short interfering ribonucleic acid (siRNA) are modified to reduce or eliminate their immunostimulatory effect without significantly affecting their gene silencing effect. Modified siRNA include one or more 2? sugar modifications and, optionally, internucleotide linkages on the sense strand. Compositions containing the modified siRNA and methods of making and using the modified siRNA are disclosed. New and previously characterized siRNA can be synthesized to incorporate modifications according to the invention.
    Type: Application
    Filed: September 15, 2006
    Publication date: December 10, 2009
    Applicants: Coley Pharmaceutical GmbH, Qiagen GmbH
    Inventors: Eugen Uhlmann, Marion Jurk, Joerg Vollmer, Christian Schetter, Martin Weber, Ioanna Andreou, Stefan Pitsch
  • Patent number: 7615539
    Abstract: The invention relates to a nucleic acid-lipophilic conjugates and methods for modulating an immune response using the conjugates. The lipophilic moiety associated with an immunostimulatory nucleic acid.
    Type: Grant
    Filed: September 27, 2004
    Date of Patent: November 10, 2009
    Assignees: Coley Pharmaceutical Group, Inc., Coley Pharmaceutical GmbH
    Inventors: Eugen Uhlmann, Jörg Vollmer, Arthur M. Krieg
  • Patent number: 7566703
    Abstract: The invention relates to specific C-Class semi-soft CpG immunostimulatory oligonucleotides that are useful for stimulating an immune response. In particular the oligonucleotides are useful for treating allergy, such as allergic rhinitis and asthma, cancer and infectious disease, such as hepatitis B and hepatitis C.
    Type: Grant
    Filed: October 20, 2005
    Date of Patent: July 28, 2009
    Assignees: Coley Pharmaceutical Group, Inc., Coley Pharmaceutical GmbH
    Inventors: Arthur M. Krieg, Ulrike Samulowitz, Jörg Vollmer, Eugen Uhlmann
  • Patent number: 7550582
    Abstract: The present invention relates to PNA derivatives which carry, at the C terminus, or at both the C and N termini of the PNA backbone, one or more phosphoryl radicals. The phosphoryl radicals carry, where appropriate, one or more labeling groups, groups for crosslinking, groups which promote intracellular uptake, or groups which increase the binding affinity of the PNA derivative for nucleic acids. The invention furthermore relates to a process for preparing the above-mentioned PNA derivatives and to their use as pharmaceuticals or diagnostic agents.
    Type: Grant
    Filed: September 14, 2007
    Date of Patent: June 23, 2009
    Assignee: sanofi-aventis Deutschland GmbH
    Inventors: Eugen Uhlmann, Gerhard Breipohl, David William Will
  • Publication number: 20090137519
    Abstract: The invention relates to specific C-Class semi-soft CpG immunostimulatory oligonucleotides that are useful for stimulating an immune response. In particular the oligonucleotides are useful for treating allergy, such as allergic rhinitis and asthma, cancer and infectious disease, such as hepatitis B and hepatitis C.
    Type: Application
    Filed: December 17, 2008
    Publication date: May 28, 2009
    Applicants: Coley Pharmaceutical Group, Inc., Coley Pharmaceutical GmbH
    Inventors: Arthur M. Krieg, Ulrike Samulowitz, Jorg Vollmer, Eugen Uhlmann
  • Publication number: 20090087446
    Abstract: Immunostimulatory oligonucleotides, which contain a CpG immunostimulatory motif and a second motif that is capable of forming secondary structure, including duplex and higher order structures in vitro and in vivo, are disclosed. They include nucleic acids, or pharmaceutically acceptable salts thereof, having base sequences that include 5? TCGTCGTTTTCGGCGCGCGCCGT 3? (SEQ ID NO: 1), in which each C is unmethylated and 3? refers to the 3? end of the nucleic acid. The oligonucleotides activate B cells and NK cells and induce expression of type I interferon and interferon-?. The oligonucleotides are useful for treating a variety of disorders and conditions, including allergy, asthma, infection, and cancer. In addition to their use as single agents and as combination therapies, the disclosed oligonucleotides are useful as adjuvants in vaccines.
    Type: Application
    Filed: August 12, 2008
    Publication date: April 2, 2009
    Inventors: JORG VOLLMER, Eugen Uhlmann, Arthur M. Krieg, Douglas C. Hanson, Ulrike Samulowitz
  • Patent number: 7485421
    Abstract: Polyamide-oligonucleotide derivatives of the formula F[(DNA-Li)q(PNA-Li)r(DNA-Li)s(PNA)t]xF? wherein q, r, s, t are, independently of one another, zero or 1, where the total of two or more adjacent q, r, s and t?2; x is 1 to 20; DNA is a nucleic acid such as DNA or RNA or a known derivative thereof; Li is a covalent linkage between DNA and PNA, where the covalent linkage comprises a bond or an organic radical with at least one atom from the series consisting of C, N, O or S; PNA is a polyamide structure which contains at least one nucleotide base which is different from thymine; and F and F? are end groups and/or are linked together by a covalent bond, and the physiologically tolerated salts thereof, a process for their preparation and their use as pharmaceutical, as gene probe and as primer, are described.
    Type: Grant
    Filed: September 10, 2004
    Date of Patent: February 3, 2009
    Assignee: Hoechst GmbH
    Inventors: Eugen Uhlmann, Gerhard Breipohl
  • Publication number: 20080113929
    Abstract: Compositions and methods are provided for enhancing delivery of therapeutic agents. More specifically, compositions and methods are provided for improving antigen delivery to antigen-presenting cells. Conjugates between abasic oligonucleotides and antigen are provided, along with methods for their use in vaccination and in the treatment of cancer, infection, and allergy and asthma. Also provided are conjugates between abasic oligonucleotides and various immunostimulatory nucleic acids, including CpG oligonucleotides, as well as methods of use thereof. Also provided are conjugates between abasic oligonucleotides and various other agonists and antagonists of immunostimulation, as well as methods of use thereof.
    Type: Application
    Filed: June 8, 2005
    Publication date: May 15, 2008
    Applicant: Coley Pharmaceutical GmbH
    Inventors: Grayson B. Lipford, Alexandra Forsbach, Eugen Uhlmann, Hermann Wagner
  • Publication number: 20080071069
    Abstract: The present invention provides conjugates, processes for their preparation, and the use of these conjugates for transporting low-molecular-weight compounds and macromolecules across biological membranes, in particular for transporting molecules into cells. The present invention also provides pharmaceutical compositions, diagnostic aids, and test kits in which these conjugates are present or used.
    Type: Application
    Filed: January 11, 2007
    Publication date: March 20, 2008
    Applicant: SANOFI-AVENTIS DEUTSCHLAND GMBH
    Inventors: Eugen Uhlmann, Beate Greiner, Eberhard Unger, Gislinde Gothe, Marc Schwerdel
  • Publication number: 20080070258
    Abstract: The present invention relates to PNA derivatives which carry, at the C terminus, or at both the C and N termini of the PNA backbone, one or more phosphoryl radicals. The phosphoryl radicals carry, where appropriate, one or more labeling groups, groups for crosslinking, groups which promote intracellular uptake, or groups which increase the binding affinity of the PNA derivative for nucleic acids. The invention furthermore relates to a process for preparing the above-mentioned PNA derivatives and to their use as pharmaceuticals or diagnostic agents.
    Type: Application
    Filed: September 14, 2007
    Publication date: March 20, 2008
    Applicant: AVENTIS PHARMA DEUTSCHLAND GMBH
    Inventors: Eugen UHLMANN, Gerhard Breipohl, David Will
  • Publication number: 20080045473
    Abstract: The present invention relates generally to immunostimulatory nucleic acids, compositions thereof and methods of using the immunostimulatory nucleic acids. In particular the invention relates to palindrome-containing immunostimulatory nucleic acids and the use of these nucleic acids in treating disease.
    Type: Application
    Filed: February 15, 2007
    Publication date: February 21, 2008
    Applicants: Coley Pharmaceutical GmbH, Coley Pharmaceutical Group, Inc.
    Inventors: Eugen Uhlmann, Jorg Vollmer, Arthur Krieg, Ulrike Samulowitz, Bernhard Noll
  • Publication number: 20070224210
    Abstract: The invention relates to a class of soft or semi-soft CpG immunostimulatory oligonucleotides that are useful for stimulating an immune response.
    Type: Application
    Filed: October 4, 2006
    Publication date: September 27, 2007
    Applicants: Coley Pharmaceutical Group, Inc., Coley Pharmaceutical GmbH
    Inventors: Arthur Krieg, Grayson Lipford, Ulrike Samulowitz, Jorg Vollmer, Eugen Uhlmann, Marion Jurk, Robert Rankin
  • Patent number: 7241882
    Abstract: The present invention relates to PNA derivatives which carry, at the N terminus of the PNA backbone, a phosphoryl radical. The phosphoryl radical can be, for example, a phosphate radical, or a substituted phosphoryl radical, with substituted phosphoryl derivatives carrying, where appropriate, one or more labeling groups, groups for crosslinking, groups which promote intracellular uptake, or groups which increase the binding affinity of the PNA derivative for nucleic acids. The invention furthermore relates to a process for preparing the abovementioned PNA derivatives and to their use as pharmaceuticals and diagnostic agents.
    Type: Grant
    Filed: June 9, 2004
    Date of Patent: July 10, 2007
    Assignee: Sanofi-Aventis Deutschland GmbH
    Inventors: Eugen Uhlmann, Gerhard Breipohl, David William Will
  • Patent number: 7229974
    Abstract: Oligonucleotides of the formula 5?-(CAP)-(Oligo)-(CAP)-3? are disclosed where (oligo) is a nucleotide sequence of from 10 to 40 nucleotides in length, and CAP is Gm, where m is an integer of from zero to ten, the two CAP's which are present in the molecule can be defined independently of each other and must be different in the case where m is zero at the 5? or 3? end and the end of the Oligo sequence is other than guanine. The oligonucleotides can be synthesized chemically. The oligonucleotides are used to diagnose or treat cancer, restenosis, a disease caused by a virus, a disease affected by integrins or cell-cell adhesion receptor or a disease triggered by diffusible factors.
    Type: Grant
    Filed: May 21, 2001
    Date of Patent: June 12, 2007
    Assignee: Sanofi-Aventis Deutschland GmbH
    Inventors: Anuschirwan Peyman, Eugen Uhlmann
  • Publication number: 20060241076
    Abstract: The invention provides immunostimulatory compositions and methods for their use. In particular, the immunostimulatory compositions of the invention include RNA-like polymers that incorporate an immunostimulatory sequence motif and at least one chemical modification to confer improved stability against nuclease degradation and improved activity. Specific modifications involving phosphate linkages, nucleotide analogs, and combinations thereof are provided. Compositions of the invention optionally include an antigen and can be used to stimulate an immune response. Also provided are compositions and methods useful for treating a subject having an infection, a cancer, an allergic condition, or asthma. Modified oligoribonucleotide analogs of the invention are believed to stimulate Toll-like receptors TLR7 and TLR8.
    Type: Application
    Filed: April 26, 2006
    Publication date: October 26, 2006
    Applicants: Coley Pharmaceutical GmbH, Coley Pharmaceutical Group, Inc.
    Inventors: Eugen Uhlmann, Arthur Krieg, Grayson Lipford
  • Publication number: 20060140875
    Abstract: The invention relates to specific C-Class semi-soft CpG immunostimulatory oligonucleotides that are useful for stimulating an immune response. In particular the oligonucleotides are useful for treating allergy, such as allergic rhinitis and asthma, cancer and infectious disease, such as hepatitis B and hepatitis C.
    Type: Application
    Filed: October 20, 2005
    Publication date: June 29, 2006
    Applicants: Coley Pharmaceutical Group, Inc., Coley Pharmaceutical GmbH
    Inventors: Arthur Krieg, Ulrike Samulowitz, Jorg Vollmer, Eugen Uhlmann
  • Publication number: 20060025374
    Abstract: The present invention relates to oligoribonucleotide derivatives which have a 2?5?-linked oligoribonucleotide residue without a 5?-phosphate residue on the 3? end and to the use thereof for specific inhibition of gene expression.
    Type: Application
    Filed: September 22, 2005
    Publication date: February 2, 2006
    Inventors: Eugen Uhlmann, Jochen Huber, Niki Gunkel, Sandra Neumann
  • Publication number: 20050239734
    Abstract: The invention relates to a class of CpG immunostimulatory oligonucleotides containing a CpG immunostimulatory motif and a second motif which is capable of forming secondary structure, including duplex and higher order structures, in vitro and in vivo. The oligonucleotides of the invention are useful as adjuvants in vaccination. The oligonucleotides are also useful for inducing an immune response, inducing expression of a type I interferon (IFN), inducing expression of gamma interferon (IFN-?), and for treating a variety of conditions, including allergy, asthma, infection, and cancer.
    Type: Application
    Filed: October 29, 2004
    Publication date: October 27, 2005
    Applicants: Coley Pharmaceutical GmbH, Coley Pharmaceutical Group, Inc.
    Inventors: Eugen Uhlmann, Jorg Vollmer, Arthur Krieg, Bernhard Noll