Patents by Inventor Nicolaas Francois Visser BURGER

Nicolaas Francois Visser BURGER has filed for patents to protect the following inventions. This listing includes patent applications that are pending as well as patents that have already been granted by the United States Patent and Trademark Office (USPTO).

  • Method for controlling pest infestations
    Patent number: 11944102
    Abstract: The invention provides siRNA molecules for use in controlling pest infestation. The siRNA molecules target the mature mRNA of D. noxia cprr1-8 in a region between nucleotides 464 and 774 of SEQ ID NO: 23, or an equivalent region of an ortholog of D. noxia cprr1-8. Ingestion of the siRNA molecule by a pest inhibits the biological activity of the pest. In one embodiment, the siRNA molecule comprises a polynucleotide which has at least 80% sequence identity to the sequence 5? UAAACAAUCGCAAGAAGCUGA 3? (SEQ ID NO: 1) and a polynucleotide which has at least 80% sequence identity to the sequence 5? AGCUUCUUGCGAUUGUUUAAG 3? (SEQ ID NO: 2). Compositions comprising the siRNA molecules, vectors encoding the siRNA molecules, and methods for using the siRNA molecules are also provided.
    Type: Grant
    Filed: March 5, 2019
    Date of Patent: April 2, 2024
    Assignee: Stellenbosch University
    Inventors: Anna-Maria Botha-Oberholster, Hendrik Willem Swiegers, Nicolaas Francois Visser Burger
  • METHOD FOR CONTROLLING PEST INFESTATIONS
    Publication number: 20210000124
    Abstract: The invention provides siRNA molecules for use in controlling pest infestation. The siRNA molecules target the mature mRNA of D. noxia cprr1-8 in a region between nucleotides 464 and 774 of SEQ ID NO: 23, or an equivalent region of an ortholog of D. noxia cprr1-8. Ingestion of the siRNA molecule by a pest inhibits the biological activity of the pest. In one embodiment, the siRNA molecule comprises a polynucleotide which has at least 80% sequence identity to the sequence 5? UAAACAAUCGCAAGAAGCUGA 3? (SEQ ID NO: 1) and a polynucleotide which has at least 80% sequence identity to the sequence 5? AGCUUCUUGCGAUUGUUUAAG 3? (SEQ ID NO: 2). Compositions comprising the siRNA molecules, vectors encoding the siRNA molecules, and methods for using the siRNA molecules are also provided.
    Type: Application
    Filed: March 5, 2019
    Publication date: January 7, 2021
    Applicant: Stellenbosch University
    Inventors: Anna-Maria BOTHA-OBERHOLSTER, Hendrik Willem SWIEGERS, Nicolaas Francois Visser BURGER