Abstract: This application provides for a method of treating a subject suffering from Crohn's disease, the method comprising periodically administering to the subject an amount of laquinimod or pharmaceutically acceptable salt thereof effective to treat the subject. This application provides for use of laquinimod in the manufacture of a medicament for treating a subject suffering from Crohn's disease. This application also provides for a pharmaceutical composition comprising laquinimod for use in treating a subject suffering from Crohn's disease.

Abstract: The present disclosure provides methods and compositions for treating chronic autoimmune diseases, such as multiple sclerosis, using [8-(4-methanesulfonyl-phenyl)-[1,2,4]triazolo[1,5-a]pyridin-2-yl]-[3-(4-methyl-piperazin-1-yl)-phenyl]-amine or a pharmaceutically acceptable salt thereof.

Abstract: This application provides for a method of treating a subject suffering from Crohn's disease, the method comprising periodically administering to the subject an amount of laquinimod or pharmaceutically acceptable salt thereof effective to treat the subject. This application provides for use of laquinimod in the manufacture of a medicament for treating a subject suffering from Crohn's disease. This application also provides for a pharmaceutical composition comprising laquinimod for use in treating a subject suffering from Crohn's disease.

Abstract: The subject invention provides a method for treating a subject afflicted with a form of multiple sclerosis (MS) or presenting a clinically isolated syndrome (CIS) comprising periodically administering to the subject an amount of laquinimod and an amount of a compound of formula (I): as described herein. The subject invention also provides packages and pharmaceutical compositions comprising laquinimod and a compound of formula (I) as described herein. The subject invention further provides uses of said compounds, pharmaceutical compositions and packages in treating a subject afflicted with a form of MS or presenting a CIS.

Abstract: This invention provides a method of treating a subject afflicted with multiple sclerosis or presenting a clinically isolated syndrome comprising administering to the subject fampridine as an add-on therapy to or in combination with laquinimod. This invention also provides a package comprising laquinimod and fampridine for treating a subject afflicted with multiple sclerosis or presenting a clinically isolated syndrome. This invention also provides fampridine for use as an add-on therapy or in combination with laquinimod in treating a subject afflicted with multiple sclerosis or presenting a clinically isolated syndrome. This invention also provides a pharmaceutical composition comprising laquinimod and fampridine for use in treating a subject afflicted with multiple sclerosis or presenting a clinically isolated syndrome.

Abstract: Processes and systems are provided for reforming and isomerizing hydrocarbons to produce octane upgraded hydrocarbons. The process involves providing a reforming feedstream to a reforming zone containing a reforming catalyst and operating the reforming zone at reforming conditions including reforming pressure in a range of from about 1 to about 18 atmospheres to generate a reforming zone effluent. The reforming zone effluent is separated to form a net gas stream comprising primarily hydrogen and a liquid reforming product stream, and then providing the net gas stream and an isomerization feedstream to an isomerization zone containing an isomerization catalyst. The isomerization zone is operated at an isomerization pressure that is greater than the reforming pressure, to produce an isomerization zone effluent.

Abstract: The present invention provides a method of treating cancer in a subject afflicted with cancer comprising administering to the subject an anti-clusterin oligonucleotide as a monotherapy to treat the cancer. The present invention also provides compositions for treating cancer in a subject afflicted with cancer, comprising an anti-clusterin oligonucleotide having the sequence CAGCAGCAGAGTCTTCATCAT (Seq. ID No.: 1). Additionally, the present invention provides pharmaceutical compositions for treating cancer in a subject afflicted with cancer, the composition comprising an anti-clusterin oligonucleotide having the sequence CAGCAGCAGAGTCTTCATCAT (Seq. ID No.: 1), wherein the anti-clusterin oligonucleotide has a phosphorothioate backbone throughout, has sugar moieties of nucleotides 1-4 and 18-21 bearing 2?-O-methoxyethyl modifications, has nucleotides 5-17 which are 2?deoxynucleotides, and has 5-methylcytosines at nucleotides 1, 4, and 19.

Abstract: This application provides for a method of treating a human patient afflicted with anti-TNF? refractory Crohn's disease, of treating a human patient afflicted with non-fibrostenotic Crohn's disease, and of treating a human patient whose Crohn's disease had not been surgically treated, the method comprising periodically administering to the patient an amount of laquinimod or pharmaceutically acceptable salt thereof effective to treat the patient. This application also provides for a method of inducing or maintaining clinical remission in a human patient afflicted with Crohn's disease comprising periodically administering to the patient an amount of laquinimod effective to induce or maintain clinical remission in the patient, which amount of laquinimod is less than 0.5 mg/day.

Abstract: This application provides for a method of treating a human patient afflicted with anti-TNF? refractory Crohn's disease, of treating a human patient afflicted with non-fibrostenotic Crohn's disease, and of treating a human patient whose Crohn's disease had not been surgically treated, the method comprising periodically administering to the patient an amount of laquinimod or pharmaceutically acceptable salt thereof effective to treat the patient. This application also provides for a method of inducing or maintaining clinical remission in a human patient afflicted with Crohn's disease comprising periodically administering to the patient an amount of laquinimod effective to induce or maintain clinical remission in the patient, which amount of laquinimod is less than 0.5 mg/day.

Abstract: The subject invention provides a method for treating a subject afflicted with a form of multiple sclerosis (MS) or presenting a clinically isolated syndrome (CIS) comprising periodically administering to the subject an amount of laquinimod and an amount of a compound of formula (I): as described herein. The subject invention also provides packages and pharmaceutical compositions comprising laquinimod and a compound of formula (I) as described herein. The subject invention further provides uses of said compounds, pharmaceutical compositions and packages in treating a subject afflicted with a form of MS or presenting a CIS.

Abstract: The present invention provides a method of treating cancer in a subject afflicted with cancer comprising administering to the subject an anti-clusterin oligonucleotide as a monotherapy to treat the cancer. The present invention also provides compositions for treating cancer in a subject afflicted with cancer, comprising an anti-clusterin oligonucleotide having the sequence CAGCAGCAGAGTCTTCATCAT (Seq. ID No.: 1). Additionally, the present invention provides pharmaceutical compositions for treating cancer in a subject afflicted with cancer, the composition comprising an anti-clusterin oligonucleotide having the sequence CAGCAGCAGAGTCTTCATCAT (Seq. ID No.: 1), wherein the anti-clusterin oligonucleotide has a phosphorothioate backbone throughout, has sugar moieties of nucleotides 1-4 and 18-21 bearing 2?-O-methoxyethyl modifications, has nucleotides 5-17 which are 2?deoxynucleotides, and has 5-methylcytosines at nucleotides 1, 4, and 19.

Abstract: This application provides for a method of treating a subject suffering from Crohn's disease, the method comprising periodically administering to the subject an amount of laquinimod or pharmaceutically acceptable salt thereof effective to treat the subject. This application provides for use of laquinimod in the manufacture of a medicament for treating a subject suffering from Crohn's disease. This application also provides for a pharmaceutical composition comprising laquinimod for use in treating a subject suffering from Crohn's disease.

Abstract: This application provides for a method of treating a subject suffering from Crohn's disease, the method comprising periodically administering to the subject an amount of laquinimod or pharmaceutically acceptable salt thereof effective to treat the subject. This application provides for use of laquinimod in the manufacture of a medicament for treating a subject suffering from Crohn's disease. This application also provides for a pharmaceutical composition comprising laquinimod for use in treating a subject suffering from Crohn's disease.

Abstract: This invention provides a method of treating a subject afflicted with multiple sclerosis or presenting a clinically isolated syndrome comprising administering to the subject fampridine as an add-on therapy to or in combination with laquinimod. This invention also provides a package comprising laquinimod and fampridine for treating a subject afflicted with multiple sclerosis or presenting a clinically isolated syndrome. This invention also provides fampridine for use as an add-on therapy or in combination with laquinimod in treating a subject afflicted with multiple sclerosis or presenting a clinically isolated syndrome. This invention also provides a pharmaceutical composition comprising laquinimod and fampridine for use in treating a subject afflicted with multiple sclerosis or presenting a clinically isolated syndrome.

Abstract: Disclosed is a method for treating an ocular inflammatory disease (OID), e.g., uveitis or conjunctivitis, comprising periodic administration of a therapeutically effective amount of laquinimod or a pharmaceutically acceptable salt thereof. Also provided is a pharmaceutical composition comprising laquinimod or a pharmaceutically acceptable salt thereof for use in treating a subject suffering from an OID, uveitis, bacterial conjunctivitis, viral conjunctivitis, an inflammation of the orbital tissue, the lacrimal apparatus, the eyelid, the cornea, the retina or the optic pathway.

Abstract: This application provides for a method of treating a subject suffering from Crohn's disease, the method comprising periodically administering to the subject an amount of laquinimod or pharmaceutically acceptable salt thereof effective to treat the subject. This application provides for use of laquinimod in the manufacture of a medicament for treating a subject suffering from Crohn's disease. This application also provides for a pharmaceutical composition comprising laquinimod for use in treating a subject suffering from Crohn's disease.

Abstract: This application provides for a method of treating a human patient afflicted with anti-TNF? refractory Crohn's disease, of treating a human patient afflicted with non-fibrostenotic Crohn's disease, and of treating a human patient whose Crohn's disease had not been surgically treated, the method comprising periodically administering to the patient an amount of laquinimod or pharmaceutically acceptable salt thereof effective to treat the patient. This application also provides for a method of inducing or maintaining clinical remission in a human patient afflicted with Crohn's disease comprising periodically administering to the patient an amount of laquinimod effective to induce or maintain clinical remission in the patient, which amount of laquinimod is less than 0.5 mg/day.

Abstract: This invention provides a method of treating a subject afflicted with rheumatoid arthritis comprising periodically administering to the subject an amount of laquinimod or pharmaceutically acceptable salt thereof and an amount of methotrexate, wherein the amounts when taken together are effective to treat the subject. This invention also provides laquinimod or pharmaceutically acceptable salt thereof for use in combination with methotrexate in treating a subject afflicted with rheumatoid arthritis. This invention also provides a pharmaceutical composition comprising an amount of laquinimod or pharmaceutically acceptable salt thereof and an amount of methotrexate for use in treating a subject afflicted with rheumatoid arthritis.

Abstract: This invention provides a method of treating a subject afflicted with rheumatoid arthritis comprising periodically administering to the subject an amount of laquinimod or pharmaceutically acceptable salt thereof and an amount of methotrexate, wherein the amounts when taken together are effective to treat the subject. This invention also provides laquinimod or pharmaceutically acceptable salt thereof for use in combination with methotrexate in treating a subject afflicted with rheumatoid arthritis. This invention also provides a pharmaceutical composition comprising an amount of laquinimod or pharmaceutically acceptable salt thereof and an amount of methotrexate for use in treating a subject afflicted with rheumatoid arthritis.

Abstract: This application provides for a method of treating a subject suffering from Crohn's disease, the method comprising periodically administering to the subject an amount of laquinimod or pharmaceutically acceptable salt thereof effective to treat the subject. This application provides for use of laquinimod in the manufacture of a medicament for treating a subject suffering from Crohn's disease. This application also provides for a pharmaceutical composition comprising laquinimod for use in treating a subject suffering from Crohn's disease.