Patents by Inventor Suman Preet Singh Khanuja

Suman Preet Singh Khanuja has filed for patents to protect the following inventions. This listing includes patent applications that are pending as well as patents that have already been granted by the United States Patent and Trademark Office (USPTO).

  • Patent number: 9018226
    Abstract: The present invention relates to bioactive extracts its fractions and isolation of compound from Rauwolfia tetraphylla. The extracts and fractions are useful for the treatment of psychosis based on in-vivo validation on animal model and proportional binding affinities for dopaminergic-D2, Cholinergic (muscarinic) and Serotonergic (5HT2A) receptors for antipsychotic activity. The present invention relates to novel antipsychotic activity in the leaf alkaloids of Formula 1 and 2 named tetrahydroalstonine, 10-methoxytetrahydroalstonine, isoreserpiline, 10-demethoxyreserpiline, 11-demethoxyreserpiline, reserpiline and ?-yohimbine. The present invention also relates to processes for obtaining antipsychotic extracts as well as for the isolation of alkaloids of formula 1 and 2 from the leaves of Rauwolfia tetraphylla. The present invention particularly relates to significant antipsychotic activity in the MeOH extract, ethylacetate and chloroform fractions of R.
    Type: Grant
    Filed: March 31, 2010
    Date of Patent: April 28, 2015
    Assignee: Council of Scientific & Industrial Research
    Inventors: Santosh Kumar Srivastava, Ashok Kumar Agrawal, Subhash Chandra Singh, Vinay Kumar Khanna, Janardan Singh, Chandeshwar Nath, Madan Mohan Gupta, Shikha Gupta, Ram Kishor Verma, Anirban Pal, Dnyaneshwar Umrao Bawankule, Dharmendra Saikia, Anil Kumar Gupta, Anupam Maurya, Suman Preet Singh Khanuja
  • Publication number: 20120184576
    Abstract: The present invention relates to bioactive extracts its fractions and isolation of compound from Rauwolfia tetraphylla. The extracts and fractions are useful for the treatment of psychosis based on in-vivo validation on animal model and proportional binding affinities for dopaminergic-D2, Cholinergic (muscarinic) and Serotonergic (5HT2A) receptors for antipsychotic activity. The present invention relates to novel antipsychotic activity in the leaf alkaloids of Formula 1 and 2 named tetrahydroalstonine, 10-methoxytetrahydroalstonine, isoreserpiline, 10-der?ethoxyreserpiline, 11-demethoxyreserpiline, reserpiline and ?-yohimbine. The present invention also relates to processes for obtaining antipsychotic extracts as well as for the isolation of alkabids of formula 1 and 2 from the leaves of Rauwolfia tetraphylla. The present invention particularly relates to significant antipsychotic activity in the MeOH extract, ethylacetate and chloroform fractions of R.
    Type: Application
    Filed: March 31, 2010
    Publication date: July 19, 2012
    Inventors: Santosh Kumar Srivastava, Ashok Kumar Agrawal, Subhash Chandra Singh, Vinay Kumar Khanna, Janardan Singh, Chandeshwar Nath, Madan Mohan Gupta, Shikha Gupta, Ram Kishor Verma, Anirban Pal, Duyaneshwar Umrao Bawankule, Dharmendra Saikia, Anil Kumar Gupta, Anupam Maurya, Suman Preet Singh Khanuja
  • Publication number: 20110092585
    Abstract: The present invention provides a novel pharmaceutical composition consisting of a combination of three coumarinolignoids of formula 1, 2 and 3 isolated from the seeds of the plant Cleome viscosa along with a pharmaceutically acceptable carrier useful as a immunomodulator. The invention also describes the ability of the compounds to modulate humorral and cell mediated immune response. It further provides a process for the preparation of a novel pharmaceutical composition of the said three coumarinolignoids in an optimized ratio to modulate humorral and cell mediated immune response.
    Type: Application
    Filed: September 1, 2010
    Publication date: April 21, 2011
    Applicants: COUNCIL OF SCIENTIFIC AND INDUSTRIAL RESEARCH
    Inventors: Suman Preet Singh Khanuja, Anirban Pal, Sunil Kumar Chattopadhyay, Mahendra Pandurang Darokar, Rajendra Prasad Patel, Anil Kumar Gupta, Arvind Singh Negi, Tanpreet Kaur, Sudeep Tandon, Atul Prakash Kahol, Ankur Garg
  • Patent number: 7767798
    Abstract: The present invention provides novel loganin analogues and a process for the preparation thereof. The present invention further provides the use of Iridoid glycoside loganin isolated from the fruit pulp of Strychnos nux-vomica and its bioactive semi-synthetic analogues against various human cancer cell lines grown in-vitro.
    Type: Grant
    Filed: March 2, 2006
    Date of Patent: August 3, 2010
    Assignee: Council of Scientific & Industrial Research
    Inventors: Suman Preet Singh Khanuja, Santosh Kumar Srivastava, Ankur Garg, Merajuddin Khan, Mahendra Pandurang Dardokar, Anirban Pal
  • Patent number: 7579491
    Abstract: The present invention provides a process for production of an anticancer taxoid brevifoliol of the formula I from plants belonging to the genus Taxus by first extracting the dried and pulverized leaves of the plant with an alcohol preferably at a temperature in the range of 20-40° C. and then. concentrating the solvent to obtain an alcoholic extract. The alcoholic extract obtained is then adsorbed with an adsorbent and the resulting adsorbed material is then dried at a temperature ranging from 20-50° C. for 4-48 hours. The dried adsorbed material is then extracted with a combination of an aliphatic solvent and a chlorinated solvent successively and concentrated to obtain a residue. The residue is subjected to gross fractionation using column chromatography such as silica gel, florosil and silicic acid followed by chromatography with a suitable adsorbent to get brevifoliol.
    Type: Grant
    Filed: October 10, 2006
    Date of Patent: August 25, 2009
    Assignee: Council of Scientific and Industrial Research
    Inventors: Sunil Kumar Chattopadhyay, Sachin Srivastava, Arvind Singh Negi, Ranganathan Santha Kumar Tirupadiripuliyur, Ankur Garg, Suman Preet Singh Khanuja
  • Patent number: 7527814
    Abstract: The invention provides a simple method for isolation of calliterpenone (16?,17 dihydroxy-3-oxo phyllocladane), a phyllocladane diterpenoid with the plant growth regulating properties, from plant genus Callicarpa.
    Type: Grant
    Filed: January 30, 2007
    Date of Patent: May 5, 2009
    Assignee: Council of Scientific and Industrial Research
    Inventors: Anil Kumar Singh, Suman Preet Singh Khanuja, Sudeep Tandon, Alok Kalra, Deeptanjali Sahoo, Atul Prakash Kahol, Madan Mohan Gupta, Ram Kishor Verma, Arun Kumar Kukreja, Mansoor Alam, Guru Das Bagachi, Ravi Prakash Bansal, Mahendra Pandurang Darokar, Anil Kumar Gupta
  • Patent number: 7510836
    Abstract: The present invention relates to an alpha-arteether resistance domain (ADR) of Sequence ID No.1 and a method of identifying ADR in alpha-arteether resistant pathogens and lastly, it relates to set three pairs of primers of sequence ID Nos. 3 to 8.
    Type: Grant
    Filed: March 26, 2004
    Date of Patent: March 31, 2009
    Assignee: Council of Scientific & Industrial Research
    Inventors: Suman Preet Singh Khanuja, Suchi Srivastava, Ajit Kumar Shasany, Tiruppadiripuliyur Ranganathan Santha Kumar, Mahendra Pandurang Darokar, Preeti Chand, Sushil Kumar
  • Patent number: 7473768
    Abstract: The present invention relates to a pair of primers with forward primer of SEQ ID NO. 1 having sequence of CCAAGCTTGCTGAACGCATCGG, and reverse primer of SEQ ID No. 2 having sequence of CCAAGCTTGCCACGCAGGATTATC, and a screening method for early identification of plants Artemisia annua having high content of artemisinin and thereby helping generation of plant population with further high content of artemisinin.
    Type: Grant
    Filed: March 31, 2004
    Date of Patent: January 6, 2009
    Assignee: Council of Scientific & Industrial Research
    Inventors: Suman Preet Singh Khanuja, Shilpi Paul, Ajit Kumar Shasany, Mahendra Pandurang Darokar, Ashutosh Kumar Shukla, Madan Mohan Gupta, Anuruddha Kumar
  • Patent number: 7446243
    Abstract: The present invention relates to a cultivar of Phyllanthus amarus ‘CIM-Jeevan’, producing high amount of herb, phyllanthin and hypophyllanthin, wherein said cultivar is developed through ?-irradiation of superior germplasm, the said plant produces high amount of herbage yield ranging between 1.0-1.15 kg per sqm fresh total plant herb, possesses high vegetative erect growth with a height ranging between 60 to 65 cm, produces phyllanthin ranging between 0.70-0.77% in dry herb, produces hypophyllanthin ranging between 0.32-0.37% in dry herb, and shows seed germination of about 90%.
    Type: Grant
    Filed: August 25, 2003
    Date of Patent: November 4, 2008
    Assignee: Council of Scientific and Industrial Research
    Inventors: Anil Kumar Gupta, Suman Preet Singh Khanuja, Madan Mohan Gupta, Ajit Kumar Shasany, Neeraj Jain, Ram Kishor Verma, Mahendra Pandurang Darokar, Guru Das Bagchi, Sushil Kumar
  • Patent number: 7435877
    Abstract: Indian basil, Ocimum basilicum, belongs to the family of Lamiaceae. The essential oil of Indian basil extracted via hydro or steam distillation from the leaves or whole plants is used to flavor foods, dental and oral products, in fragrances, and in traditional rituals and medicines. Extracted essential oil has also been shown to contain biologically active constituents that are insecticidal, nematicidal, fungistatic or which have antimicrobial properties. The present invention relates to the development of an early, short duration, dwarf, high essential oil, methy chavicol and linalool yielding variety of Indian basil (Ocimum basilicum). Family—Lamiaceae) named as ‘CIM-SAUMYA’. This new variety of Indian basil was developed through open pollination in the germplasm followed by half-sib progeny selection and evaluation for the yield characters of selected population for 3 years in field conditions.
    Type: Grant
    Filed: August 6, 2004
    Date of Patent: October 14, 2008
    Assignee: Council of Scientific & Industrial Research
    Inventors: Suman Preet Singh Khanuja, Raj Kishori Lal, Arun Kumar Agnihotri, Ajit Kumar Shasany, Ali Arif Naqvi, Samresh Dwivedi, Hari Om Misra, Om Prakesh Dhawan, Alok Kalra, Aparbal Singh, Janak Raj Bahl, Saudan Singh, Dharani Dhar Patra, Shilpi Agarwal, Mahendra Pandurang Darokar, Anil Kumar Gupta, Moti Lal Gupta, Ram Chandra
  • Patent number: 7435433
    Abstract: The present invention provides an improved process for the isolation of oleane compounds from the bark of Terminalia arjuna (Roxb.). More particularly, the present invention relates to an improved process for the isolation of arjunic acid and its derivates from the bark of Terminalia arjuna (Roxb.). The present invention further provides the identification of arjunic acid [1] and its derivatives as anticancer agent useful in the treatment of various types of cancer in humans.
    Type: Grant
    Filed: March 31, 2006
    Date of Patent: October 14, 2008
    Assignee: Council of Scientific & Industrial Research
    Inventors: Suman Preet Singh Khanuja, Madan Mohan Gupta, Santosh Kumar Srivastava, Tiruppadiripuliyur Ranganathan Santha Kumar, Digvijay Singh, Subash Chandra Verma, Ankur Grag, Merajuddin Khan, Ram Kishor Verma, Raghavendra Kumar Mishra, Subash Chandra Singh
  • Patent number: 7375260
    Abstract: The present invention is related to the development of a novel, distinct high herb and artemisinin yielding genotype of Artemisia annua obtained through systematic marker assisted breeding followed by selection of uniform population in a methodical way wherein the genotype is distinct, uniform and stably maintainable by continuous rouging of off types in the population using DNA marker at early seedling stage from nursery itself and suitable for commercial cultivation.
    Type: Grant
    Filed: January 18, 2006
    Date of Patent: May 20, 2008
    Assignee: Council of Scientific and Industrial Research
    Inventors: Suman Preet Singh Khanuja, Shilpi Paul, Ajit Kumar Shasany, Anil Kumar Gupta, Mahendra Pandurang Darokar, Madan Mohan Gupta, Ram Kishor Verma, Govind Ram, Anuraddha Kumar, Raj Kishori Lal, Ravi Prakash Bansal, Anil Kumar Singh, Rajendra Singh Bhakuni, Sudeep Tandon
  • Patent number: 7291349
    Abstract: The present invention provides an improved preparation based on the synergistic action of garlic extract and essential oil of M. spicata var. Ganga or cinnamon oil against dermatophytic fungus. More particularly, the present invention relates to the synergistic enhancement of activity of a combination by menthyl acetate or Geraniol. The invention also provides a method of preparation of the synergistic combination and the shelf life observed to be more than one year. The cream based preparation is a potent anti-dermatophytic as described and illustrated by in vitro and in vivo evaluations.
    Type: Grant
    Filed: January 21, 2004
    Date of Patent: November 6, 2007
    Inventors: Suman Preet Singh Khanuja, Pushplata Chaturvedi, Anil Kumar Singh, Ajit Kumar Shasany, Vinay Kumar Agarwal, Vivek Kumar Gupta, Subhash Chandra Gupta, Arun Kumar Tripathy, Anirban Pal, Dharmendra Saikia, Mahendra Pandurang Darokar, Krishna Kumar Aggarwal, Ravi Prakash Bansal
  • Publication number: 20070212745
    Abstract: The present invention provides a novel beta glucosidase and a process for extraction of a beta-glucosidase from Rauvolfia serpentine useful for the cleaving of beta-1,4 linkage of PNPG and to convert other gluco-conjugates such as strictosidine and raucaffricine into their corresponding aglycon such as vomilenine, commercially through immobilizing the enzyme. The ? glucosidase enzyme has shown maximum activity in the acid pH range, with high optimum temperature using PNPG as substrate. The crude enzyme, when stored at 4° C., was quite stable for 6 days with 50% loss of activity. The enzyme was activated in presence of FeSO4 in the assay mixture.
    Type: Application
    Filed: September 12, 2006
    Publication date: September 13, 2007
    Inventors: Neelam Singh Sangwan, Sidharth Kumar Misra, Suman Preet Singh Khanuja, Advadesh Kumar Srivastava, Rajender Singh Sangwan
  • Patent number: 7262004
    Abstract: An in vitro screening method for identifying insect tolerant genotypes or clones is described. The method comprises growing plantlets in an in vitro system, screening the plantlets for molecular variation of somaclones using RAPD analysis in vitro, selecting the somaclones having molecular variation, exposing the somaclones to insect larvae or nymphs and identifying the surviving somaclones.
    Type: Grant
    Filed: January 18, 2000
    Date of Patent: August 28, 2007
    Assignee: Council of Scientific and Industrial Research
    Inventors: Suman Preet Singh Khanuja, Ajit Kumar Shasany, Sunita Dhawan, Mahendra Pandurang Darokar, Sarita Satapathy, Tiruppadiripuliyur Ranganathan Santha Kumar, Dharmendra Saikia, Nirmal Kumar Patra, Janak Raj Bahl, Arun Kumar Tripathy, Sushil Kumar
  • Patent number: 7262003
    Abstract: The present invention relates to a method of testing Bacopa monnieri response to abiotic stress factors and for testing bioactivity of natural, synthetic and semisynthetic compounds using Bacopa monnieri plant, which comprises growing the said plant and plant parts aseptically in MS 0 basal medium with agar in microcentrifuge tubes by adding the compounds to be tested either to the culture media or by spraying the said compounds on the plant or plant parts or on the said medium to detect the distinct morphological and cytological responses.
    Type: Grant
    Filed: December 13, 2002
    Date of Patent: August 28, 2007
    Assignee: Council of Scientific and Industrial Research
    Inventors: Sushil Kumar, Suman Preet Singh Khanuja, Mahendra Pandurang Darokar, Tiruppadiripuliyur Ranganathan Santha Kumar, Anita Gangwar, Ajit Kumar Shasany, Srilekha Mishra, Shalini Mathur, Dharmendra Saikia
  • Patent number: 7235262
    Abstract: The invention relates to a novel pharmaceutical composition comprising an effective amount of bio-active fraction from cow urine distillate as a bioavailability facilitator and pharmaceutically acceptable additives selected from anticancer compounds, antibiotics, drugs, therapeutic and nutraceutic agents, ions and similar molecules which are targeted to the living systems.
    Type: Grant
    Filed: April 13, 2004
    Date of Patent: June 26, 2007
    Assignee: Council of Scientific and Industrial Research
    Inventors: Suman Preet Singh Khanuja, Sushil Kumar, Ajit Kumar Shasany, Jai Shankar Arya, Mahendra Pandurang Darokar, Monika Singh, Prachi Sinha, Soumya Awasthi, Subhash Chandra Gupta, Vivek Kumar Gupta, Madan Mohan Gupta, Ram Kishore Verma, Sweta Agarwal, Sunil Balkrishna Mansinghka, Suresh Haribhau Dawle
  • Patent number: 7211428
    Abstract: The present invention relates to the selection and development of superior strain of Bacillus spp for improving plant growth and health by inhibiting pathogenic fungi.
    Type: Grant
    Filed: May 18, 2004
    Date of Patent: May 1, 2007
    Assignee: Council of Scientific and Industrial Research
    Inventors: Abdul Sattar, Mansoor Alam, Abdul Khaliq, Suman Preet Singh Khanuja, Alok Kalra, Abdul Samad, Ajit Kumar Shasany, Mahendra Pandurang Darokar, Ashutosh Kumar Shukla, Togarati Padmapriya, Mohammad Yaseen, Om Parkash Dhawan, Mohammad Zaim, Poovappallivadakethil Viswanathan Nair Ajaya Kumar
  • Publication number: 20070092491
    Abstract: The present invention relates to the selection and development of superior strain of Bacillus spp for improving plant growth and health by inhibiting pathogenic fungi
    Type: Application
    Filed: May 18, 2004
    Publication date: April 26, 2007
    Inventors: Abdul Sattar, Mansoor Alam, Abdul Khaliq, Suman Preet Singh Khanuja, Alok Kalra, Abdul Samad, Ajit Shasany, Mahendra Darokar, Ashutosh Shukla, Togarati Padmapriya, Mohammad Yaseen, Om Parkash Dhawan, Mohammad Zaim, Poovappallivadakethil Viswanathan Nair Ajaya Kumar
  • Patent number: PP20149
    Abstract: A new and distinct somaclone of rose scented geranium Pelargonium graveolens christened ‘Parimal’ characterized by distinct morphology and improved oil yield determining parameters.
    Type: Grant
    Filed: March 30, 2000
    Date of Patent: July 7, 2009
    Assignee: Council of Scientific and Industrial Research
    Inventors: Gauri Saxena, Suchitra Banerjee, Laiq ur Rahman, Gopal Rao Mallavarapu, Srikant Sharma, Suman Preet Singh Khanuja, Sushil Kumar