Patents by Inventor Satoru Nakagami

Satoru Nakagami has filed for patents to protect the following inventions. This listing includes patent applications that are pending as well as patents that have already been granted by the United States Patent and Trademark Office (USPTO).

  • Publication number: 20220191520
    Abstract: There is provided an information processing apparatus, an image processing apparatus, an encoding device, a decoding device, an information processing method, and a program that facilitate scalable decoding of attribute information. Regarding the attribute information about a point cloud representing a three-dimensional object, a process of classifying the respective points of the point cloud into prediction points that are the points at which difference values between the attribute information and predicted values are left, and reference points that are the points at which the attribute information is referred to during derivation of the predicted values is recursively repeated on the reference points, so that the attribute information is hierarchized.
    Type: Application
    Filed: March 5, 2020
    Publication date: June 16, 2022
    Applicant: SONY GROUP CORPORATION
    Inventors: Tsuyoshi KATO, Satoru KUMA, Ohji NAKAGAMI, Hiroyuki YASUDA, Koji YANO
  • Publication number: 20220182670
    Abstract: The present disclosure relates to an information processing apparatus and an information generation method that enable suppression of deterioration in subjective quality of a point cloud. There is generated an occupancyMap indicating, for each local area of a frame image, presence or absence of a projection image of a point cloud on a two-dimensional plane in accordance with a positional relationship of points in a three-dimensional space, while the point cloud represents an object having a three-dimensional shape as a set of the points. The present disclosure can be applied to, for example, an information processing apparatus, an encoding device, a decoding device, or the like.
    Type: Application
    Filed: December 24, 2019
    Publication date: June 9, 2022
    Applicant: Sony Group Corporation
    Inventors: Satoru KUMA, Ohji NAKAGAMI, Tsuyoshi KATO, Koji YANO
  • Patent number: 11356690
    Abstract: The present disclosure relates to an image processing apparatus and a method that allow for easier and more appropriate rendering. Coded data is generated by encoding a two-dimensional plane image in which position information and attribute information for a point cloud that represents an object having a three-dimensional shape as a group of points are projected onto a two-dimensional plane, and a bitstream that includes the generated coded data and metadata to be used to render the point cloud is generated. The present disclosure can be applied to, for example, an image processing apparatus, an electronic device, an image processing method, a program, or the like.
    Type: Grant
    Filed: July 5, 2019
    Date of Patent: June 7, 2022
    Assignee: SONY CORPORATION
    Inventors: Tsuyoshi Kato, Satoru Kuma, Ohji Nakagami, Koji Yano
  • Patent number: 5601976
    Abstract: An intended nucleic acid is determined in a sample by a method in which at least one of the nucleic acid strands of the intended nucleic acid is subjected to hybridization with a primer and to chain-extension reaction over the primer to form a synthesized nucleic acid which is complementary to and in hybridization with the strand; a copy of the intended nucleic acid is obtained, which copy is (a) the nucleic acid of the double-stranded double produced by the chain-extension reaction, or (b) the synthesized nucleic acid freed from the double-stranded nucleic acid, or (c) a double stranded nucleic acid form from a pair of the synthesized nucleic acids complementary with each other; and it is determined whether the copy is present in the sample thereby to know whether the intended nucleic acid is in present in the sample.
    Type: Grant
    Filed: September 16, 1992
    Date of Patent: February 11, 1997
    Assignee: Wakunaga Seiyaku Kabushiki Kaisha
    Inventors: Akio Yamane, Takanori Oka, Satoru Nakagami, Kenichi Miyoshi
  • Patent number: 5437978
    Abstract: The present invention discloses a primer for detecting methicillin-resistant or toxic shock syndrome toxin-1 Staphylococcus spp. comprising any one of nucleotide fragments of sequences (1) to (4):5'GAAATGACTGAACGTCCGAT (1)5'GCGATCAATGTTACCGTAGT (2)5'AGTATGGGCCAAAGTTCGAT (3)5'CACTTTGATATGTGGATCCG (4)a method and kit for detecting these bacteria using the primer. The present invention makes direct and rapid detection of MRS and/or TPS from samples possible, and enables patients with infections caused by these bacteria to be treated at an early stage.
    Type: Grant
    Filed: August 4, 1992
    Date of Patent: August 1, 1995
    Assignee: Wakunaga Seiyaku Kabushiki Kaisha
    Inventors: Kimiko Ubukata, Satoru Nakagami, Akio Yamane