Abstract: There is provided an image processing device and method capable of suppressing an increase in the amount of coding. A spraying attribute projection image, which is used for spraying for adding an attribute to a geometry in the reconstruction of 3D data in a three-dimensional space, is generated by projecting an attribute of 3D data representing an object in a three-dimensional shape onto a two-dimensional plane independently of the projection of the geometry of the 3D data onto the two-dimensional plane, and coding is performed on a frame image in which the spraying attribute projection image is disposed. The present disclosure can be applied to, for example, an image processing device, an electronic device, an image processing method, or a program or the like.

Abstract: The present disclosure relates to an image processing apparatus and a method that enable decoding of encoded data of an octree in various processing orders. The octree corresponding to point cloud data is encoded after the context is initialized for each layer of the octree. Further, a breadth-first order or a depth-first order is selected as the decoding order for the encoded data of the octree corresponding to point cloud data, and the encoded data is decoded in the selected decoding order. The present disclosure can be applied to an image processing apparatus, an electronic apparatus, an image processing method, a program, or the like, for example.

Abstract: The present disclosure relates to image processing apparatus and method that can prevent a reduction in image quality. Geometry data that is a frame image having arranged thereon a projected image obtained by projecting 3D data representing a three-dimensional structure on a two-dimensional plane and includes a special value indicating occupancy map information in a range is generated. The generated geometry data is encoded. Further, the encoded data on the geometry data is decoded, and a depth value indicating a position of the 3D data and the occupancy map information are extracted from the decoded geometry data. The present disclosure is applicable to, for example, an information processing apparatus, an image processing apparatus, electronic equipment, an information processing method, or a program.

Abstract: There is provided an information processing apparatus, an image processing apparatus, an encoding device, a decoding device, an information processing method, and a program that facilitate scalable decoding of attribute information. Regarding the attribute information about a point cloud representing a three-dimensional object, a process of classifying the respective points of the point cloud into prediction points that are the points at which difference values between the attribute information and predicted values are left, and reference points that are the points at which the attribute information is referred to during derivation of the predicted values is recursively repeated on the reference points, so that the attribute information is hierarchized.

Abstract: There is provided an image processing apparatus and an image processing method that are capable of suppressing an increase in loads when a point cloud is generated from a mesh. Point cloud data is generated by positioning points at intersection points between a surface of a mesh and vectors each including, as a start origin, position coordinates corresponding to a specified resolution. For example, intersection determination is performed between the surface of the mesh and each of the vectors, and in a case where the surface and the vector are determined to intersect each other, the coordinates of the intersection point are calculated. The present disclosure can be applied to an image processing apparatus, electronic equipment, an image processing method, a program, or the like.

Abstract: The present disclosure relates to an information processing apparatus and an information generation method that enable suppression of deterioration in subjective quality of a point cloud. There is generated an occupancyMap indicating, for each local area of a frame image, presence or absence of a projection image of a point cloud on a two-dimensional plane in accordance with a positional relationship of points in a three-dimensional space, while the point cloud represents an object having a three-dimensional shape as a set of the points. The present disclosure can be applied to, for example, an information processing apparatus, an encoding device, a decoding device, or the like.

Abstract: There is provided an image processing device and a method capable of suppressing lowering of image quality. Correction information that is information regarding correction of 3D data representing a three-dimensional structure constructed using 2D data representing a two-dimensional image is generated, and the generated correction information is coded. Furthermore, coded data of correction information that is information regarding correction of 3D data representing a three-dimensional structure constructed using 2D data representing a two-dimensional image is decoded, and 3D data is constructed using the 2D data and correction information generated by decoding coded data of the correction information. The present disclosure can be applied to, for example, an information processing device, an image processing device, an electronic apparatus, an information processing method, a program, or the like.

Abstract: An intended nucleic acid is determined in a sample by a method in which at least one of the nucleic acid strands of the intended nucleic acid is subjected to hybridization with a primer and to chain-extension reaction over the primer to form a synthesized nucleic acid which is complementary to and in hybridization with the strand; a copy of the intended nucleic acid is obtained, which copy is (a) the nucleic acid of the double-stranded double produced by the chain-extension reaction, or (b) the synthesized nucleic acid freed from the double-stranded nucleic acid, or (c) a double stranded nucleic acid form from a pair of the synthesized nucleic acids complementary with each other; and it is determined whether the copy is present in the sample thereby to know whether the intended nucleic acid is in present in the sample.

Abstract: The present invention discloses a primer for detecting methicillin-resistant or toxic shock syndrome toxin-1 Staphylococcus spp. comprising any one of nucleotide fragments of sequences (1) to (4):5'GAAATGACTGAACGTCCGAT (1)5'GCGATCAATGTTACCGTAGT (2)5'AGTATGGGCCAAAGTTCGAT (3)5'CACTTTGATATGTGGATCCG (4)a method and kit for detecting these bacteria using the primer. The present invention makes direct and rapid detection of MRS and/or TPS from samples possible, and enables patients with infections caused by these bacteria to be treated at an early stage.