Methods of Inducing Tissue Regeneration
Methods are provided for producing cells within a lineage (lineage restricted cells) from post-mitotic differentiated cells of the same lineage ex vivo and in vivo, and for treating a subject in need of tissue regeneration therapy by employing these lineage-restricted cells. In addition, the production of lineage restricted cells from postmitotic tissues derived from patients with diseases allows for a characterization of pathways that have gone awry in these diseases and for screening of drugs that will ameliorate or correct the defects as a means of novel drug discovery. Also provided are kits for performing these methods.
Pursuant to 35 U.S.C. §119 (e), this application claims priority to the filing date of the U.S. Provisional Patent Application Ser. No. 61/281,575 filed Nov. 18, 2009; the disclosure of which are herein incorporated by reference.
GOVERNMENT RIGHTSThis invention was made with government support under grants F32 AR051678-01, 5T32 Al07328, 5T32 HD007249, AG009521, and AG020961 from the National Institutes of Health. The United States Government has certain rights in this invention.
FIELD OF THE INVENTIONThis invention pertains to methods for inducing tissue regeneration by producing cells within a lineage, i.e. lineage-restricted cells, from post-mitotic differentiated cells of the same lineage ex vivo and in vivo. Also provided are kits for performing these methods.
BACKGROUND OF THE INVENTIONTissue regeneration in humans is extremely limited and constitutes a major challenge to the repair of damaged organ function. A number of organs rely on undifferentiated stem and progenitor cells for tissue regeneration. However, it is unclear if resident stem cells are capable of regenerating the full mass of tissue required for a given injury. Furthermore, stem cells have not yet been identified for a number of tissues, and in those tissues in which stem cells have been identified, the factors required to induce their propagation and differentiation to acquire the fates of cells in these tissues are not fully understood. Thus, there is a need for methods of inducing well defined differentiated cells of known identity to contribute to cell replacement and tissue regeneration in vivo. Moreover, propagation of such cells ex vivo can be used as cell based therapies upon delivery in vivo. Such methods are also applicable to modeling human diseases ex vivo (eg. skeletal, neuronal, cardiac, pancreatic, hepatic diseases and the like) and elucidating the underlying defects. In addition drugs capable of ameliorating the human disease phenotype can be screened using such disease models.
SUMMARY OF THE INVENTIONMethods for producing cells within a lineage, i.e. lineage-restricted cells (LRCs), from post-mitotic differentiated cells (PMDs) of the same lineage ex vivo and in vivo are provided, wherein the lineage-restricted cells may encompass mitotic progenitor cells committed to a cell lineage (MPC), post-mitotic immature cells committed to a particular type of cell in the cell lineage (post-mitotic immature cell, PMI), and post-mitotic differentiated cells of the cell lineage (post-mitotic differentiated cell, PMD). Also provided are methods for treating a subject in need of tissue regeneration therapy by employing cells produced by methods of the invention. Also provided are kits for performing these methods.
In some embodiments of the invention, a post-mitotic differentiated cell (PMD) is contacted ex vivo with an effective amount of an agent that transiently inhibits activity of a member of the pocket protein family of cell cycle regulators (i.e. a pocket protein) and an effective amount of an agent that transiently inhibits activity of the cyclin-dependent kinase inhibitor 2A (CDKNA2) alternate reading frame protein (ARF). Contact with these agents occurs under conditions that are sufficient to induce the PMD cell to transiently become a replication competent cell (RCC) and divide to produce non-tumorigenic progeny that are post-mitotic immature cells (PMI) of the same lineage as the PMD. In some embodiments, the PMD dedifferentiates in the course of becoming a RCC. In some embodiments, the PMD is a myocyte, e.g., a cardiomyocyte. In some embodiments, the PMD is a hepatocyte. In some embodiments, the PMD is a neuron, e.g. a dopaminergic neuron. Any tissue that harbors post-mitotic cells (e.g. muscle, brain, skin, pancreas, liver, etc) is embodied herein,
In some embodiments, the pocket protein is retinoblastoma protein (RB). In some embodiments, the agent that transiently inhibits RB activity transiently inhibits synthesis of RB protein. In some embodiments, the agent that transiently inhibits ARF transiently inhibits synthesis of ARF protein. In some embodiments, about 10% of PMD present in a population of cells are induced to become RCC and divide.
In some embodiments, a population of progeny PMI are provided with conditions that promote differentiation, so as to produce a population of PMD of a desired lineage. In certain embodiments, progeny PMI are transferred to differentiation conditions by transplanting the progeny to a target site in a subject. In some embodiments, the subject is a subject in need of tissue regeneration therapy, desirably at the target site of transplantation.
In some embodiments of the invention, post-mitotic differentiated cells (PMDs) in a tissue are contacted in vivo with an effective amount of an agent that transiently inhibits the activity of a member of the pocket protein family of cell cycle regulators (i.e. a pocket protein) and an effective amount of an agent that transiently inhibits activity of the cyclin-dependent kinase inhibitor 2A (CDKNA2) alternate reading frame protein (ARF), where the contacted PMDs are induced to transiently become replication competent cells (RCCs) and divide in situ to produce a population of post-mitotic immature cells (PMIs) of the lineage of the tissue. In some embodiments, the PMD dedifferentiates in the course of becoming a RCC. In some embodiments, the post-mitotic differentiated cells are myocytes, e.g. cardiomyocytes. In some embodiments, the PMD are hepatocytes. In some embodiments, the PMD are neurons, e.g. dopaminergic neurons. Any tissue that harbors post-mitotic cells is embodied herein (eg. pancreas).
In some embodiments, the pocket protein is retinoblastoma protein (RB). In some embodiments, the agent that transiently inhibits RB activity transiently inhibits synthesis of RB protein. In some embodiments, the agent that transiently inhibits ARF transiently inhibits synthesis of ARF protein. In some embodiments, the agent that transiently inhibits the activity of the pocket protein and the agent that transiently inhibits the activity of ARF are administered to a target site in a subject. In some embodiments, the subject is a subject in need of tissue regeneration therapy, desirably at the target site of administration of the agent.
In some embodiments, the PMDs are derived from an individual with a disease to characterize that disease (e.g. cortical neurons from Alzheimer's patients, dopaminergic neurons from Parkinson's patients, cardiomyocytes from patients with heritable and acquired cardiac diseases, and the like). In some embodiments, the PMDs are derived from an individual that is alive, e.g. the PMDs are from a live tissue biopsy. In some embodiments, the PMDs are derived from a patient that has died, i.e. the PMDs are from a cadaver.
In some aspects of the invention, a method is provided for screening a candidate agent for an effect on a disease condition. In these methods, lineage-restricted cells (LRCs) are produced from a post-mitotic differentiated cell (PMD) from an individual with a disease condition by methods described above. The LRCs are transferred to conditions that promote differentiation to produce a differentiated population of cells. Cells that are differentiated are contacted with a candidate agent, and the viability and/or function of the cells in the differentiated population are compared to the viability and/or function of differentiated cells not contacted with the candidate agent; wherein enhanced viability and/or function of the cells in the differentiated population contacted with the candidate agent as compared to a differentiated population not contacted with the candidate agent indicates that the candidate agent will have an effect on the disease condition. In some embodiments, the disease condition is a muscle disorder. In some embodiments, the muscle is smooth muscle, skeletal muscle, or cardiac muscle. In some embodiments, the disease condition is a nervous system disorder. In some embodiments, the nervous system disorder is Parkinson's Disease, Alzheimer's Disease, ALS, a disorder of olfactory neurons, a disorder of spinal cord neurons, or a disorder of peripheral neurons. In some embodiments, the PMDs are derived from an individual that is alive. In some embodiments, the PMDs are derived from a cadaver.
In some aspects of the invention, a method is provided for screening a candidate agent for toxicity to a human. In these methods, lineage-restricted cells (LRCs) are produced from a post-mitotic differentiated cell (PMD) from a healthy individual by the subject methods described above. The LRCs are transferred to conditions that promote differentiation to produce a differentiated population of cells. The differentiated population of cells is contacted with a candidate agent, and the viability and/or function of the cells in the differentiated population is compared to the viability and/or function of differentiated cells not contacted with said candidate agent; wherein a decrease in viability and/or function of the cells in the differentiated population contacted with the candidate agent as compared to a differentiated population not contacted with the candidate agent indicates that the candidate agent is toxic to a human. In some embodiments, the PMD is a hepatocyte. In some embodiments, the function of the cells is assess by assessing a cytochrome P450 panel.
The invention is best understood from the following detailed description when read in conjunction with the accompanying drawings. The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee. It is emphasized that, according to common practice, the various features of the drawings are not to-scale. On the contrary, the dimensions of the various features are arbitrarily expanded or reduced for clarity. Included in the drawings are the following figures.
Representative cross-sections of tibialis anterior 10 days post-injection of 2.5×105 cells from TAMcap1 and TAMcap1+RB captured myocytes. Incorporation of dedifferentiated myocytes into pre-existing fibers can be visualized in merged fields by GFP+ staining (green) of a laminin-bound fibers (red), nuclei (blue); to enhance visualization cells were infected with constitutive-eGFP expressing retroviral vector prior to injection. Bar 50 μm. (B) Schematic representation of the events following suppression of RB and p19ARF in primary differentiated myocytes and multi-nucleated myotubes.
(A) Representative images pLE-myog3R-GFP myocytes FACS sorted directly into microwells, imaged before treatment, as well as 72 and 96 hrs after DKD treatment. Magnified panel, highlights expansion of one well following RBsi and p16/19si treatment. Bar 150 μm. (B) Histogram represents percentage of GFP-positive cells that also express myogenin following FACS isolation of subset of cells sorted into microwells. Individual cells were evaluated for expression of each marker. A minimum of 250 cells were counted from random fields. Error bars indicate the mean±SE of two independent experiments. (C) Histogram represents percent colony formation observed in microwells at 96 hrs after treatment. A minimum of 500 wells with at least one cell before treatment counted for each trial. Error bars indicate the mean±SE of at least three independent experiments. (*P<0.005)
Before the present methods and compositions are described, it is to be understood that this invention is not limited to particular method or composition described, as such may, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting, since the scope of the present invention will be limited only by the appended claims.
Where a range of values is provided, it is understood that each intervening value, to the tenth of the unit of the lower limit unless the context clearly dictates otherwise, between the upper and lower limits of that range is also specifically disclosed. Each smaller range between any stated value or intervening value in a stated range and any other stated or intervening value in that stated range is encompassed within the invention. The upper and lower limits of these smaller ranges may independently be included or excluded in the range, and each range where either, neither or both limits are included in the smaller ranges is also encompassed within the invention, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in the invention.
Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, some potential and preferred methods and materials are now described. All publications mentioned herein are incorporated herein by reference to disclose and describe the methods and/or materials in connection with which the publications are cited. It is understood that the present disclosure supercedes any disclosure of an incorporated publication to the extent there is a contradiction.
It must be noted that as used herein and in the appended claims, the singular forms “a”, “an”, and “the” include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to “a cell” includes a plurality of such cells and reference to “the peptide” includes reference to one or more peptides and equivalents thereof, e.g. polypeptides, known to those skilled in the art, and so forth.
The publications discussed herein are provided solely for their disclosure prior to the filing date of the present application. Nothing herein is to be construed as an admission that the present invention is not entitled to antedate such publication by virtue of prior invention. Further, the dates of publication provided may be different from the actual publication dates which may need to be independently confirmed.
DefinitionsMethods for producing cells within a lineage, i.e. lineage-restricted cells (LRCs), from post-mitotic differentiated cells (PMDs) of the same lineage ex vivo and in vivo are provided, wherein the lineage-restricted cells may encompass mitotic progenitor cells committed to a cell lineage (MPC), post-mitotic immature cells committed to the cell lineage (post-mitotic immature cell, PMI), and post-mitotic differentiated cells of the cell lineage (post-mitotic differentiated cell, PMD). The subject lineage-restricted cells that are produced are useful in tissue regeneration; for drug screening; as experimental models of cellular differentiation; for screening in vitro assays to define growth and differentiation factors and to characterize genes involved in cell development and regulation; and the like. These cells may be used directly for these purposes, or they may be genetically modified to provide altered capabilities. These and other objects, advantages, and features of the invention will become apparent to those persons skilled in the art upon reading the details of the compositions and methods as more fully described below.
The term “lineage-restricted cell”, or “LRC”, is used herein to mean a cell within a defined lineage. LRCs encompass mitotic progenitor cells committed to a defined cell lineage (MPC), post-mitotic immature cells committed to a particular type of cell in the cell lineage (post-mitotic immature cell, PMI), and post-mitotic differentiated cells of that cell lineage (post-mitotic differentiated cell, PMD). A lineage-restricted cell is not pluripotent; in other words, it cannot be induced to differentiate into all cell types in the embryo. Rather, it is restricted to differentiating into only the cell or cells of a specified lineage. Examples of lineages would be the skeletal muscle lineage, the cardiac muscle lineage, the neuronal lineage, the pancreatic islet cell lineage, etc.
The term “mitotic progenitor cell”, or “MPC”, is used to describe a mitotic progenitor cell committed to a defined cell lineage. MPC are cells that are able to self-regenerate as well as generate daughter cells of their cell lineage. In other words, an MPC is a mitotic cell that, upon division, gives rise to a) more MPC and/or b) post-mitotic immature cells committed to a particular cell type in the cell lineage (post-mitotic immature cells, PMIs). MPCs are recognizable as such by their expression of one or more markers, i.e. proteins, RNA, etc. that are known in the art to be characteristic of an immature state of differentiation for their cell lineage. In addition, progenitor cells are typically mitotic, and thus incorporate BrdU into their DNA and/or express one or more markers, e.g. proteins, that are typically expressed in mitotic cells, e.g. Ki67, PCNA, Anillin, AuroraB, and Survivin. An example of an MPC is a progenitor cell of the muscle lineage, namely a myoblast, as it can give rise to more myoblasts and/or post-mitotic muscle precursors.
The term “post-mitotic immature cell”, or “PMI”, refers to post-mitotic precursor cells committed to a particular cell type in the cell lineage, that is, post-mitotic cells that have committed to a cell fate but have not yet differentiated to that cell fate. The PMI typically does not have all of the defining characteristics of a fully mature cell of the lineage. PMIs of a lineage are recognizable as such by their expression of one or more markers and a characteristic morphology as is well known in the art. In addition, PMIs are distinguishable from MPCs because they are post-mitotic and thus do not incorporate BrdU into their DNA or express markers that are typically expressed in mitotic cells, e.g. Ki67, PCNA, Anillin, AuroraB, and Survivin. An example of a PMI is a precursor cell of the cardiac muscle lineage, as it is post-mitotic but has not fully differentiated into a cardiomyocyte.
The term “post-mitotic differentiated cell”, or PMD, is used herein to refer to a post-mitotic cell of a cell lineage that has differentiated into a mature, functional cell of a tissue. PMDs express markers that are well-known to the artisan as characteristic of a mature cell fate. In addition, because PMDs are post-mitotic, they do not incorporate BrdU into their DNA or express markers that are typically expressed in proliferating cells, e.g. Ki67, PCNA, Anillin, AuroraB, Survivin, etc. An example of a PMD is a cardiomyocyte, a myofiber, a hepatocyte, a neuron, and the like.
The term “replication competent cell,” or “RCC”, is used to describe a cell that is capable of mitosis. RCC cells may express markers characteristic of a MPC or a PMI, i.e. markers that are known in the art to be characteristic of an immature state of differentiation for their cell lineage. Alternatively, they may express markers of a PMD, i.e. markers that are well-known to the artisan as characteristic of a mature cell fate. In either instance, they incorporate BrdU into their DNA and/or express one or more markers, e.g. proteins, that are typically expressed in mitotic cells, e.g. Ki67, PCNA, Anillin, AuroraB, Survivin, and the like.
It will be understood by those of skill in the art that in discussing the expression of markers by cells as above, the stated expression levels reflect detectable amounts of the marker. A cell that is negative for staining for a marker protein (the level of binding of a marker specific reagent is not detectably different from an isotype matched control) may still express minor amounts of the marker. And while it is commonplace in the art to refer to cells as “positive” or “negative” for a particular marker, actual expression levels are a quantitative trait. For example, the number of molecules on the cell surface can vary by several logs, yet still be characterized as “positive”. The staining intensity of cells can be monitored by flow cytometry, where lasers detect the quantitative levels of fluorochrome (which is proportional to the amount of cell surface marker bound by specific reagents, e.g. antibodies). Although the absolute level of staining may differ with a particular fluorochrome and reagent preparation, the data can be normalized to a control. Alternatively, the staining intensity of cells can be monitored by immunohistochemistry or immunofluorescence. Cell-specific markers that are cell surface proteins may be observed without fixing the cells, i.e. while maintaining cell viability, e.g. by flow cytometry. Alternatively, intracellular markers may be observed in a subpopulation of the subject cells that are fixed and prepared by methods known in the art.
By “dedifferentiate”, it is meant that cells revert from a more differentiated state to a less differentiated state in a cell lineage. In other words, the cells lose traits, e.g. morphology, expression of certain genes, functional capabilities etc. of the more differentiated cell and acquire traits of cells of the lineage that are less mature. By “transiently dedifferentiate,” it is meant that the dedifferentiation phase is temporary; that is, that after a given amount of time and/or under certain given conditions, the dedifferentiated cells and/or their progeny will be permitted to differentiate to a more mature fate, unlike a tumor cell, which is not able to do so.
By “proliferate” it is meant to divide by mitosis, i.e. undergo mitosis. An “expanded population” is a population of cells that has proliferated, i.e. undergone mitosis, such that the expanded population has an increase in cell number, that is, a greater number of cells, than the population at the outset.
The term “explant” refers to a portion of an organ or tissue therein taken from the body and cultured in an artificial medium. Cells that are grown “ex vivo” are cells that are taken from the body in this manner, temporarily cultured in vitro, and returned to the body.
The term “primary culture” denotes a mixed cell population of cells from an organ or tissue within an organ. The word “primary” takes its usual meaning in the art of tissue culture.
The term “tissue” refers to a group or layer of similarly specialized cells which together perform certain special functions.
The term “organ” refers to two or more adjacent layers of tissue, which layers of tissue maintain some form of cell-cell and/or cell-matrix interaction to form a microarchitecture.
A “pocket protein” is a protein that is a member of the pocket protein family of cell cycle regulators. Pocket proteins are tumor suppressor proteins; in other words, they are negative regulators of the cell cycle. There are three known pocket proteins: Retinoblastoma protein (also called RB, RB1, pRB, OSRC, pp110 or p105-RB), p107 (also called RBL1, CP107), and p130 (also called RB2). The human RB polypeptide sequence and the nucleotide sequence that encodes it may be found at Genbank Ref. No. NM—000321 (SEQ ID NO:1 and SEQ ID NO:2). The human p107 polypeptide sequence and the nucleotide sequence that encodes it may be found at Genbank Ref. Nos. NM—002895 (variant 1; SEQ ID NO:3 and SEQ ID NO:4), and NM—183404 (variant 2; SEQ ID NO:5 and SEQ ID NO:6). The human p130 polypeptide sequence and the nucleotide sequence that encodes it may be found at Genbank Ref. No. NM—005611 (SEQ ID NO:7 and SEQ ID NO:8). These proteins negatively regulate the cell cycle in part by repressing E2F transcription factor activity to limit the expression of genes required for cell cycle progression. In the canonical signaling pathway, members of the pocket protein family bind members of the E2F family of proteins to prevent E2F-directed transcription of genes that mediate entry into the cell cycle. Phosphorylation of the pocket proteins or disruption of the pocket protein-E2F interaction releases the E2F proteins, which can now induce the transcription of genes that mediate S-phase entry. This and other mechanisms of action of the pocket proteins are described in more detail in Cobrinik (2005) Oncogene 24:2796-2809, the disclosure of which is incorporated herein by reference.
An “agent that transiently inhibits the activity of a pocket protein” is an agent that transiently antagonizes, inhibits or otherwise negatively regulates the pocket protein's modulation of a cell's activity. Agents that transiently inhibit pocket protein activity can act anywhere along the pocket protein signaling pathway to antagonize pocket protein signaling. Thus, for example, based upon the above described paradigm of pocket protein signaling, agents that inhibit pocket protein modulation of cell activity include those that prevent the synthesis of the pocket protein (e.g. siRNAs for RB, p107, or p130), induce the phosphorylation of the pocket protein (e.g. D cyclin peptides); disrupt binding between the pocket protein and E2F (e.g. human papillomavirus peptide E7); overcome the activity of the pocket protein (e.g. E2F peptides); etc.
The “cyclin-dependent kinase inhibitor 2A (CDKNA2) alternate reading frame” (ARF, also known as p14ARF in humans and p19ARF in mice) is the polypeptide encoded by transcript variant/isoform 4 of the cyclin-dependent kinase inhibitor 2A (CDKNA2, Ink4a, MTS) gene. The ARF polypeptide sequence and the sequence of the CDKNA2 gene that encodes it may be found at Genbank Ref. No. NM—058195 (SEQ ID NO:9 and SEQ ID NO:10). The variant is encoded by an alternate first exon located 20 Kb upstream of the remainder of the gene, which renders the ARF protein structurally unrelated to the proteins encoded by the other CDKNA2 transcript variants p16Ink4a (Genbank Ref. No. NM—000077) and isoform 3 (NM—058197, NP—478104). ARF functions as a stabilizer of the tumor suppressor protein p53, in part by interacting with and sequestering HDM2 (MDM2 p53 binding protein homolog, also called HDMX and MDM2), which is normally responsible for the degradation of p53. During mitosis, Not dead yet 1 (NDY1/KDM2b) represses ARF expression by inducing histone H3K27 trimethylation of the ARF locus; in the absence of ARF protein, HDM2 proteins are available to degrade p53, thereby relieving p53-mediated suppression of mitosis. This and other mechanisms of action of the ARF protein are well known in the art.
An “agent that transiently inhibits the activity of ARE” is an agent that transiently antagonizes, inhibits or otherwise negatively regulates the ARF modulation of cell activity. Agents that inhibit ARF activity can act anywhere along the ARF signaling pathway to antagonize ARF signaling. Thus, for example, based upon the above described paradigm of ARF signaling, agents that inhibit ARF modulation of cell activity include those that inhibit the expression of ARF (e.g. NDY1 peptide), prevent the synthesis of the ARF protein (e.g. ARF siRNA), overcome the activity of the ARF protein (e.g. HDM2 peptide), etc.
The terms “individual,” “subject,” “host,” and “patient,” are used interchangeably herein and refer to any mammalian subject for whom diagnosis, treatment, or therapy is desired, particularly humans.
The terms “treatment”, “treating”, “treat” and the like are used herein to generally refer to obtaining a desired pharmacologic and/or physiologic effect. The effect may be prophylactic in terms of completely or partially preventing a disease or symptom thereof and/or may be therapeutic in terms of a partial or complete stabilization or cure for a disease and/or adverse effect attributable to the disease. “Treatment” as used herein covers any treatment of a disease in a mammal, particularly a human, and includes: (a) preventing the disease or symptom from occurring in a subject which may be predisposed to the disease or symptom but has not yet been diagnosed as having it; (b) inhibiting the disease symptom, i.e., arresting its development; or (c) relieving the disease symptom, i.e., causing regression of the disease or symptom.
General methods in molecular and cellular biochemistry can be found in such standard textbooks as Molecular Cloning: A Laboratory Manual, 3rd Ed. (Sambrook et al., HaRBor Laboratory Press 2001); Short Protocols in Molecular Biology, 4th Ed. (Ausubel et al. eds., John Wiley & Sons 1999); Protein Methods (Bollag et al., John Wiley & Sons 1996); Nonviral Vectors for Gene Therapy (Wagner et al. eds., Academic Press 1999); Viral Vectors (Kaplift & Loewy eds., Academic Press 1995); Immunology Methods Manual (I. Lefkovits ed., Academic Press 1997); and Cell and Tissue Culture: Laboratory Procedures in Biotechnology (Doyle & Griffiths, John Wiley & Sons 1998), the disclosures of which are incorporated herein by reference. Reagents, cloning vectors, and kits for genetic manipulation referred to in this disclosure are available from commercial vendors such as BioRad, Stratagene, Invitrogen, Sigma-Aldrich, and ClonTech.
As summarized above, the subject invention provides methods for producing cells within a lineage, i.e. lineage-restricted cells (LRCs), from post-mitotic differentiated cells (PMDs) of the same lineage ex vivo and in vivo, wherein the lineage-restricted cells may encompass mitotic progenitor cells committed to a cell lineage (mitotic progenitor cells, MPC), post-mitotic immature cells committed to a particular type of cell in the cell lineage (post-mitotic immature cell, PMI), and post-mitotic differentiated cells of that lineage (post-mitotic differentiated cell, PMD). In further describing the subject invention, the subject methods are described first in greater detail, followed by a review of various representative applications in which the subject invention finds use as well as kits that find use in practicing the subject invention.
In practicing the subject methods, post-mitotic differentiated cells (PMDs) are contacted with an agent that transiently inhibits activity of one or more members of the pocket protein family of cell cycle regulators, and an agent that transiently inhibits activity of the transcript variant of the cyclin-dependent kinase inhibitor 2A referred to as ARF. As defined above, PMDs are cells that have completed differentiation to become mature, functional cells in a tissue, e.g. a myocyte in skeletal or heart muscle, an islet cell in pancreas, a hepatocyte in liver, a neuron in CNS tissue or peripheral neural tissue, an osteocyte in bone, hematopoietic cell from blood, etc. PMDs can be identified as such by the expression of one or more proteins or RNAs, i.e. markers, as will be known in the art. In addition, these cells may express one or more subtype-specific markers, as will also be known in the art. In some embodiments, the subject PMDs cells are myocytes, which express one or more of myogenin, myosin heavy chain (MHC), and creatine kinase. In certain embodiments, the myocytes are cardiomyocytes, which are rod shaped and cross-striated in culture and express one or more of proteins cardiac troponin, eHand transcription factor, and cardiac-specific myosins. In certain embodiments, the myocytes are smooth muscle myocytes, which express smooth muscle actin. In certain embodiments, the myocytes are skeletal muscle myocytes, which express one or more of skeletal muscle myosins, skeletal muscle troponin, myoD.
In some embodiments, subject PMDs are contacted with agents in vivo, that is, in the tissue in which they reside, i.e. in situ. In some embodiments, subject PMDs are contacted with agents ex vivo, that is, they are harvested from the body and contacted with agents in vitro. In cases when the method is to be performed ex vivo, the PMDs may be cultured from an explant, e.g. biopsy or autopsy material, as a culture of primary cells. Methods of culturing PMDs from explants are typically specific for the type of primary cell being cultured, and are well known to one of ordinary skill in the art. As one non-limiting example, for embodiments wherein the PMDs are myocytes, exemplary methods may be found in Mitcheson, J S et al. (1998) Cardiovascular Research 39(2):280-300 (for cardiomyocytes); Rosenblatt et al. (1995) In Vitro Cell Dev. Biol Anim 31(10):773-339 (for human skeletal muscle myocytes); Siow, RCM and Pearson, J D (2001) Methods in Molecular Medicine: Angiogenesis protocols 46:237-245 (vascular smooth muscle myocytes); and Graham M, and Willey A. (2003) Methods in Molecular Medicine: Wound healing 78:417-423 (intestinal smooth muscle myocytes), the disclosures of which are incorporated herein by reference.
Subject PMDs are contacted ex vivo or in vivo with an effective amount of an agent that transiently inhibits RB activity and an effective amount of an agent that transiently inhibits ARF activity. As discussed above, an agent that transiently inhibits activity of a pocket protein family member is an agent that transiently antagonizes, inhibits or otherwise negatively regulates the pocket protein's modulation of a cell's activity; agents that transiently inhibit pocket protein activity can therefore act anywhere along a pocket protein signaling pathway as it is known in the art and described above to antagonize pocket protein signaling. Similarly, an agent that transiently inhibits the activity of ARF is an agent that transiently antagonizes, inhibits or otherwise negatively regulates the ARF modulation of cell activity; agents that inhibit pocket protein activity can therefore act anywhere along the pocket protein signaling pathway as it is known in the art and described above to antagonize pocket protein signaling By an effective amount of agent, it is an amount that will transiently reduce the overall activity of the subject pathway by at least about 25%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, by about 100%, such that the cell is now able to enter mitosis and divide. In other words, the overall activity of the subject pathway will be reduced by at least about 2-fold, usually by at least about 5-fold, e.g., 10-fold, 15-fold, 20-fold, 50-fold, 100-fold or more, as compared to a control ,i.e. uncontacted, cell. For agents that transiently inhibit the activity of a pocket protein, this biochemically may be realized by, for example, reducing the amount of pocket protein in the cell by about 10% or 50% or more, 70% or more, 90% or more, or up to 100%; increasing the amount of phosphorylation of the pocket protein by about 10% or 50% or more, by 70% or more, by 100% or more, by 200% or more, by 500% or more; increasing the amount of free E2F in the cell by about 10% or more, 25% or more, 50% or more, 100% or more, 200% or more, 500% or more; etc. as is well known in the art. For agents that transiently inhibit the activity of ARF, this biochemically may be realized by, for example, increasing the amount of free NDY1 in the cell by about 10% or more, 25% or more, 50% or more, 100% or more, 200% or more, 500% or more; reducing the amount of ARF in the cell by about 10% or 30% or more, 50% or more, 70% or more, about 100%; increasing the amount of free HDM2 in the cell by about 10% or more, 25% or more, 50% or more, 100% or more, 200% or more, 500% or more; etc. as is well known in the art. By transiently, it is meant that the inhibition is for a limited period of time. In transiently inhibiting a target pathway, an effective amount of agent will antagonize its target pathway for about 12 hours, about 1 day, about 2 days, about 3 days, about 5 days, about 7 days, about 10 days, about 15 days, about 20 days, or about 30 days. Antagonism of the target pathway may cease either naturally, e.g. because the agent is degraded, naturally inactivated over time, removed from the body of a subject by the blood, etc. or it may be actively shut off, e.g. by providing additional agents that inhibit expression or activity of the subject agent.
Agents suitable for transiently inhibiting pocket protein activity and ARF activity in the present invention include small molecule compounds. Naturally occurring or synthetic small molecule compounds of interest include numerous chemical classes, such as organic molecules, e.g., small organic compounds having a molecular weight of more than 50 and less than about 2,500 daltons. Candidate agents comprise functional groups for structural interaction with proteins, particularly hydrogen bonding, and typically include at least an amine, carbonyl, hydroxyl or carboxyl group, preferably at least two of the functional chemical groups. The candidate agents may include cyclical carbon or heterocyclic structures and/or aromatic or polyaromatic structures substituted with one or more of the above functional groups. Candidate agents are also found among biomolecules including peptides, saccharides, fatty acids, steroids, purines, pyrimidines, derivatives, structural analogs or combinations thereof. Exemplary of pharmaceutical agents suitable for this invention are those described in “The Pharmacological Basis of Therapeutics” (Goodman and Gilman (1996) McGraw-Hill, New York, N.Y., Ninth edition). Also included are toxins, and biological and chemical warfare agents, for example see Somani, S. M. (Ed.), “Chemical Warfare Agents,” Academic Press, New York, 1992. Small molecule compounds can be provided directly to the medium in which the cells are being cultured, for example as a solution in DMSO or other solvent.
Agents suitable for transiently inhibiting pocket protein activity and ARF activity in the present invention also include nucleic acid molecules that inhibit the synthesis of pocket proteins, ARF proteins, and/or other proteins of the pocket protein or ARF pathways, respectively, for example, nucleic acids that encode antisense, siRNA, or shRNA molecules that target the RB, p107, p130 or CDKNA2/Ink4a genes and transcripts.
For example, nucleic acid agents of interest include antisense oligonucleotides (ODN), particularly synthetic ODN having chemical modifications from native nucleic acids, or nucleic acid constructs that express such antisense molecules as RNA. The antisense sequence is complementary to the targeted coding sequence, and inhibits its expression. Antisense molecules may be produced by expression of all or a part of the target coding sequence in an appropriate vector, where the transcriptional initiation is oriented such that an antisense strand is produced as an RNA molecule. Alternatively, the antisense oligonucleotide is a synthetic oligonucleotide. Antisense oligonucleotides will generally be at least about 7, usually at least about 12, more usually at least about 20 nucleotides in length, and not more than about 25, usually not more than about 23-22 nucleotides in length, where the length is governed by efficiency of inhibition, specificity, including absence of cross-reactivity, and the like. Antisense oligonucleotides may be chemically synthesized by methods known in the art. Preferred oligonucleotides are chemically modified from the native phosphodiester structure, in order to increase their intracellular stability and binding affinity. A number of such modifications that alter the chemistry of the backbone, sugars or heterocyclic bases have been described in the literature. Among useful changes in the backbone chemistry are phosphorothioates; phosphorodithioates, where both of the non-bridging oxygens are substituted with sulfur; phosphoroamidites; alkyl phosphotriesters and boranophosphates. Achiral phosphate derivatives include 3′-0′-5′-S-phosphorothioate, 3′-S-5′-O-phosphorothioate, 3′-CH2-5′-O-phosphonate and 3′-NH-5′-O-phosphoroamidate. Peptide nucleic acids replace the entire ribose phosphodiester backbone with a peptide linkage. Sugar modifications are also used to enhance stability and affinity. The alpha-anomer of deoxyribose may be used, where the base is inverted with respect to the natural beta-anomer. The 2′-OH of the ribose sugar may be altered to form 2′-O-methyl or 2′-O-allyl sugars, which provides resistance to degradation without comprising affinity. Modification of the heterocyclic bases must maintain proper base pairing. Some useful substitutions include deoxyuridine for deoxythymidine; 5-methyl-2′-deoxycytidine and 5-bromo-2′-deoxycytidine for deoxycytidine. 5-propynyl-2′-deoxyuridine and 5-propynyl-2′-deoxycytidine have been shown to increase affinity and biological activity when substituted for deoxythymidine and deoxycytidine, respectively. One or a combination of antisense oligonucleotides may be administered, where a combination may comprise multiple different sequences.
As another example, nucleic acid agents of interest include RNA agents that inhibit the synthesis of pocket proteins, ARF protein, or proteins in the pathways activated by these subject proteins. By RNA agents it is meant ribonucleotide-based agents that modulate expression of target genes, i.e. RB, p107, p130, or ARF, or members of their signaling pathways, by an RNA interference mechanism. The RNA agent may be a microRNA; see, e.g. Mudhasani et al. (2008) J Cell Biol 181(7):1055-63, which teaches that miRNAs suppress the expression of ARF. The RNA agent may be an RNAi agent, e.g., a small ribonucleic acid molecule (also referred to herein as an interfering ribonucleic acid), i.e., oligoribonucleotides, that is present in duplex structures, e.g., two distinct oligoribonucleotides hybridized to each other (siRNA) or a single ribooligonucleotide that assumes a small hairpin formation to produce a duplex structure (shRNA). By oligoribonucleotide is meant a ribonucleic acid that does not exceed about 100 nt in length, and typically does not exceed about 75 nt length, where the length in certain embodiments is less than about 70 nt. Where the RNA agent is a duplex structure of two distinct ribonucleic acids hybridized to each other, i.e. an siRNA, the length of the duplex structure typically ranges from about 15 to 30 bp, usually from about 15 to 29 bp, where lengths between about 20 and 29 bps, e.g., 21 bp, 22 bp, are of particular interest in certain embodiments. Where the RNA agent is a duplex structure of a single ribonucleic acid that is present in a hairpin formation, i.e., a shRNA, the length of the hybridized portion of the hairpin is typically the same as that provided above for the siRNA type of agent or longer by 4-8 nucleotides. The weight of the RNAi agents of this embodiment typically ranges from about 5,000 daltons to about 35,000 daltons, and in many embodiments is at least about 10,000 daltons and less than about 27,500 daltons, often less than about 25,000 daltons.
dsRNA can be prepared according to any of a number of methods that are known in the art, including in vitro and in vivo methods, as well as by synthetic chemistry approaches. Examples of such methods include, but are not limited to, the methods described by Sadher et al. ((1987) Biochem. Int. 14:1015); by Bhattacharyya ((1990) Nature 343:48); by Livache, et al. (U.S. Patent No. 5,795,715); by Sambrook, et al. ((1989) Molecular Cloning: A Laboratory Manual, 2nd ed.); in Transcription and Translation ((1984) B. D. Hames, and S. J. Higgins, Eds.); in DNA Cloning, volumes I and II ((1985) D. N. Glover, Ed.); and in Oligonucleotide Synthesis ((1984) M. J. Gait, Ed.), each of which is incorporated herein by reference in its entirety. Single-stranded RNA (ssRNA) can also be produced using a combination of enzymatic and organic synthesis or by total organic synthesis. The use of synthetic chemical methods enable one to introduce desired modified nucleotides or nucleotide analogs into the dsRNA or ssRNA. For example, small interfering double-stranded RNAs (siRNAs) engineered with certain ‘drug-like’ properties such as chemical modifications for stability and cholesterol conjugation for delivery have been shown to achieve therapeutic silencing of an endogenous gene in vivo. To develop a pharmacological approach for silencing target genes in vivo, chemically modified, cholesterol-conjugated single-stranded RNA analogues complementary to sequence in target genes may be synthesized using standard solid phase oligonucleotide synthesis protocols. The RNAs are conjugated to cholesterol, and may further have a phosphorothioate backbone at one or more positions. RNA inhibitory agents may be provided at a final concentration of about 50 nM-500 nM, more usually 100 nM-200 nM.
In certain embodiments, the RNA agent may be a transcriptional template of the interfering ribonucleic acid. In these embodiments, the transcriptional template is typically a DNA that encodes the interfering ribonucleic acid. The DNA may be present in a vector, where a variety of different vectors are known in the art, e.g., a plasmid vector, a viral vector, etc.
Agents suitable for transiently inhibiting the pocket protein activity and ARF activity in the present invention also include polypeptides, e.g. dominant negative peptides, or peptides of targets of the pocket proteins or ARF that are normally antagonized by pocket protein or ARF activity as is understood in the art. Such polypeptides may optionally be fused to a polypeptide domain that increases solubility of the product. The domain may be linked to the polypeptide through a defined protease cleavage site, e.g. a TEV sequence, which is cleaved by TEV protease. The linker may also include one or more flexible sequences, e.g. from 1 to 10 glycine residues. In some embodiments, the cleavage of the fusion protein is performed in a buffer that maintains solubility of the product, e.g. in the presence of from 0.5 to 2 M urea, in the presence of polypeptides and/or polynucleotides that increase solubility, and the like. Domains of interest include endosomolytic domains, e.g. influenza HA domain; and other polypeptides that aid in production, e.g. IF2 domain, GST domain, GRPE domain, and the like.
To promote delivery of the polypeptide to the intracellular domain of the cell, the polypeptide may comprise the polypeptide sequences of interest fused to a polypeptide permeant domain. A number of permeant domains are known in the art and may be used in the non-integrating polypeptides of the present invention, including peptides, peptidomimetics, and non-peptide carriers. For example, a permeant peptide may be derived from the third alpha helix of Drosophila melanogaster transcription factor Antennapaedia, referred to as penetratin, which comprises the amino acid sequence RQIKIWFQNRRMKWKK. As another example, the permeant peptide comprises the HIV-1 that basic region amino acid sequence, which may include, for example, amino acids 49-57 of naturally-occurring tat protein. Other permeant domains include poly-arginine motifs, for example, the region of amino acids 34-56 of HIV-1 rev protein, nona-arginine, octa-arginine, and the like. (See, for example, Futaki et al. (2003) Curr Protein Pept Sci. 2003 April; 4(2): 87-96; and Wender et al. (2000) Proc. Natl. Acad. Sci. U.S.A 2000 Nov. 21; 97(24):13003-8; published U.S. Patent applications 20030220334; 20030083256; 20030032593; and 20030022831, herein specifically incorporated by reference for the teachings of translocation peptides and peptoids). The nona-arginine (R9) sequence is one of the more efficient PTDs that have been characterized (Wender et al. 2000; Uemura et al. 2002).
Agents suitable for transiently inhibiting pocket protein activity and ARF activity in the present invention also include nucleic acids that encode the aforementioned polypeptides that antagonize pocket protein activity and ARF activity. Many vectors useful for transferring nucleic acids into target cells are available. The vectors may be maintained episomally, e.g. as plasmids, minicircle DNAs, virus-derived vectors such cytomegalovirus, adenovirus, etc., or they may be integrated into the target cell genome, through homologous recombination or random integration, e.g. retrovirus derived vectors such as MMLV, HIV-1, ALV, etc. Vectors may be provided directly to the subject cells. In other words, the subject post-mitotic differentiated cells are contacted with vectors comprising the nucleic acid of interest such that the vectors are taken up by the cells. Methods for contacting cells with nucleic acid vectors, such as electroporation, calcium chloride transfection, and lipofection, are well known in the art.
Alternatively, the nucleic acid of interest may be provided to the subject cells via a virus. In other words, the subject post-mitotic differentiated cells are contacted with viral particles comprising the nucleic acid of interest. Retroviruses, for example, lentiviruses, are particularly suitable to the method of the invention. Commonly used retroviral vectors are “defective”, i.e. unable to produce viral proteins required for productive infection. Rather, replication of the vector requires growth in a packaging cell line. To generate viral particles comprising nucleic acids of interest, the retroviral nucleic acids comprising the nucleic acid are packaged into viral capsids by a packaging cell line. Different packaging cell lines provide a different envelope protein to be incorporated into the capsid, this envelope protein determining the specificity of the viral particle for the cells. Envelope proteins are of at least three types, ecotropic, amphotropic and xenotropic. Retroviruses packaged with ecotropic envelope protein, e.g. MMLV, are capable of infecting most murine and rat cell types, and are generated by using ecotropic packaging cell lines such as BOSC23 (Pear et al. (1993) P.N.A.S. 90:8392-8396). Retroviruses bearing amphotropic envelope protein, e.g. 4070A (Danos et al, supra.), are capable of infecting most mammalian cell types, including human, dog and mouse, and are generated by using amphotropic packaging cell lines such as PA12 (Miller et al. (1985) Mol. Cell. Biol. 5:431-437); PA317 (Miller et al. (1986) Mol. Cell. Biol. 6:2895-2902); GRIP (Danos et al. (1988) PNAS 85:6460-6464). Retroviruses packaged with xenotropic envelope protein, e.g. AKR env, are capable of infecting most mammalian cell types, except murine cells. The appropriate packaging cell line may be used to ensure that the subject CD33+ differentiated somatic cells are targeted by the packaged viral particles. Methods of introducing the retroviral vectors comprising the nucleic acid encoding the reprogramming factors into packaging cell lines and of collecting the viral particles that are generated by the packaging lines are well known in the art.
Vectors used for providing nucleic acid of interest to the subject cells will typically comprise suitable promoters for driving the transient expression, that is, transient transcriptional activation, of the nucleic acid of interest. These will typically be inducible promoters, such as promoters that respond to the presence of drugs such as tetracycline. By transcriptional activation, it is intended that transcription will be increased above basal levels in the target cell by at least about 10 fold, by at least about 100 fold, more usually by at least about 1000 fold.
One or more agents that transiently inhibit the activity of one or more pocket proteins may be used. Likewise, one or more agents that transiently inhibit the activity of ARF may be used. The agent(s) may be provided to the subject post-mitotic differentiated cells individually or as a single composition, that is, as a premixed composition, of agents. When provided individually, the agents may be added to the subject post-mitotic differentiated cells simultaneously or sequentially at different times. For example, the agent(s) that transiently inhibits the activity of the pocket protein(s) may be provided first, and the agent(s) that transiently inhibits the activity of ARF is provided second, e.g. 24 hours later.
In some embodiments, additional agents that promote mitosis may be provided to the cell at the contacting step, e.g. growth factors, e.g. bFGF, EGF, BMP, neuregulin, periostin, etc. In some embodiments, agents that promote cell cycle reentry are also provided to the cell in the contacting step. For example, in embodiments in which the subject post-mitotic differentiated cell is a skeletal muscle myocyte, agents that disrupt microtubules such a myoseverin peptide (Rosania G R et al. (2000) Nat Biotechnol. 18(3):304-8) or a small molecule as is known in the art (see, e.g., Duckmanton A, (2005) Chem Biol. 12(10):1117-26, the disclosure of which is incorporated herein by reference) may be provided to fragment the multinucleated skeletal muscle cell. Such agents are typically used when the subject post-mitotic differentiated cell has a morphologically complex phenotype, for example, a cytoskeletal architecture that polarizes the cell, such as the architecture of a multinucleated muscle cell, neuron, hepatocyte, etc.
In embodiments in which the PMDs are induced to become RCCs and divide in vivo, i.e. in situ, agents are administered locally, that is, directly to the target site in a subject, i.e. the tissue. The agents may be provided in any number of ways that are known in the art, e.g. as a liquid (e.g. in any suitable buffer (saline, PBS, DMEM, Iscove's media, etc.)), as a paste, in a matrix support, conjugated to a solid support (e.g. a bead, a filter such as a mesh filter, a membrane, a thread, etc), etc. The conditions in the tissue are typically permissive of dedifferentiation and division of PMDs, and no alteration of the basal conditions is required with the exception of providing the agents as described above.
In embodiments in which the PMDs are induced to become RCCs and divide ex vivo, the cells are contacted with the agents for about 30 minutes to about 24 hours, e.g., 1 hour, 1.5 hours, 2 hours, 3 hours, 4 hours, 6 hours, 8 hours, 12 hours, 18 hours, 20 hours, or any other period from about 30 minutes to about 24 hours in a culture media that is typically used to promote proliferation of progenitor cells of the subject lineage as is known in the art. For example, in embodiments in which the post-mitotic differentiated cell is a myocyte, the agents may be provided in DMEM LG+F10 media that has been supplemented with high levels of serum, e.g. 15%-20% FBS, 1% Pen-Strep, and 1.25-2.5 ng/mL bFGF. In some embodiments, the cells are contacted with agent repeatedly, e.g. with a frequency of about every day to about every 4 days, e.g., every 1.5 days, every 2 days, every 3 days, every 4 days, or any other frequency from about every day to about every four days with the agent. For example, agents may be provided to the subject cells once, and the cells allowed to incubate with the agent for 16-24 hours, after which time the media is replaced with fresh media and the cells are cultured further, or the agents may be provided to the subject cells twice, with two 16-24 hour incubations with the agent following each provision, after which the media is replaced with fresh media and the cells are cultured further.
Transient inhibition of one or more pocket proteins and ARF will transiently induce the subject PMDs to become RCCs and divide. By transiently induced, it is meant that the PMDs are induced to undergo mitosis for a limited amount of time, i.e. 12 hours, 1 day, 2 days, 3 days, 5 days, or 7 days. Accordingly, the subject PMDs and their progeny may undergo 1 round of mitosis, up to 2 rounds of mitosis, up to 3 rounds, up to 4 rounds, up to 5 rounds, up to 6 rounds, or up to 10 rounds of mitosis. This is unlike tumorigenic cells, which undergo unregulated mitosis, i.e., continue to divide for an unlimited amount of time. The period of time in which the RCCs are actively dividing is known as the induction period. During the induction period, a PMD that is transiently induced to divide will give rise to a population, or cohort, of progeny that are lineage-restricted cells. In other words, a PMD may give rise to 2 or more cells, 4 or more cells, 8 or more cells, 16 or more cells, 32 or more cells, 64 or more cells, 100 or more cells, 1000 or more cells, or 10,000 or more cells. In some embodiments, multiple PMDs, i.e. a population of PMDs, are induced to divide, giving rise to a population of progeny that are lineage-restricted cells. At least about 1%, about 2%, about 5%, about 8%, more usually about 10%, about 15%, about 20%, or about 50% of contacted post-mitotic differentiated cells in a population may be induced to divide. In some embodiments, the PMD dedifferentiates in the course of becoming an RCC. In some instances, transient induction may be controlled by providing agents, e.g. Rb and/o ARF-related agents to return to cells to a post-mitotic state. Examples of such RB and/or or ARF related-agents include RB or ARF polypeptides or the cDNA encoding these polypeptides or the active domains thereof.
The progeny of these divisions are all cells of a particular lineage, i.e. lineage-restricted cells (LRCs), that lineage being the lineage of the PMD that was contacted at the outset. While the agents that inhibit the pocket protein and ARF are active, i.e. during the induction period, the LRC of the culture may be mitotic progenitor cells (MPCs) that are committed to the cell lineage of the PMD. Once the agents that inhibit the pocket protein and ARF are no longer active, i.e. following the completion of the induction period, the LRC of the culture may be post-mitotic immature cells (PMIs) that are committed to the cell lineage of the PMD. For example, in embodiments in which the post-mitotic differentiated cell(s) is a myocyte, the progeny LRC during the induction period may be myoblasts (identifiable for their expression of one of more mitotic markers as well as one or more myoblast markers such as myf5 and pax7) and the progeny LRC after the induction period may be muscle precursors (identifiable for their lack of expression of mitotic markers as well as expression of one of more markers including myogenin).
In embodiments in which the PMDs are induced to become RCCs and divide in vivo, i.e. in situ, progeny may spontaneously differentiate into PMD of the lineage, or they may be provided with agents that promote differentiation into PMD of that lineage. Likewise, in embodiments in which the PMDs are induced to become RCCs and divide ex vivo, the progeny may spontaneously differentiate into PMD of the lineage, or they may be transferred to conditions that promote differentiation into the mature population of post-mitotic differentiated cells that they are destined to become. In certain embodiments, the transferring of the cells induced to divide ex vivo to condition that promote differentiation is effected by transplanting the progeny into the tissue of a subject. Cells may be transplanted by any of a number of standard methods in the art for delivering cells to tissue, e.g. injecting them as a suspension in a suitable buffer (saline, PBS, DMEM, Iscove's media, etc.), providing them on a solid support, e.g. a bead, a filter such as a mesh filter, a membrane, etc. In certain embodiments, the transferring is effected by changing the culture media to a media that promotes the differentiation of cells of that lineage, as is known in the art. For example, in embodiments in which the post-mitotic differentiated cell is a myocyte, the LRC that is produced may be induced to differentiate in DMEM LG media that has been supplemented with low levels of serum, e.g. 2% HS, 1% Pen-Strep.
In Vitro UsesLRCs produced by the subject methods find many uses, both in vitro and in vivo. For example, PMDs derived from individuals having a disease have the desired cell-specific identity and disease-related aberrant regulatory program. LRCs produced from these PMDs by the subject methods will also exhibit the disease phenotype. Thus, the propagated LRCs may serve as material for the characterization of the regulatory mechanisms that have gone awry. In addition, these cells will serve as material on which to screen therapeutic agents for their ability to ameliorate the disease phenotype. Accordingly, LRCs produced ex vivo may be used to study the regulatory networks or underlying mechanisms that lead to the disease phenotype. Likewise, LRCs from such diseases may be used to screen candidate therapeutic agents for efficacy and/or for toxicity in ameliorating the regulatory step(s) that have gone awry in the disease state.
In screening assays for biologically active agents, LRCs are produced from PMDs from an individual, e.g. an individual with a disease condition, e.g. a live individual or a cadaver, by the subject methods described above, and allowed to differentiate. The differentiated cells are then contacted with a candidate agent of interest and the effect of the candidate agent is assessed by monitoring one or more output parameters. These output parameters may be reflective of an apoptotic state, such as the amount of DNA fragmentation, the amount of cell blebbing, the amount of phosphatidylserine on the cell surface as visualized by Annexin V staining, and the like by methods described above. Alternatively or additionally, the output parameters may be reflective of the viability of the culture, e.g. the number of cells in the culture, the rate of proliferation of the culture. Alternatively or additionally, the output parameters may be reflective of the health of the cells in the culture, e.g. the length of time that the cells survive in the culture, the presence or absence of ubiquitin-related puncat in the culture, etc. Alternatively or additionally, the output parameters may be reflective of the function of the cells in the culture, e.g. the cytokines and chemokines produced by the cells, the rate of chemotaxis of the cells, the cytotoxic activity of the cells, etc. Such parameters are well known to one of ordinary skill in the art and.
Parameters are quantifiable components of cells, particularly components that can be accurately measured, desirably in a high throughput system. A parameter can be any cell component or cell product including cell surface determinant, receptor, protein or conformational or posttranslational modification thereof, lipid, carbohydrate, organic or inorganic molecule, nucleic acid, e.g. mRNA, DNA, etc. or a portion derived from such a cell component or combinations thereof. While most parameters will provide a quantitative readout, in some instances a semi-quantitative or qualitative result will be acceptable. Readouts may include a single determined value, or may include mean, median value or the variance, etc. Characteristically a range of parameter readout values will be obtained for each parameter from a multiplicity of the same assays. Variability is expected and a range of values for each of the set of test parameters will be obtained using standard statistical methods with a common statistical method used to provide single values.
PMDs useful for producing LRCs include any post-mitotic cell from any tissue comprising post-mitotic cells, e.g. muscle, nervous system, pancreas, liver, etc., e.g. a cardiomyocyte from an individual with a heart condition, a neuron from an individual with Alzheimer's disease, Parkinson's Disease, ALS, etc., as described above.
Candidate agents of interest for screening include known and unknown compounds that encompass numerous chemical classes, primarily organic molecules, which may include organometallic molecules, inorganic molecules, genetic sequences, etc. An important aspect of the invention is to evaluate candidate drugs, including toxicity testing; and the like.
Candidate agents include organic molecules comprising functional groups necessary for structural interactions, particularly hydrogen bonding, and typically include at least an amine, carbonyl, hydroxyl or carboxyl group, frequently at least two of the functional chemical groups. The candidate agents often comprise cyclical carbon or heterocyclic structures and/or aromatic or polyaromatic structures substituted with one or more of the above functional groups. Candidate agents are also found among biomolecules, including peptides, polynucleotides, saccharides, fatty acids, steroids, purines, pyrimidines, derivatives, structural analogs or combinations thereof. Included are pharmacologically active drugs, genetically active molecules, etc. Compounds of interest include chemotherapeutic agents, hormones or hormone antagonists, etc. Exemplary of pharmaceutical agents suitable for this invention are those described in, “The Pharmacological Basis of Therapeutics,” Goodman and Gilman, McGraw-Hill, New York, N.Y., (1996), Ninth edition. Also included are toxins, and biological and chemical warfare agents, for example see Somani, S. M. (Ed.), “Chemical Warfare Agents,” Academic Press, New York, 1992).
Compounds, including candidate agents, are obtained from a wide variety of sources including libraries of synthetic or natural compounds. For example, numerous means are available for random and directed synthesis of a wide variety of organic compounds, including biomolecules, including expression of randomized oligonucleotides and oligopeptides. Alternatively, libraries of natural compounds in the form of bacterial, fungal, plant and animal extracts are available or readily produced. Additionally, natural or synthetically produced libraries and compounds are readily modified through conventional chemical, physical and biochemical means, and may be used to produce combinatorial libraries. Known pharmacological agents may be subjected to directed or random chemical modifications, such as acylation, alkylation, esterification, amidification, etc. to produce structural analogs.
Candidate agents are screened for biological activity by adding the agent to at least one and usually a plurality of cell samples, usually in conjunction with cells lacking the agent. The change in parameters in response to the agent is measured, and the result evaluated by comparison to reference cultures, e.g. in the presence and absence of the agent, obtained with other agents, etc.
The agents are conveniently added in solution, or readily soluble form, to the medium of cells in culture. The agents may be added in a flow-through system, as a stream, intermittent or continuous, or alternatively, adding a bolus of the compound, singly or incrementally, to an otherwise static solution. In a flow-through system, two fluids are used, where one is a physiologically neutral solution, and the other is the same solution with the test compound added. The first fluid is passed over the cells, followed by the second. In a single solution method, a bolus of the test compound is added to the volume of medium surrounding the cells. The overall concentrations of the components of the culture medium should not change significantly with the addition of the bolus, or between the two solutions in a flow through method.
A plurality of assays may be run in parallel with different agent concentrations to obtain a differential response to the various concentrations. As known in the art, determining the effective concentration of an agent typically uses a range of concentrations resulting from 1:10, or other log scale, dilutions. The concentrations may be further refined with a second series of dilutions, if necessary. Typically, one of these concentrations serves as a negative control, i.e. at zero concentration or below the level of detection of the agent or at or below the concentration of agent that does not give a detectable change in the phenotype. In some embodiments, the cells are also contacted with an agent that suppresses DSBR, further sensitizing the cells to the apoptotic effects of the elevated numbers of DSBs.
Various methods can be utilized for quantifying the selected parameters. For example, terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) may be employed to measure DNA fragmentation. Flow cytometry may be employed to detect Annexin V binding to phosphatidylserine on the cell surface. BrdU labeling may be employed to detect proliferation rates. Western blots may be employed to assay cytokines and chemokines secreted into the medium. Migration assays, e.g. in Boyden chambers, may be employed to assay chemotaxis capacity. Antibody-dependent cell-mediated cytotoxicity (ADCC) assays may be employed to assay cytotoxicity of cells. Such methods would be well known to one of ordinary skill in the art.
As another example, LRCs produced ex vivo by the subject methods may be used in research, e.g to elucidate cellular mechanisms of disease. For example, LRCs produced ex vivo may be characterized to determine the mechanisms underlying the disease state and the regulatory pathways that have gone awry. As another example, the genomic DNA and/or RNA of LRCs produced ex vivo may be harvested and profiled to better understand which promoters are more active and which genes are more highly transcribed in which cell lineages and at which stages in development.
LRCs produced ex vivo by the subject methods may also be used to identify novel targets for drugs leading to drug discovery. Agents can be screened for those that modulate particular signaling pathways to better understand the roles that these signaling pathways play in the differentiation of cells of a particular lineage. Such agents may constitute new therapeutics that ameliorate the disease state.
Additionally, LRCs produced by the subject methods may be used to screen for compounds for their toxicity. For example, LRCs may be prepared from hepatocytes using the subject methods, and those LRCs differentiated into hepatocytes by the subject methods. The newly differentiated LRCs may then be used to screen drugs for toxicity. Examples of parameters indicative of cell function that may be assayed in such screens include members of the cytochrome P450 panel, or “CYP”, as well known in the art.
In Vivo UsesAs another example, LRCs have the potential to contribute to the tissue from which the starting PMDs were acquired, and thus LRCs produced ex vivo or in vivo may be used for reconstituting or supplementing differentiating or differentiated cells in a recipient, that is, for regenerating tissue. For example, in embodiments of the above methods in which the subject post-mitotic differentiated cells are myocytes, transplanting lineage-restricted cells generated by ex vivo methods described above into muscle, or producing lineage-specific cells in situ in the muscle by in vivo methods described above results in the differentiation of new muscle cells in the patient. Muscle regeneration as used herein refers to the process by which new muscle fibers form from muscle progenitor cells or muscle precursor cells. A therapeutic composition will usually confer an increase in the number of new fibers by at least 1%, more preferably by at least 20%, and most preferably by at least 50%. The growth of muscle may occur by the increase in the fiber size and/or by increasing the number of fibers. The growth of muscle may be measured by an increase in wet weight, an increase in protein content, an increase in the number of muscle fibers, an increase in muscle fiber diameter; etc. An increase in growth of a muscle fiber can be defined as an increase in the diameter where the diameter is defined as the minor axis of ellipsis of the cross section.
Muscle regeneration may also be monitored by the mitotic index of muscle. For example, cells may be exposed to a labeling agent for a time equivalent to two doubling times. The mitotic index is the fraction of cells in the culture which have labeled nuclei when grown in the presence of a tracer which only incorporates during S phase (i.e., BrdU) and the doubling time is defined as the average S time required for the number of cells in the culture to increase by a factor of two. Productive muscle regeneration may be also monitored by an increase in muscle strength and agility.
Muscle regeneration may also be measured by quantitation of myogenesis, i.e. fusion of myoblasts to yield myotubes. An effect on myogenesis results in an increase in the fusion of myoblasts and the enablement of the muscle differentiation program. For example, the myogenesis may be measured by the fraction of nuclei present in multinucleated cells in relative to the total number of nuclei present. Myogenesis may also be determined by assaying the number of nuclei per area in myotubes or by measurement of the levels of muscle specific protein by Western analysis.
The survival of muscle fibers may refer to the prevention of loss of muscle fibers as evidenced by necrosis or apoptosis or the prevention of other mechanisms of muscle fiber loss. Muscles can be lost from injury, atrophy, and the like, where atrophy of muscle refers to a significant loss in muscle fiber girth.
Tissue regeneration therapy that employs the lineage-restricted cells produced by the subject methods are useful for treating subjects suffering from a wide range of diseases or disorders. For example, in embodiments in which the post-mitotic differentiated cells are myocytes, subjects suffering from muscular disorders, e.g., acute cardiac ischemia, injury due to surgery (e.g. tumor resection) or physical trauma (amputation/gunshot wound), or degenerative heart diseases such as ischemic cardiomyopathy, conduction disease, and congenital defects, etc. could especially benefit from regenerative tissue therapies that use the lineage-restricted cells of the subject method.
Particular examples of muscle disorders that could be treated with the subject cells include disorders of the heart muscle. Such disorders include, without limitation, myocardial infarction (interruption of blood supply to a part of the heart, causing heart cells to die); cardiac arrest (failure of the heart to contract effectively); heart failure (a progressive inability of the heart to supply sufficient blood flow to meet the body's needs, often but not always due to myocardial infarction or cardiac arrest); cardiac ischemia reperfusion injury (injury to a tissue due to reperfusion of the tissue with blood following an ischemic condition); cardiomyopathy (muscle weakness due to e.g. ischemia, drug or alcohol toxicity, certain infections (including Hepatitis C), and various genetic and idiopathic (i.e., unknown) causes); injury due to surgery, and degenerative heart diseases such as conduction disease and congenital defects.
Other examples of muscle disorders that could be treated with the subject cells, particularly allogeneic cells and/or genetically modified autologous cells, include muscular dystrophies such as Duchenne dystrophy and Becker muscular dystrophy. Duchenne dystrophy is an X-linked recessive disorder characterized by progressive proximal muscle weakness with destruction and regeneration of muscle fibers and replacement by connective tissue. Duchenne dystrophy is caused by a mutation at the Xp21 locus, which results in the absence of dystrophin, a protein found inside the muscle cell membrane. It affects 1 in 3000 live male births. Symptoms typically start in boys aged 3 to 7 yr. Progression is steady, and limb flexion contractures and scoliosis develop. Firm pseudohypertrophy (fatty and fibrous replacement of certain enlarged muscle groups, notably the calves) develops. Most patients are confined to a wheelchair by age 10 or 12 and die of respiratory complications by age 20. Becker muscular dystrophy is a less severe variant, also due to a mutation at the Xp21 locus. Dystrophin is reduced in quantity or in molecular weight. Patients usually remain ambulatory, and most survive into their 30s and 40s.
Other particular examples of muscle disorders that could be treated with the subject cells, particularly allogeneic cells and/or genetically modified autologous cells, include the non-dystrophic myopathies such as congenital and metabolic myopathies, including glycogen storage diseases and mitochondrial myopathies. Congenital myopathies are a heterogeneous group of disorders that cause hypotonia in infancy or weakness and delayed motor milestones later in childhood. An autosomal dominant form of nemaline myopathy is linked to chromosome 1 (tropomyosin gene), and a recessive form to chromosome 2. Other forms are caused by mutations in the gene for the ryanodine receptor (the calcium release channel of the sarcoplasmic reticulum) on chromosome 19q. Skeletal abnormalities and dysmorphic features are common. Diagnosis is made by histochemical and electron microscopic examination of a muscle sample to identify specific morphologic changes.
Mitochondrial myopathies range from mild, slowly progressive weakness of the extraocular muscles to severe, fatal infantile myopathies and multisystem encephalomyopathies. Some syndromes have been defined, with some overlap between them. Established syndromes affecting muscle include progressive external ophthalmoplegia, the Kearns-Sayre syndrome (with ophthalmoplegia, pigmentary retinopathy, cardiac conduction defects, cerebellar ataxia, and sensorineural deafness), the MELAS syndrome (mitochondrial encephalomyopathy, lactic acidosis, and stroke-like episodes), the MERFF syndrome (myoclonic epilepsy and ragged red fibers), limb-girdle distribution weakness, and infantile myopathy (benign or severe and fatal). Muscle biopsy specimens stained with modified Gomori's trichrome stain show ragged red fibers due to excessive accumulation of mitochondria. Biochemical defects in substrate transport and utilization, the Krebs cycle, oxidative phosphorylation, or the respiratory chain are detectable. Numerous mitochondrial DNA point mutations and deletions have been described, transmitted in a maternal, nonmendelian inheritance pattern. Mutations in nuclear-encoded mitochondrial enzymes occur.
Glycogen storage diseases of muscle are a group of rare autosomal recessive diseases characterized by abnormal accumulation of glycogen in skeletal muscle due to a specific biochemical defect in carbohydrate metabolism. These diseases can be mild or severe. In a severe form, acid maltase deficiency (Pompe's disease), in which 1,4-glucosidase is absent, is evident in the first year of life and is fatal by age 2. Glycogen accumulates in the heart, liver, muscles, and nerves. In a less severe form, this deficiency may produce proximal limb weakness and diaphragm involvement causing hypoventilation in adults. Myotonic discharges in paraspinal muscles are commonly seen on electromyogram, but myotonia does not occur clinically. Other enzyme deficiencies cause painful cramps after exercise, followed by myoglobinuria. The diagnosis is supported by an ischemic exercise test without an appropriate rise in serum lactate and is confirmed by demonstrating a specific enzyme abnormality.
Channelopathies are neuromuscular disorders with functional abnormalities due to distuRBance of the membrane conduction system, resulting from mutations affecting ion channels. Myotonic disorders are characterized by abnormally slow relaxation after voluntary muscle contraction due to a muscle membrane abnormality.
Myotonic dystrophy (Steinert's disease) is an autosomal dominant multisystem disorder characterized by dystrophic muscle weakness and myotonia. The molecular defect is an expanded trinucleotide (CTG) repeat in the 3″ untranslated region of the myotonin-protein kinase gene on chromosome 19q. Symptoms can occur at any age, and the range of clinical severity is broad. Myotonia is prominent in the hand muscles, and ptosis is common even in mild cases. In severe cases, marked peripheral muscular weakness occurs, often with cataracts, premature balding, hatchet facies, cardiac arrhythmias, testicular atrophy, and endocrine abnormalities. Mental retardation is common. Severely affected persons die by their early 50s.
Myotonia congenita (Thomsen's disease) is a rare autosomal dominant myotonia that usually begins in infancy. In several families, the disorder has been linked to a region on chromosome 7 containing a skeletal muscle chloride channel gene. Painless muscle stiffness is most troublesome in the hands, legs, and eyelids and improves with exercise. Weakness is usually minimal. Muscles may become hypertrophied. Diagnosis is usually established by the characteristic physical appearance, by inability to release the handgrip rapidly, and by sustained muscle contraction after direct muscle percussion.
Familial periodic paralysis is a group of rare autosomal dominant disorders characterized by episodes of flaccid paralysis with loss of deep tendon reflexes and failure of muscle to respond to electrical stimulation. The hypokalemic form is due to genetic mutation in the dihydropyridine receptor-associated calcium channel gene on chromosome 1 q. The hyperkalemic form is due to mutations in the gene on chromosome 17q that encodes a subunit of the skeletal muscle sodium channel (SCN4A).Subjects suffering from muscular disorders e.g., acute cardiac ischemia, degenerative heart diseases such as ischemic cardiomyopathy, conduction disease, and congenital defects, or injury due to surgery, etc. could especially benefit from regenerative tissue therapies.
Diseases other than those of the musculature may similarly be treated by regenerative tissue therapy that employs lineage-restricted cells produced by the subject methods. For example, diseases of the central nervous system (CNS) or the peripheral nervous system (PNS) may be treated by such therapy. For example, for the treatment of Parkinson's disease, dopaminergic neurons may be transiently induced to divide, giving rise to neural progenitors (i.e. mitotic cells of the neural lineage) or neural precursors (post-mitotic cells of the neural lineage, i.e. following exit from mitosis) that may be transferred into the substantia nigra of a subject suffering from Parkinson's disease. Alternatively, the neural progenitors or neural precursors may be induced to differentiate into dopaminergic neurons ex vivo, and then transferred into the substantia nigra or striatum of a subject suffering from Parkinson's disease. Alternatively, dopaminergic neurons of the substantia nigra of a subject suffering from Parkinson's disease may be induced to transiently divide in situ. Descriptions of post-mitotic differentiated neurons, neuronal progenitor and precursor cells, and how to culture these cells are have been described in the art. Other diseases and disorders of the nervous system that may benefit from the subject methods include Alzheimer's Disease, ALS, disorders of olfactory neurons, a disorder of spinal cord neurons, a disorder of peripheral neurons, and other disorders due to injury or disease.
For the treatment of multiple sclerosis, spinal cord injury, or other disorder of the Central Nervous System in which enhancing myelination is desirable to treat the disorder, oligodendrocytes may be transiently induced to divide, giving rise to oligodendrocyte progenitors (MPCs) or oligodendrocyte precursors (PMIs), which are then transferred to a subject suffering from a demyelinating condition of the CNS, e.g. Multiple sclerosis, etc. or other condition wherein it is desirable to enhance myelination, e.g. spinal cord injury, etc., at the site where enhanced myelination is desired. Alternatively, the oligodendrocyte progenitors or oligodendrocyte precursors may be induced to differentiate into oligodendrocytes ex vivo, and then transferred into the subject suffering from the MS, spinal cord injury, etc., at the site where enhanced myelination is desired. Alternatively, oligodendrocytes of a subject suffering from the MS, spinal cord injury, etc. may be induced to transiently divide in situ at the site where enhanced myelination is desired. Descriptions of post-mitotic differentiated oligodendrocytes, oligodendrocyte progenitors, and oligodendrocyte precursors, and how to culture these cells are described in Dugas, J. et al. (2006) J Neurosci. 26:10967-10983 and US Application No. 20090258423, the disclosures of which is incorporated herein by reference.
In other examples, pancreatic islet cell progenitor (MPC) or precursor (PMI) cells derived from post-mitotic differentiated pancreatic islet cells may be transplanted into a subject suffering from diabetes (e.g., diabetes mellitus, type 1), see e.g., Burns et al., (2006) Curr. Stem Cell Res. Ther., 2:255-266. Descriptions of post-mitotic differentiated cells of the pancreas, i.e. islet cells, the progenitor and precursor cells of that lineage, and how to culture these cells are described in U.S. Pat. No. 6,326,201, the disclosure of which is incorporated herein by reference.
Hepatic progenitor cells or post-mitotic differentiated hepatic cells derived from post-mitotic differentiated hepatic cells are transplanted into a subject suffering from a liver disease, e.g., hepatitis, cirrhosis, or liver failure.
In some instances, it will be desirable to regenerate tissue with lineage-restricted cells that were produced from post-mitotic differentiated cells of allogeneic tissue, that is, tissue from a different host, for example, where the disease conditions result from genetic defects in tissue-specific cell function. Where the dysfunction arises from conditions such as trauma, the subject cells may be isolated from autologous tissue, and used to regenerate function. Autologous cells may also be genetically modified, in order to correct disease conditions results from genetic defects. Alternatively, where the dysfunction arises from conditions such as trauma, post-mitotic differentiated cells may be transiently induced to divide in situ, giving rise to lineage-restricted cells that will differentiate and incorporate into the injured tissue.
As alluded to above, genes may be introduced into the subject lineage-restricted cells that have been produced ex vivo for a variety of purposes, e.g. to replace genes having a loss of function mutation, provide marker genes, etc. Alternatively, vectors are introduced that express antisense mRNA or ribozymes, thereby blocking expression of an undesired gene. Other methods of gene therapy are the introduction of drug resistance genes to enable normal progenitor cells to have an advantage and be subject to selective pressure, for example the multiple drug resistance gene (MDR), or anti-apoptosis genes, such as bcl-2. Various techniques known in the art may be used to introduce nucleic acids into the lineage-restricted cells, e.g. electroporation, calcium precipitated DNA, fusion, transfection, lipofection, infection and the like, as discussed above. The particular manner in which the DNA is introduced is not critical to the practice of the invention.
To prove that one has genetically modified the subject lineage-restricted cells, various techniques may be employed. The genome of the cells may be restricted and used with or without amplification. The polymerase chain reaction; gel electrophoresis; restriction analysis; Southern, Northern, and Western blots; sequencing; or the like, may all be employed. The cells may be grown under various conditions to ensure that the cells are capable of maturation to all of the myeloid lineages while maintaining the ability to express the introduced DNA. Various tests in vitro and in vivo may be employed to ensure that the potential of the cells to differentiate into a cell of a particular lineage has been maintained.
The lineage-restricted cells may be used as a therapy to treat disease (e.g., a genetic defect). The therapy may be directed at treating the cause of the disease; or alternatively, the therapy may be to treat the effects of the disease or condition. Lineage-restricted cells produced by the ex vivo methods above may be transferred to, or close to, an injured site in a subject, that is, delivered/administered locally; or the cells can be introduced to the subject in a manner allowing the cells to migrate, or home, to the injured site. The transferred cells may advantageously replace the damaged or injured cells and allow improvement in the overall condition of the subject. In some instances, the transferred cells may stimulate tissue regeneration or repair.
The lineage-restricted cells may be administered in any physiologically acceptable excipient, where the cells may find an appropriate site for regeneration and differentiation. The cells may be introduced by injection, catheter, or the like. The cells may be frozen at liquid nitrogen temperatures and stored for long periods of time, being capable of use on thawing. If frozen, the cells will usually be stored in a 10% DMSO, 50% FCS, 40% RPMI 1640 medium. Once thawed, the cells may be expanded by use of growth factors and/or feeder cells associated with progenitor cell proliferation and differentiation.
The cells of this invention can be supplied in the form of a pharmaceutical composition, comprising an isotonic excipient prepared under sufficiently sterile conditions for human administration. Choice of the cellular excipient and any accompanying elements of the composition will be adapted in accordance with the route and device used for administration. The composition may also comprise or be accompanied with one or more other ingredients that facilitate the engraftment or functional mobilization of the cells. Suitable ingredients include matrix proteins that support or promote adhesion of the cells.
The subject methods are useful for both prophylactic and therapeutic purposes. Thus, as used herein, the term “treating” is used to refer to both prevention of disease, and treatment of a pre-existing condition. The treatment of ongoing disease, to stabilize or improve the clinical symptoms of the patient, is a particularly important benefit provided by the present invention. Such treatment is desirably performed prior to loss of function in the affected tissues; consequently, the prophylactic therapeutic benefits provided by the invention are also important. Evidence of therapeutic effect may be any diminution in the severity of disease. The therapeutic effect can be measured in terms of clinical outcome or can be determined by immunological or biochemical tests.
The dosage of the therapeutic formulation will vary widely, depending upon the nature of the condition, the frequency of administration, the manner of administration, the clearance of the agent from the host, and the like. The initial dose can be larger, followed by smaller maintenance doses. The dose can be administered as infrequently as weekly or biweekly, or more often fractionated into smaller doses and administered daily, semi-weekly, or otherwise as needed to maintain an effective dosage level.
The number of administrations of treatment to a subject may vary. Introducing the lineage-restricted cells into the subject may be a one-time event; but in certain situations, such treatment may elicit improvement for a limited period of time and require an on-going series of repeated treatments. In other situations, multiple administrations of the cells may be required before an effect is observed. The exact protocols depend upon the disease or condition, the stage of the disease and parameters of the individual subject being treated, and can be readily determined by one of ordinary skill in the art.
The invention also provides a pharmaceutical pack or kit comprising one or more containers filled with one or more of the ingredients of the compositions of the invention, e.g. an agent that transiently inhibits the activity of a pocket protein family member and an agent that transiently inhibits the activity of ARF. Associated with such container(s) can be a notice in the form prescribed by a governmental agency regulating the manufacture, use or sale of pharmaceuticals or biological products, which notice reflects approval by the agency of manufacture, use or sale for human administration.
The following example is put forth so as to provide those of ordinary skill in the art with a complete disclosure and description of how to make and use the present invention, and are not intended to limit the scope of what the inventors regard as their invention nor are they intended to represent that the experiments below are all or the only experiments performed. Efforts have been made to ensure accuracy with respect to numbers used (e.g. amounts, temperature, etc.) but some experimental errors and deviations should be accounted for. Unless indicated otherwise, parts are parts by weight, molecular weight is weight average molecular weight, temperature is in degrees Centigrade, and pressure is at or near atmospheric.
All publications and patent applications cited in this specification are herein incorporated by reference as if each individual publication or patent application were specifically and individually indicated to be incorporated by reference.
EXAMPLE Materials and MethodsMice and primary myoblast preparation. Rosa26-CreERT2 RBlox/lox mice bred and maintained as described in (Viatour, P., et al. (2008) Cell Stem Cell 3(4): 416-428) were crossed to mice carrying a Cre-responsive β-galactosidase reporter allele (Ventura, A., et al. (2007) Nature 445(7128): 661-665). The hind leg muscles of 6-8 weeks old genotyped offspring mice were prepared for primary myoblasts harvest as described (Rando, T. A. and Blau, H. M. (1994) The Journal of Cell Biology 125(6): 1275-1287). Primary myoblasts after harvest were selected in F10 media (Gibco) supplemented with 20% FBS (Omega scientific), 2.5ng/mL bFGF (Promega), and 1% Pen-Strep (Gibco) for a week on collagen (Sigma) coated plates.
Cell culture. C2C12 mouse myoblasts were cultured at 10% CO2 37° C. in DMEM HG (Gibco) supplemented with 20% FBS+1% Pen-Strep. Myoblasts were seeded for fusion as described (Pajcini, K. V., et al. (2008) The Journal of Cell Biology 180(5): 1005-1019) under low serum conditions in DMEM supplemented with 2% HS, on collagen coated plates. DM media was replaced every 24 hrs. After primary myoblast harvest and selection, passages were counted once cells were cultured and expanded on growth media: DMEM LG+F10 media supplemented with 15% FBS, 1% Pen-Strep and 1.25 ng/mL bFGF, and plated on collagen coated plates. Primary myoblasts were seeded for fusion under low serum conditions in DMEM LG, 2% HS 1% Pen-Strep at 6×105 cells per 6 cm plate and for sparse, single-cell differentiation at 5×104 cells per 6 cm plate. Cell seeding numbers were adjusted depending on the surface area of different plating platforms from the 6 cm standards described above.
Cloning and vector construction. pLE-myog3R-GFP retroviral vector was constructed by subcloning the myogenin promoter elements driving GFP expression from peGFPN1-hmyg by digestion at NotI/EcoR0109 into pLE-GFP retroviral vector backbone at XhoI/NaeI sites, after removal of CMV-GFP cassette by blunt cloning (T4 DNA pol and CIP treatment). Both forward and reverse insertion orientation were tested as described in
siRNA silencing and semi-quantitative RT-PCR (sqRT-PCR). RNA-interference was carried out using small-interfering RNAs (siRNAs) duplexes designed then screened for specific and effective knockdown of target genes. Duplexes employed for experiments shown in this article designed for p16/19 sense sequence AGGUGAUGAUGAUGGGCAAUU (SEQ ID NO:11) and p19ARF sense sequence GCUCUGGCUUUCGUGAACAUG (SEQ ID NO:12) or ordered directly as ON-TARGETplus siRNA RB1 (J-047474-06) from Thermo/Dharmacon. For control transfections non-targeting siRNA#1 (D-001810-01-05) and siGlo-Green were purchased from Thermo/Dharmacon. Transfections of siRNA duplexes, resuspended in siRNA buffer (Dharmacon) were carried out after differentiation of myocytes or after fusion of myotubes at 48-72 hrs in DM with silmporter transfection reagent (Millipore) as per manufacturer's instructions with final siRNA concentration at 100-200 nM. Transfection mix was added to cells after supplemented to differentiation media for 12 hrs. RNA was harvested from C2C12 or primary cells in GM or DM by RNeasy mini kit (Qiagen) and 200 ng of total RNA was used in semi-quantitative RT-PCR analysis with Superscript III One-Step RT-PCR (invitrogen). Primers designed for genes tested are listed below all sequences are in 5′-3′ orientation:
Annealing temperature ranged from 58-62° C. and cycles from 23 (Myogenin) to 31 (p19ARF) with most products visible at 26 to 28 cycles. For RNA loading control 50 ng of total RNA was run with GAPDH primers and visualized at 22 cycles.
BrdU analysis. 5-bromo-2′-deoxy-uridine (BrdU) labeling and detection kit (Roche) was employed on C2C12 myotubes and primary myocytes and myotubes. BrdU labeling reagent was added to the cells with fresh DM media for 12 hrs after the treatments outlaid in each of the schemes in
Western analysis. Cells were lysed at room temperature in lysis buffer (50 mM Tris pH 7.5, 10 mM MgCl2, 0.3 M NaCl, 2% IGEPAL). Lysates were cleared by centrifugation 5 min at 6000 rpm at 4° C., and protein quantification was determined by Bradford assay (Bio-Rad). Immunoblotting was conducted using NuPage system from invitrogen. Samples were loaded in 10% Bis-Tris pre-cast gels, resolved by running with MES or MOPS SDS buffer, and transferred at 4° C. onto Immobilon-P membranes (Amersham). Membranes were blocked in 5% milk-PBS-T then incubated with antibodies against RB (BD) diluted 1/250 or RB (Sage lab) 1/1000; p19ARF (abcam) 1/1000; Survivin (Cytoskeleton Inc) 1/1000; AuroraB (Cytoskeleton Inc.) 1/500; MHC (Chemicon) 1/500; adult MHC (Blau lab) 1/50; M-CK (Novus) 1/500; Myogenin (BD) 1/500; and GAPDH as protein loading control diluted 1/10000 (Santa Cruz biotech). Membranes were then incubated with HRP-conjugated secondary antibodies ( 1/5000) (Zymed) and detected by ECL or ECL+ detection reagents (Amersham). When necessary, membranes were stripped by incubating at 50° C. for 45 min and then 1 hr at RT in stripping buffer (100 mM 2-mercaptoethanol, 2% SDS, 62 mM Tris, pH7).
Immunofluorescence. C2C12 myotubes and primary myocytes or myotubes seeded densely for fusion or sparsely for differentiation as described above were fixed and permeabilized as per manufacturer's instructions when co-staining with BrdU or with 1.5% paraformaldehyde 15 min at room temperature (RT) then permeabilized with 0.3% Triton-PBS 10 min at RT. All fixed cells were blocked with 20% goat serum for 30 min at RT or 8 hrs at 4° C. Primary antibodies for myosin heavy chain (MHC) (Chemicon) diluted 1/75 in blocking buffer or adult MHC diluted 1/20 were incubated at RT for 30 min. Primary antibodies for myogenin-RBt (Santa Cruz biotech) 1/100 or myogenin-Ms (BD) 1/250, incubated at RT for 1 hr. Primary antibodies for GFP-RBt (Invitrogen) 1/500 incubated at RT for 1 hr. Primary antibodies for survivin (Cytoskeleton Inc.) 1/250 incubated for 1 hr at RT. Primary antibodies for Ki67 (Dako) diluted 1/100 and incubated for 8 hrs at 4° C. Secondary antibodies (Invitrogen) Alexa-488 GtaMs or GtaRBt and Alexa-546 GtaMs or GtaRBt and Alexa-546 GtaRat were diluted 1/500 and incubated with appropriate primary combinations for 45 min at room temperature. When co-staining after BrdU labeling, secondary antibody for BrdU was FITC-aMs diluted 1/40 and incubated 30 min at 37° C. Nuclear staining of cells with Hoechst 33258 (Sigma) diluted 1/5000 and incubated at room temperature for 15 min. Cells were imaged with Zeiss Axioplan2 using 40× water immersion objective, Zeiss Axiovert 200M, or Zeiss Observer Z1 using NeoFluar 10× or LD Plan NeoFluar 20× objectives while ORCA-ER C4742-95; Hamamatsu Photonics, or Axiocam MRm cameras were used to capture image. Openlab 5.0.2, Volocity 3.6.1 (Improvision), and PALM Robo V4 (Zeiss) were the software used for image acquisition. Images were composed and edited in Photoshop CS (Adobe). Background was reduced using contrast adjustments and color balance was performed to enhance colors. All modifications were applied to the entire image.
FACS sorting. Cells were harvested from culture dishes after 0.05% trypsin treatment, centrifuged and resuspended in FACS buffer (PBS+2% GS+2 mM EDTA), and kept on ice until analysis. Cells were analyzed and sorted using a FACSVantage SE (BD Biosciences), with the DIVA analysis software. Dead cells were gated out by staining with Propidium Iodide (1μg/ml), and cells were sorted for GFP expression at low pressure to preserve cell viability. Double sort was carried out in order to obtain a purity of 99% viable cells. In the second sort, cells were sorted directly in GM or DM as indicated and then seeded in different platforms (microwells or PALM duplex dishes).
PALM LPC. Primary myoblasts were sparsely seeded for differentiation in 50 mm or 35 mm laminin (Roche) coated Duplexdishes (Zeiss). 72-96 hrs after DM switch and upon verification of GFP expression by direct native fluorescence, myocytes were treated as described in
Immunocytochemistry. 10 days after injection, TA muscles were dissected and immersed in PBS/0.5% EM-grade PFA (Polysciences) for 2 h at room temperature followed by overnight immersion in PBS with 20% sucrose at 4° C. Section staining and image analysis was performed as described in Pajcini, K. V., et al. (2008) The Journal of cell biology 180(5): 1005-1019.
Timelapse microscopy. Primary myoblasts were seeded for fusion in 6-well collagen coated plates. After 72 hrs in DM, primary myoblasts were treated with TAM. 24 hours later, i.e. at 96 hrs in DM, one set of primary myotubes were treated with 200 nM p16/19si for 12 hrs, at which point transfection mix was washed and cells were placed in fresh DM media. 12 hrs later, primary myotubes were imaged using Zeiss Axiovert 200M equipped with timelapse apparatus CTI-Controller 3700 Digital; Tempcontrol 37-2 digital; scanning stage Incubator XL 100/135 (PECON). Frames were captured every 10 min for a total of 50 hrs, encompassing days 5 and 6 during primary myotube fusion and maturation. Images were acquired and analyzed using Volocity 3.6.1 (Improvision). Growth medium (GM); Differentiation medium (DM).
ResultsSuppression of RB by siRNA induces S-phase re-entry in C2C12 myotubes. The myoblast cell line C2C12 is a model system for studying muscle differentiation in vitro. In low serum differentiation medium (DM), confluent C2C12 myoblasts exit the cell cycle and fuse with one another to form multinucleated muscle cells (myotubes), which express muscle proteins and are contractile. We developed a protocol to transiently express siRNA molecules in more than 60% of myotubes using the silmporter reagent (
To determine if S-phase re-entry in C2C12 myotubes occurred after suppression of RB, we labeled Mocksi and RBsi-treated myotubes with BrdU, as indicated in the scheme in
Both RB and p19ARF must be suppressed for S-phase re-entry in primary myotubes. The majority of the data that suggests that suppressing RB alone is sufficient for cell cycle re-entry in mature mammalian myotubes has been obtained in experiments using the C2C12 cell line. Although useful for studying various aspects of muscle cell differentiation and fusion, C2C12 cells, like other cell lines, have acquired mutations that permit their immortalization. Therefore, we considered it critical to use primary cells to assess the role of RB in maintaining the post-mitotic state. We harvested primary myoblasts capable of differentiation in culture, as previously described (Rando, T. A. and Blau, H. M. (1994) The Journal of Cell Biology 125(6): 1275-1287), from the hind leg muscles of Rosa26-CreERT2 RBlox/lox mice crossed to mice carrying a Cre-responsive β-galactosidase reporter allele. In these mice, Cre expression and RB excision is dependent on tamoxifen (TAM) induction (
We analyzed S-phase re-entry in primary myotube cultures after loss of RB expression by BrdU-labeling according to the scheme in
Disruption of RB function by mutation or by hyperphosphorylation in response to mitogenic signals leads to the accumulation of E2F transcription factor activity, and activation of ARF (DeGregori, J., et al. (1997) Proceedings of the National Academy of Sciences USA 94(14): 7245-7250; Lowe, S. W. and Sherr, C. J. (2003) Current Opinion in Genetics & Development 13(1): 77-83). ARF, in turn, serves to block inappropriate cycling. Induction of ARF was accompanied by a mild increase in baseline levels of apoptosis, but the majority of myotubes remained robust and viable. Apoptosis was rarely observed in siRNA-treated cells in which p16/p19 was reduced (
In contrast, C2C12 myotubes do not express p19ARF in response to RB suppression, as would be expected in a cell line that has bypassed cell cycle regulation by the Ink4a locus during immortalization (
Upregulation of mitotic and cytokinetic components in RB and p16/19-defficient myonuclei. To determine if S-phase re-entry in PM myonuclei marked the initiation of the mitotic process in differentiated multinucleated myotubes, we analyzed control or TAM and p16/19si treated primary myotube nuclei for the induction of expression of mitotic and cytokinetic proteins. We investigated the expression patterns and localization of AuroraB and survivin, two important components of the chromosome passenger complex (CPC), which controls chromosome and spindle structure, kinetochore attachment and chromosome segregation. We also analyzed the mRNA expression of anillin, a structural protein important in the organization and stability of the cleavage furrow during cytokinesis.
Anillin and each of the CPC components mentioned above are actively expressed in primary proliferating mononucleated myoblasts, but their mRNA and protein levels drop precipitously once myotubes form (
Dedifferentiation accompanies S-phase re-entry in primary muscle cells. Differentiated muscle cells exhibit characteristic changes in expression of phenotypic markers such as MHC and creatine kinase (M-CK) that accompany the profound changes observed in their morphology and post-mitotic state; see, for example, Charge, S. B. and Rudnicki, M. A. (2004) Physiological Reviews 84(1): 209-238. We investigated the role of the RB and Ink4a gene products in sustaining expression of the differentiated phenotype by analyzing morphology and expression of markers of differentiation. In primary myoblasts in kept in growth medium or undergoing differentiation (DM), the cellular morphology and expression of MHC were analyzed at various time points, with or without deletion of RB and with or without suppression of p16/19. The data show that over time, cells which are treated with TAM first undergo formation of mature myotubes with strong expression of MHC, followed at later time points by a strong decrease in MHC expression after loss of expression of RB, but only if ARF is also suppressed (
In primary myotubes, protein analysis of cell lysates revealed that some myogenic protein levels are moderately sensitive to the loss of RB alone. A moderate decline in MHC and myogenin levels was observed in primary myotubes following treatment with TAM only (
Morphological deterioration of myotube structure correlated with BrdU+ staining in primary myotubes as in C2C12 myotubes, however, only if both RB and p16/19 were suppressed.
Post-mitotic differentiated myocytes are capable of proliferation after suppression of RB and p16/19. The extent of muscle differentiation can be characterized based on the serial expression of muscle regulatory transcription factors. MyoD and Myf5 are early and characteristic of cycling myoblasts, whereas late transcription factors include myogenin and MRF4 which are expressed in post-mitotic differentiated myocytes and myotubes. Based on this transcription factor timecourse, we sought to develop a system in which we could study cycling and dedifferentiation in prospectively isolated populations derived from individual differentiated muscle cells. We infected low passage Rosa26-CreERT2 RBlox/lox primary myoblasts with a retroviral expression vector in which GFP expression is under the control of the myogenin promoter (pLE-myog3R-GFP). To verify the fidelity of myogenin and GFP co-expression, pLE-myog3R-GFP myoblasts were sparsely seeded in growth medium or differentiation medium for 72 hours and stained for myogenin and GFP. IF analysis clearly showed that GFP and myogenin expression were upregulated in the differentiating (DM3) myocyte population (
Myoblasts seeded at low density will express myogenin and undergo terminal differentiation in the absence of fusion. We took advantage of this in vitro property of muscle cells to investigate whether the dedifferentiation and cell cycle re-entry observed in differentiated multinucleated myotubes could lead to proliferation after suppression of RB and p19ARF in differentiated mononucleated myocytes. The following experiments were performed using individual pLE-myog3R-GFP muscle cells, in order to follow the fate of single cells. First, sparsely seeded primary muscle cells, maintained in DM for 72 hrs, were sorted on the basis of GFP expression as depicted by the gated population in
Since mono-nucleated, differentiated myocytes enter S-phase following silencing of RB and p16/19, we assayed whether these cells were capable of completing the cell-cycle and proliferating. We reasoned that if myocytes could divide, they would give rise to clones. However, to rule out cell migration and definitively show that a postmitotic myocyte divided, single-cell resolution and clonal analysis was critical. Accordingly, to assess the proliferative potential of myocytes, we first FACS-purified cells twice in order to isolate individual differentiated GFP+ myocytes which were then sorted directly into microarrays of hydrogel wells. Myocytes were first imaged 12 hrs after sorting into microwells, at which time they were treated with Mocksi or the first application of DKD treatment (
Clonal expansion and proliferation of individually purified myocytes after laser microdissection and laser pressure catapulting. We sought to increase the purity of all of our prospectively isolated cells by evaluating each individual myocyte for differentiation prior to capture. FACS sorting in combination with the hydrogel microwell platform described above can be readily used to monitor single-cell proliferation potential. However, several disadvantages precluded subsequent analysis: heterogeneity of the sorted population, disruption of cellular morphology upon detachment from the plate, and lack of post-treatment molecular analysis. These obstacles can be overcome by the use of photoactivated laser microdissection (PALM) and laser pressure catapulting (LPC), which enables pure and homogenous individual cell sample preparation without disruption of cell adhesion and morphology, and permits expansion and molecular analysis after colony establishment. See, for example, Stich, M., et al. (2003) Pathology, research and practice 199(6): 405-409; Schutze, K., et al. (2007) Methods in cell biology 82: 649-673).
Laser microdissection and pressure catapulting analysis was performed with myocytes. For this purpose primary myoblasts expressing pLE-myog3R-GFP+ were sparsely seeded and differentiated to become GFP+ myocytes and then treated with either mock siRNA (
In five independent PALM LPC isolation experiments, an analysis of a total of 250 membranes verified that without RB and p16/19 suppression not a single myogenin-GFP+ myocyte captured divided to produce a colony. In contrast, TAM and p16/19si treated myocytes produced 34 colonies, a frequency of 14% colony formation (
Redifferentiation of captured myocyte colonies after exposure to low serum. Dedifferentiated muscle cells in axolotls are thought capable of proliferation and contribution to regenerating muscle. To determine if dedifferentiated, actively dividing mammalian myocytes are capable of redifferentiation after expansion, we exposed captured cells to differentiation conditions. After LPC capture, TAM and p16/19si-treated myocytes proliferated rapidly in culture in GM, and most of the cells lost myogenin expression after 72 hrs, evidenced by lack of GFP (
In contrast to the TAM-treated captured myocytes, RB suppression in DKD captured myocytes was transient (
Protein analysis of the DKD captured colonies supports a function for RB in successful redifferentiation, since DKDcap1 cells have lost RB expression, while the colonies that readily fused and differentiated (DKDcap4 and DKDcap2) expressed high levels of RB in DM (
Based on these observations, we reasoned that if RB was re-introduced into the TAM and p16/19si captured cells, redifferentiation and fusion should occur. Thus, we infected a subset of captured colonies with a pMIG retrovirus vector expressing the human RB cDNA. We monitored the TAMcap myoblast colonies after infection with pMIG-RB or control pMIG retrovirus and determined that differentiation and fusion occurred in those colonies that re-expressed RB (
Captured and expanded myocytes are capable of contribution to muscle in vivo. Finally, we tested whether PALM LPC isolated, expanded myocytes could contribute to existing muscle in vivo. 1.5×105 DKD derived dedifferentiated myocytes (DKDcap1 and DKDcap2) were injected into the tibialis anterior (TA) of NOD/SCID mice. Myogenin-GFP expression was used to track the injected cells, as this marker was reliably detected in vitro upon differentiation (
Visualization of the myofibers in which DKDcap2 cells fused was difficult due to weak GFP expression. While in vitro imaging of GFP+ in redifferentiated myotubes was facilitated by fusion of multiple myogenin-GFP cells, in vivo contribution of a few injected cells to a non-GFP myofiber significantly larger than a culture-derived myotube explains the weak GFP signal observed in vivo. To overcome this problem, we co-infected TAMcap colonies with pMIG-RB and pLE-GFP retrovirus, thus providing these cells with a copy of RB as well as bright constitutive GFP expression. Control TAMcap1 cells, which received control pMIG and pLE-GFP infections, proliferated excessively in vivo (
The molecular basis for the extraordinary disparity between mammals and certain lower vertebrates, such as newts, axolotls and zebrafish, in their capacity to regenerate injured or amputated tissues remains a major unresolved biological question. Mammalian regeneration of a muscle occurs only if that muscle is replaced after mincing or grafting of small muscles, or when chemical agents spare stem cells. Experiments of this type indicate that significant architectural remodeling can occur in lieu of scarring but that the extent of regeneration is limited by the amount of replaced or surviving muscle. Although muscle stem cells can account for some degree of regeneration, they do not seem to suffice. Indeed, to date there is no evidence that the extensive regeneration of entire muscles seen in urodeles can be achieved by any known mammalian mechanism when a significant mass of tissue is removed and not replaced. This limited regenerative potential is in part due to a combination of an excessive demand for cell proliferation at the site of injury in order to replace lost tissue, and an inhibition of architectural remodeling by fibrosis. A possible basis for the failure of regeneration in mammals, which has fascinated scientists for centuries, is a capacity, which newts have retained and mammals have lost: dedifferentiation.
Does dedifferentiation endow urodeles with the regenerative capabilities that mammals lack? This question underscores the need for novel insights into the molecular mechanisms of dedifferentiation in order to discover what is missing in mammals. In urodeles, compelling evidence from studies of skeletal muscle suggests that dedifferentiation is a major mode of tissue regeneration. Dedifferentiation involves two processes, which are separable and independent: muscle cell fragmentation into individual mononuclear cells, and cell cycle re-entry followed by proliferation. In mammalian myotubes produced using the immortalized cell line, C2C12, overexpression of transcriptional factors present in the blastema such as msx1 or twist, or exposure to small molecules that disrupt the cytoskeleton, such as myoseverin, have been reported to result in myotube fragmentation. In the dedifferentiation studies reported here, fragmentation of muscle cells was not observed, which is in good agreement with reports showing that the fragmentation process in newts is independent of cell cycle re-entry (Velloso, C. P., et al. (2000) Differentiation; research in biological diversity 66(4-5): 239-246). In addition, since the trigger and mechanism for muscle fragmentation and cellularization in urodeles remains unknown, it is currently not possible to determine if a similar pathway exists in mammals. Understanding how fragmentation occurs and delineating the dedifferentiation mechanisms are complementary but distinct goals in muscle regeneration biology.
Molecular regulation of dedifferentiation by RB and ARE Our decision to suppress RB in experiments directed at elucidating the mechanisms underlying muscle dedifferentiation was based on evidence in newts that RB coordinates muscle cell cycle entry in response to damage. In mammals as in newts, cell cycle regulation by RB is dynamic and controlled primarily by its phosphoryation state. There is also a wealth of data firmly establishing the tumor suppressor RB as a necessary player in the orchestration of mammalian muscle cell differentiation, including evidence for a dual role in both muscle cell cycle progression and exit. Indeed, RB null mice die before birth and lack differentiated muscles. Furthermore, RB has also been shown to act not only as a cell cycle regulator, but also to impact differentiation and tissue specific gene expression directly by binding histone deacetylase 1 (HDAC1) and promoting activation of muscle genes such as MyoD. Once differentiation occurs, this state is stably maintained, at least in mammals. This stability is underscored by the inability to reverse differentiation simply by inactivating RB in primary differentiated mammalian muscle cells. Indeed, studies reporting otherwise have been confounded by the use of immortalized cell lines such as C2C12, which we show here do not express the ink4a products. Loss or suppression of RB leads only to moderate dedifferentiation, as demonstrated by the reduced accumulation of myogenin and MHC (
The minimal impact of RB absence alone on muscle dedifferentiation suggested that maintenance of mammalian differentiation is ensured by a separate mechanism. Whereas the RB pathway is intact in lower vertebrates, we reasoned that another component that is absent in regeneration competent vertebrates would be a good candidate regeneration suppressor in mammals. This line of thought led us to focus on the ink4a locus and ARF in particular. Unlike RB, inactivation of ARF alone in knockout mice has no apparent effect on differentiation. In agreement with these reports, we found that ARF alone had no effect on muscle differentiation or dedifferentiation. However, concomitant inactivation of RB and ARF caused extensive dedifferentiation. Differentiated myotubes exhibited robust DNA synthesis and activation of mitotic proteins upon acute loss of RB and p19ARF, suggesting that these proteins are nodal points for intrinsic control of muscle cell cycle reentry. The profound loss of architectural integrity and downregulation of myogenin, MRF-4, MHC and M-CK upon suppression of both RB and p19ARF further suggests that the two together are potent stabilizers of the differentiated state. Notably, alternative approaches that induce cycling by altering growth factor signaling and regeneration in mammalian cardiac muscle cells produce a very moderate effect when compared to regenerating urodele muscle. We speculate that ARF may inhibit robust cycling and regeneration in these settings as well.
Our findings support the hypothesis that tumor suppression mediated by the RB and ink4a loci arose at the expense of regeneration. Both p16ink4a and p19ARF have been recently shown to contribute to the decline in regenerative potential of multiple tissues during aging by affecting stem cell self-renewal. Our study suggests that the ink4a locus has an additional negative impact on tissue regeneration, i.e., suppression of cell cycle re-entry and dedifferentiation. The remarkable combined effect of acute RB and ARF loss strongly suggests (i) that continuous expression of RB itself has an important function in maintaining the differentiated state and (ii) that the maintenance of the differentiated state in mammals depends on complementary activities of RB and ARF. These findings are explicable in view of the known need for continuous regulation of differentiation as well as the documented functions of RB and ARF in preventing inappropriate cycling as tumor suppressors.
Single cell analyses of dedifferentiation. Bulk cultures do not allow a definitive assessment that a given cell has divided. The cellular complexity and rapid developmental changes observed in the blastema has hindered analysis of dedifferentiation at the single-cell level in urodele regeneration. In mammalian muscle culture systems in which S-phase re-entry was observed, the persistence of cells at earlier stages of differentiation cannot be ruled out; see, for example, Gu, W., et al. (1993) Cell 72(3): 309-324; Schneider, J. W., et al. (1994) Science (New York, N.Y. 264(5164): 1467-1471;and Blais, A., et al. (2007) The Journal of cell biology 179(7): 1399-1412). In addition, continuous timelapse monitoring and single cell analysis are essential since reports of division of differentiated muscle cells could be the result of cell migration. To overcome these problems we employed (i) dynamic single-cell tracking of myocytes isolated in microwells by time lapse microscopy and (ii) isolation of single myocytes by PALM laser capture microscopy. These single cell studies clearly demonstrated that cell cycle entry and expansion of individual differentiated postmitotic myocytes occurs after RB and p19ARF loss. We further demonstrated the regenerative potential of dedifferentiated myocytes by inducing redifferentiation. A subset of captured colonies produced by transient inactivation of RB and p19ARFwere exposed to differentiation medium in culture and fused to form myotubes. Additionally, in myocytes that had irreversibly lost RB expression due to Cre-mediated excision, reintroduction of RB by retroviral delivery not only induced myotube formation and muscle gene expression in vitro, but also resulted in fusion and regeneration of damaged myofibers in vivo with typical architecture and no evidence of the tumorigenic characteristics of cells that did not receive RB. These findings suggest that transient inactivation of the two tumor suppressors could yield dedifferentiated cells with extensive regenerative potential as depicted in the diagram in
We capitalized on evolutionary differences to genetically modify the mammalian cell-cycle regulatory pathways to more closely mimic those found in lower vertebrates. Our results reveal that it is possible to derive regenerative cells from differentiated, post-mitotic muscle in addition to classically defined stem cells. Skeletal muscle cells can alternate between a differentiated, post-mitotic state and a proliferative, regenerative state, retaining the essential characteristics of their cell type of origin during the regenerative cycle. Our experiments implicate ARF in the suppression of regeneration in mammalian cells by impeding dedifferentiation. Thus, a combination of interventions to transiently inactivate the RB pathway in a physiological manner while suppressing ARF may be employed to maximize a mammalian regenerative response.
The preceding merely illustrates the principles of the invention. It will be appreciated that those skilled in the art will be able to devise various arrangements which, although not explicitly described or shown herein, embody the principles of the invention and are included within its spirit and scope. Furthermore, all examples and conditional language recited herein are principally intended to aid the reader in understanding the principles of the invention and the concepts contributed by the inventors to furthering the art, and are to be construed as being without limitation to such specifically recited examples and conditions. Moreover, all statements herein reciting principles, aspects, and embodiments of the invention as well as specific examples thereof, are intended to encompass both structural and functional equivalents thereof. Additionally, it is intended that such equivalents include both currently known equivalents and equivalents developed in the future, i.e., any elements developed that perform the same function, regardless of structure. The scope of the present invention, therefore, is not intended to be limited to the exemplary embodiments shown and described herein. Rather, the scope and spirit of the present invention is embodied by the appended claims.
Claims
1-35. (canceled)
36. A kit for use in transiently inducing post-mitotic differentiated cells to transiently divide, comprising an agent that transiently inhibits the activity of a pocket protein and an agent that transiently inhibits the activity of ARF.
Type: Application
Filed: Jun 8, 2012
Publication Date: Nov 22, 2012
Inventors: Helen M. Blau (Menlo Park, CA), Kostandin Pajcini (Philadelphia, PA), Jason Pomerantz (Mill Valley, CA)
Application Number: 13/492,679
International Classification: A61K 38/17 (20060101); A61P 17/00 (20060101); A61K 31/713 (20060101);
