COMPOUNDS AND METHODS FOR MODULATING ANGIOTENSINOGEN EXPRESSION

Disclosed herein are compositions and compounds comprising modified oligonucleotides for modulating AGT and modulating a RAAS pathway related disease, disorder and/or condition in an individual in need thereof. A RAAS pathway related disease, disorder and/or condition in an individual such as hypertension can be treated, ameliorated, delayed or prevented with the administration of antisense compounds targeted to AGT.

Skip to: Description  ·  Claims  · Patent History  ·  Patent History
Description
SEQUENCE LISTING

The present application is being filed along with a Sequence Listing in electronic format. The Sequence Listing is provided as a file entitled BIOL0270USC1SEQ_ST25.txt created Nov. 12, 2020, which is 456 kb in size. The information in the electronic format of the sequence listing is incorporated herein by reference in its entirety.

FIELD OF THE INVENTION

The present invention provides compounds, compositions and methods for modulating angiotensinogen (AGT) expression for the purpose of modulating a RAAS pathway related disease, disorder or condition in an animal. The present invention also provides compounds, compositions and methods for reducing hypertension and organ damage by administering an AGT inhibitor to an animal

BACKGROUND OF THE INVENTION

Angiotensinogen (AGT), also known as SERPINA8 or ANHU, is a member of the serpin family and is a component of the renin-angiotensin-aldosterone system (RAAS). It is primarily produced in the liver and is released into the circulation where renin converts it into angiotensin I. Angiotensin I is subsequently converted into angiotensin II by angiotension converting enzyme (ACE). Angiotensin II is a peptide hormone which causes vasoconstriction which, in turn, can increase blood pressure. Angiotensin II also stimulates secretion of the hormone aldosterone from the adrenal cortex. Aldosterone causes the kidneys to increase reabsorption of sodium and water leading to an increase of the fluid volume in a body which, in turn, can increase blood pressure. Over stimulation or activity of the RAAS pathway can lead to high blood pressure. Chronic high blood pressure is known as hypertension. The high blood pressure in a hypertensive subject requires the heart to work harder to circulate blood through the blood vessels.

The World Health Organization (WHO) has identified hypertension as a leading cause of cardiovascular morbidity. Hypertension is a major risk factor for various disease, disorders and conditions such as shortened life expectancy, chronic kidney disease, stroke, myocardial infarction, heart failure, aneurysms of the blood vessels (e.g. aortic aneurysm), peripheral artery disease, heart damage (e.g., heart enlargement or hypertrophy) and other cardiovascular related diseases, disorders and/or conditions.

The prevalence of resistant hypertension (RHTN), hypertension resistant to drug treatment, has steadily increased in number likely due to an ageing population and an ever increasing incidence of obesity. The current projection of approximately 10 million RHTN adults in the United States is expected to continue to rise.

Anti-hypertensive drugs, renal denervation, baroreceptor activation therapy, diet changes and lifestyle changes may reduce hypertension and reduce the diseases, disorders and/or conditions associated with hypertension (Paulis et al., Nat Rev Cardiol, 2012, 9:276-285). However, there are limitations to the therapies currently approved for treating hypertension as a significant subset of all hypertensive patients do not achieve adequate blood pressure control. For example, drugs such as ACE inhibitors and angiotensin receptor blockers (ARBs) that target parts of the renin-angiotensin system (RAS) pathway are limited in their ability to inhibit the RAAS pathway (Nobakht et al., Nat Rev Nephrol, 2011, 7:356-359). Additionally, certain anti-hypertensive drugs such as ACE inhibitors are contra-indicated in hypertensive patients with renal disease due to their potential to compromise renal function in patients.

Accordingly, there is a need to find alternative treatments to inhibit the RAAS pathway and treat hypertension. Antisense technology is emerging as an effective means for reducing the expression of certain gene products. However, early antisense oligonucleotides targeting AGT provided limited benefit (WO 1997/33623) or targeted non-human AGT (WO 2014/018930). The compounds and compositions herein provide novel, highly potent and tolerable compounds to inhibit human AGT and are suitable for use in human subjects. Additionally, compounds disclosed herein, by using a conjugate strategy that delivers antisense compounds to the liver and limits their renal distribution and activity, are predicted to mitigate the tolerability issues of traditional RAS blockers in patients at risk for hyperkalemia and/or renal disease.

All documents, or portions of documents, cited in this application, including, but not limited to, patents, patent applications, articles, books, and treatises, are hereby expressly incorporated-by-reference for the portions of the document discussed herein, as well as in their entirety.

SUMMARY OF THE INVENTION

Provided herein are compositions, compounds and methods for lowering the levels of AGT mRNA and/or protein in an animal.

Certain embodiments disclosed herein provide a compound comprising a modified oligonucleotide targeting a nucleic acid sequence encoding AGT. In certain embodiments, the compound targets an AGT sequence as shown in the nucleobase sequences of any of SEQ ID NOs: 1-6.

Certain embodiments disclosed herein provide a compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides having a nucleobase sequence comprising a portion of at least 8 contiguous nucleobases complementary to an equal length portion of nucleobases 2250 to 2337 of SEQ ID NO: 1, wherein the nucleobase sequence of the modified oligonucleotide is at least 80% complementary to SEQ ID NO: 1.

Certain embodiments disclosed herein provide a compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides having a nucleobase sequence comprising a portion of at least 8 contiguous nucleobases complementary to an equal length portion of nucleobases 2281 to 2300 of SEQ ID NO: 1, wherein the nucleobase sequence of the modified oligonucleotide is at least 80% complementary to SEQ ID NO: 1.

Certain embodiments disclosed herein provide a compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 46, 53-54, 61, 68, 76, 83, 85, 93, 96-97, 109, 127, 129-130, 132, 134-15, 137-39, 142, 163-172, 180-184, 186, 189, 234, 236, 238-239, 267, 313, 411, 452, 463-470, 475-478, 480, 500-503, 512, 517-518, 524-526, 654, 689, 702, 725-726, 728, 738, 779, 786-787, 800, 808, 810-811, 825, 865, 868, 889, 894, 903, 905, 909, 954, 966, 1011, 1015, 1021, 1024, 1080, 1085, 1258-1259, 1261-1262, 1293-1294, 1299, 1325, 1470, 1472-1473, 1522, 1542, 1604, 1623-1624, 1667, 1670, 1682-1683, 1687, 1700, 1703-1704, 1708, 1714, 1716, 1719-1720, 1724-1726, 1729-1730, 1827, 1936, 1843-1844, 1846, 1886, 1893-1894, 1914, 1923, 1925, 1932, 1979, 1986, 1988, 1990, 2003, 2015, 2018, 2020, 2027-2028, 2035, 2037, 2039, 2044.

Certain embodiments disclosed herein provide a compound comprising a modified oligonucleotide according to the following formula: mCes Aes mCes Aes Aes Ads mCds Ads Ads Gds mCds Tds Gds Gds Tds mCes Ges Ges Tes Te (SEQ ID NO: 1914); wherein, A is an adenine, mC is a 5′-methylcytosine, G is a guanine, T is a thymine, e is a 2′-O-methoxyethyl modified nucleoside, d is a 2′-deoxynucleoside, and s is a phosphorothioate internucleoside linkage. In certain embodiments, the modified oligonucleotide further comprises a GalNAc conjugate. In certain embodiments, the conjugate is a 5′-Trishexylamino-(THA)-C6 GalNAc3 conjugate. In certain embodiments, the modified oligonucleotide is linked to the 5′-Trishexylamino-(THA)-C6 GalNAc3 conjugate by a cleavable moiety. In certain embodiments, the cleavable moiety is a phosphate group.

Certain embodiments disclosed herein provide a compound comprising a modified oligonucleotide with the following formula:

DETAILED DESCRIPTION OF THE INVENTION

It is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory only and are not restrictive of the invention, as claimed. Herein, the use of the singular includes the plural unless specifically stated otherwise. As used herein, the use of “or” means “and/or” unless stated otherwise. Furthermore, the use of the term “including” as well as other forms, such as “includes” and “included”, is not limiting. Also, terms such as “element” or “component” encompass both elements and components comprising one unit and elements and components that comprise more than one subunit, unless specifically stated otherwise.

The section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described. All documents, or portions of documents, cited in this application, including, but not limited to, patents, patent applications, articles, books, and treatises, are hereby expressly incorporated by reference for the portions of the document discussed herein, as well as in their entirety.

Definitions

Unless specific definitions are provided, the nomenclature utilized in connection with, and the procedures and techniques of, analytical chemistry, synthetic organic chemistry, and medicinal and pharmaceutical chemistry described herein are those well known and commonly used in the art. Standard techniques may be used for chemical synthesis, and chemical analysis. Where permitted, all patents, applications, published applications and other publications, GENBANK Accession Numbers and associated sequence information obtainable through databases such as National Center for Biotechnology Information (NCBI) and other data referred to throughout the disclosure herein are incorporated by reference for the portions of the document discussed herein, as well as in their entirety.

Unless otherwise indicated, the following terms have the following meanings:

“2′-O-methoxyethyl” (also 2′-MOE and 2′-O(CH2)2—OCH3) refers to an O-methoxy-ethyl modification of the 2′ position of a furosyl ring. A 2′-O-methoxyethyl modified sugar is a modified sugar.

“2′-O-methoxyethyl nucleotide” means a nucleotide comprising a 2′-O-methoxyethyl modified sugar moiety.

“5-methylcytosine” means a cytosine modified with a methyl group attached to the 5′ position. A 5-methylcytosine is a modified nucleobase.

“About” means within ±10% of a value. For example, if it is stated, “a marker may be increased by about 50%”, it is implied that the marker may be increased between 45%-55%.

“ACE escape”, also known as angiotensin II reactivation, refers to the inability of currently available ACE inhibitor treatment to reliably suppress plasma angiotensin II levels. The increase in plasma angiotensin II levels during ACE inhibition occurs via other enzymes converting angiotensin Ito angiotensin. This incomplete blockage of angiotensin II levels prevents the ACE inhibitors from effectively treating some hypertensive subjects. Angiotensin Receptor Blockers (ARBs) may also be susceptible to ACE escape as other receptors besides the AT1 receptor engage angiotensin metabolites.

“Active pharmaceutical agent” or “Pharmaceutical agent” means the substance or substances in a pharmaceutical composition that provide a therapeutic benefit when administered to an individual. For example, in certain embodiments, an antisense oligonucleotide targeted to AGT is an active pharmaceutical agent.

“Active target region” or “target region” means a region to which one or more active antisense compounds is targeted.

“Active antisense compounds” means antisense compounds that reduce target nucleic acid levels or protein levels.

“Administered concomitantly” refers to the co-administration of two agents in any manner in which the pharmacological effects of both are manifest in the patient time. Concomitant administration does not require that both agents be administered in a single pharmaceutical composition, in the same dosage form, or by the same route of administration. The effects of both agents need not manifest themselves at the same time. The effects need only be overlapping for a period of time and need not be coextensive.

“Administering” means providing a pharmaceutical agent to an individual, and includes, but is not limited to administering by a medical professional and self-administering.

“Aldosterone escape” or “aldosterone breakthrough” refers to the inability of currently available ACE inhibitor Angiotensin Receptor Blocker (ARB) and/or Direct Renin Inhibitor (DRI) treatment to reliably suppress aldosterone release in some treated subjects. This incomplete blockage of aldosterone prevents the ACE inhibitors, DRIs and ARBs from effectively treating some hypertensive subjects.

“Agent” means an active substance that can provide a therapeutic benefit when administered to an animal. “First Agent” means a therapeutic compound provided herein. For example, a first agent is an antisense oligonucleotide targeting AGT. “Second agent” means a second therapeutic compound described herein. For example, a second agent can be a second antisense oligonucleotide targeting AGT or a non-AGT target. Alternatively, a second agent can be a compound other than an antisense oligonucleotide.

“Amelioration” or “ameliorate” refers to a lessening of at least one indicator, marker, sign, or symptom of an associated disease, disorder and/or condition. In certain embodiments, amelioration includes a delay or slowing in the progression of one or more indicators of a condition, disorder and/or disease. The severity of indicators may be determined by subjective or objective measures, which are known to those skilled in the art.

“Angiotensinogen” and “AGT” is used interchangeably herein. Angiotensinogen is also known as SERPINA8 and ANHU.

“Angiotensinogen nucleic acid” or “AGT nucleic acid” means any nucleic acid encoding AGT. For example, in certain embodiments, an AGT nucleic acid includes a DNA sequence encoding AGT, an RNA sequence transcribed from DNA encoding AGT (including genomic DNA comprising introns and exons), and an mRNA sequence encoding AGT. “AGT mRNA” means an mRNA encoding an AGT protein.

“AGT specific inhibitor” refers to any agent capable of specifically inhibiting the expression of AGT mRNA and/or AGT protein. For example, AGT specific inhibitors include nucleic acids (including antisense compounds such as RNasH, siRNA and blockmer antisense compounds), peptides, antibodies, small molecules, and other agents capable of specifically inhibiting the expression of AGT mRNA and/or AGT protein. In certain embodiments, by specifically modulating AGT mRNA level and/or AGT protein expression, AGT specific inhibitors can affect components of the renin-angiotensin-aldosterone system (RAAS) pathway. In certain embodiments, by specifically modulating AGT mRNA level and/or AGT protein expression, AGT specific inhibitors can affect RAAS pathway related diseases, disorders and/or conditions such as blood pressure. Similarly, in certain embodiments, AGT specific inhibitors can affect other molecular processes in an animal.

“Animal” refers to a human or non-human animal, including, but not limited to, mice, rats, rabbits, dogs, cats, pigs, and non-human primates, including, but not limited to, monkeys and chimpanzees.

“Anti-hypertensive drug” refers to a drug capable of lowering blood pressure. Examples of such drugs include, but are not limited to, RAAS inhibitors, diuretics, calcium channel blockers, adrenergic receptor antagonists, adrenergic agonists and vasodilators. In one example, the anti-hypertensive drug captopril can be used in combination with the AGT compound described herein to treat an animal having or at risk of having a RAAS pathway related disease, disorder and/or condition.

“Anti-hypertensive procedure” refers to a medical procedure performed on a subject to reduce hypertension. Examples of such procedures include renal denervation and baroreceptor activation therapy.

“Antibody” refers to a molecule characterized by reacting specifically with an antigen in some way, where the antibody and the antigen are each defined in terms of the other. Antibody may refer to a complete antibody molecule or any fragment or region thereof, such as the heavy chain, the light chain, Fab region, and

Fc region.

“Antisense activity” means any detectable or measurable activity attributable to the hybridization of an antisense compound to its target nucleic acid. In certain embodiments, antisense activity is a decrease in the amount or expression of a target nucleic acid or protein encoded by such target nucleic acid.

“Antisense compound” means an oligomeric compound that is capable of undergoing hybridization to a target nucleic acid through hydrogen bonding.

“Antisense inhibition” means reduction of target nucleic acid levels or target protein levels in the presence of an antisense compound complementary to a target nucleic acid compared to target nucleic acid levels or target protein levels in the absence of the antisense compound.

“Antisense oligonucleotide” means a single-stranded oligonucleotide having a nucleobase sequence that permits hybridization to a corresponding region or segment of a target nucleic acid.

“Bicyclic sugar” means a furosyl ring modified by the bridging of two non-geminal ring atoms. A bicyclic sugar is a modified sugar.

“Bicyclic nucleic acid” or “BNA” refers to a nucleoside or nucleotide wherein the furanose portion of the nucleoside or nucleotide includes a bridge connecting two carbon atoms on the furanose ring, thereby forming a bicyclic ring system.

“Blood pressure” refers to the pressure of the blood in the circulatory system against the walls of the blood vessel. The blood pressure is due mainly to the beating of the heart in an animal. During each heartbeat, the blood pressure varies between a maximum (systolic) blood pressure (SBP) and minimum (diastolic) blood pressure (DBP). The mean arterial pressure (MAP) is the average arterial pressure during a heartbeat cycle. Blood pressure can be measure by a blood pressure meter (i.e., a sphygmomanometer). Normal blood pressure at rest is within the range of 100-140 mmHg systolic and 60-90 mmHg diastolic and is commonly expressed as the systolic pressure (top reading)/diastolic pressure (bottom reading) mmHg.

“Cap structure” or “terminal cap moiety” means chemical modifications, which have been incorporated at either terminus of an antisense compound.

“cEt” or “constrained ethyl” means a bicyclic sugar moiety comprising a bridge connecting the 4′-carbon and the 2′-carbon, wherein the bridge has the formula: 4′-CH(CH3)—O-2′.

“Constrained ethyl nucleoside” (also cEt nucleoside) means a nucleoside comprising a bicyclic sugar moiety comprising a 4′-CH(CH3)—O-2′ bridge.

“Chemically distinct region” refers to a region of an antisense compound that is in some way chemically different than another region of the same antisense compound. For example, a region having 2′-O-methoxyethyl nucleotides is chemically distinct from a region having nucleotides without 2′-O-methoxyethyl modifications.

“Chimeric antisense compound” means an antisense compound that has at least two chemically distinct regions.

“Co-administration” means administration of two or more pharmaceutical agents to an individual. The two or more pharmaceutical agents may be in a single pharmaceutical composition, or may be in separate pharmaceutical compositions. Each of the two or more pharmaceutical agents may be administered through the same or different routes of administration. Co-administration encompasses concomitant, parallel or sequential administration.

“Complementarity” means the capacity for pairing between nucleobases of a first nucleic acid and a second nucleic acid. In certain embodiments, the first nucleic acid is an antisense compound and the second nucleic acid is a target nucleic acid.

“Contiguous nucleobases” means nucleobases immediately adjacent to each other.

“Deoxyribonucleotide” means a nucleotide having a hydrogen at the 2′ position of the sugar portion of the nucleotide. Deoxyribonucleotides may be modified with any of a variety of substituents.

“Diluent” means an ingredient in a composition that lacks pharmacological activity, but is pharmaceutically necessary or desirable. For example, the diluent in an injected composition may be a liquid, e.g. phosphate buffered saline (PBS) or water.

“Dosage unit” means a form in which a pharmaceutical agent is provided, e.g. pill, tablet, or other dosage unit known in the art. In certain embodiments, a dosage unit is a vial containing lyophilized antisense oligonucleotide. In certain embodiments, a dosage unit is a vial containing reconstituted antisense oligonucleotide.

“Dose” means a specified quantity of a pharmaceutical agent provided in a single administration, or in a specified time period. In certain embodiments, a dose may be administered in one, two, or more boluses, tablets, or injections. For example, in certain embodiments where subcutaneous administration is desired, the desired dose requires a volume not easily accommodated by a single injection, therefore, two or more injections may be used to achieve the desired dose. In certain embodiments, the pharmaceutical agent is administered by infusion over an extended period of time or continuously. Doses may be stated as the amount of pharmaceutical agent per hour, day, week, or month.

“Effective amount” or “therapeutically effective amount” means the amount of active pharmaceutical agent sufficient to effectuate a desired physiological outcome in an individual in need of the agent. The effective amount can vary among individuals depending on the health and physical condition of the individual to be treated, the taxonomic group of the individuals to be treated, the formulation of the composition, assessment of the individual's medical condition, and other relevant factors. In an example, an effective amount of an AGT antisense oligonucleotide decreases blood pressure and/or ameliorates organ damage due to hypertension.

“Fully complementary” or “100% complementary” means that each nucleobase of a nucleobase sequence of a first nucleic acid has a complementary nucleobase in a second nucleobase sequence of a second nucleic acid. In certain embodiments, the first nucleic acid is an antisense compound and the second nucleic acid is a target nucleic acid.

“Gapmer” means a chimeric antisense compound in which an internal region having a plurality of nucleosides that support RNase H cleavage is positioned between external regions having one or more nucleosides, wherein the nucleosides comprising the internal region are chemically distinct from the nucleoside or nucleosides comprising the external regions. The internal region may be referred to as a “gap segment” and the external regions may be referred to as “wing segments.”

“Gap-widened” means a chimeric antisense compound having a gap segment of 12 or more contiguous 2′-deoxynucleosides positioned between and immediately adjacent to 5′ and 3′ wing segments having from one to six nucleosides.

“Hybridization” means the annealing of complementary nucleic acid molecules. In certain embodiments, complementary nucleic acid molecules include an antisense compound and a target nucleic acid.

“Hypertension” or “HTN” refers to a chronic medical condition where the blood pressure in an animal is elevated. The elevated blood pressure requires the heart to work harder to circulate blood through the blood vessels. High blood pressure is said to be present if it is persistently at or above 140/90 mmHg. Hypertension is classified as primary (essential) or secondary. Primary hypertension has no clear cause and is thought to be linked to genetics, diet, lack of exercise and obesity. Secondary hypertension is caused by another medical condition. Hypertension is a major risk factor for shortened life expectancy, chronic kidney disease, stroke, myocardial infarction, heart failure, aneurysms of the blood vessels (e.g. aortic aneurysm), peripheral artery disease, organ damage (e.g., heart enlargement or hypertrophy) and other cardiovascular diseases, disorders and/or conditions or symptoms thereof. Anti-hypertensive drugs, diet changes and lifestyle changes may reduce hypertension and reduce the diseases, disorders and/or conditions associated with hypertension. Hypertension can be nonresistant to drug intervention (i.e., controllable by commercially available drug therapies) or resistant to drug intervention.

“Identifying an animal having, or at risk for, a RAAS related disease, disorder and/or condition” means identifying an animal having been diagnosed with a RAAS related disease, disorder and/or condition or identifying an animal predisposed to develop a RAAS related disease, disorder and/or condition.

Individuals predisposed to develop a RAAS related disease, disorder and/or condition include, for example, individuals with a familial history a RAAS related disease such as hypertension. Such identification may be accomplished by any method including evaluating an individual's medical history and standard clinical tests or assessments.

“Immediately adjacent” means that there are no intervening elements between the immediately adjacent elements.

“Individual” or “subject” or “animal” means a human or non-human animal selected for treatment or therapy.

“Inhibiting the expression or activity” refers to a reduction or blockade of the expression or activity of a RNA or protein and does not necessarily indicate a total elimination of expression or activity.

“Internucleoside linkage” refers to the chemical bond between nucleosides.

“Intravenous administration” means administration into a vein.

“Linked nucleosides” means adjacent nucleosides which are bonded together.

“Marker” or “biomarker” is any measurable and quantifiable biological parameter that serves as an index for health- or physiology-related assessments. For example, an increase in blood pressure, or a decrease in organ damage (e.g., fibrosis) can be considered markers of an RAAS related disease, disorder and/or condition.

“Mismatch” or “non-complementary nucleobase” or “MM” refers to the case when a nucleobase of a first nucleic acid is not capable of pairing with the corresponding nucleobase of a second or target nucleic acid.

“Modified internucleoside linkage” refers to a substitution or any change from a naturally occurring internucleoside bond (i.e. a phosphodiester internucleoside bond).

“Modified nucleobase” refers to any nucleobase other than adenine, cytosine, guanine, thymidine, or uracil. For example, a modified nucleobase can be 5′-methylcytosine. An “unmodified nucleobase” means the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C), and uracil (U).

“Modified nucleoside” means a nucleoside having, independently, a modified sugar moiety and/or modified nucleobase.

“Modified nucleotide” means a nucleotide having, independently, a modified sugar moiety, modified internucleoside linkage, and/or modified nucleobase.

“Modified oligonucleotide” means an oligonucleotide comprising a modified internucleoside linkage, a modified sugar, and/or a modified nucleobase.

“Modified sugar” refers to a substitution or change from a natural sugar. For example, a modified sugar can be 2′-MOE.

“Modulating” refers to changing or adjusting a feature in a cell, tissue, organ or organism. For example, modulating AGT mRNA can mean to increase or decrease the level of AGT mRNA and/or AGT protein in a cell, tissue, organ or organism. Modulating AGT mRNA and/or protein can lead to an increase or decrease in a RAAS related disease, disorder and/or condition in a cell, tissue, organ or organism. A “modulator” effects the change in the cell, tissue, organ or organism. For example, an AGT antisense compound can be a modulator that increases or decreases the amount of AGT mRNA and/or AGT protein in a cell, tissue, organ or organism.

“Monomer” refers to a single unit of an oligomer. Monomers include, but are not limited to, nucleosides and nucleotides, whether naturally occurring or modified.

“Motif” means the pattern of chemically distinct regions in an antisense compound.

“Naturally occurring internucleoside linkage” means a 3′ to 5′ phosphodiester linkage.

“Natural sugar moiety” means a sugar found in DNA (2′-H) or RNA (2′-OH).

“Nonresistant hypertension”, “no refractory hypertension” or “controlled hypertension” is defined as hypertension that responds to treatment resulting in, for example, blood pressure <140 mmHg SBP or <90 mmHg DBP with concurrent use of up to 3 anti-hypertensive agents.

“Nucleic acid” refers to molecules composed of monomeric nucleotides. A nucleic acid includes ribonucleic acids (RNA), deoxyribonucleic acids (DNA), single-stranded nucleic acids, double-stranded nucleic acids, small interfering ribonucleic acids (siRNA), and microRNAs (miRNA).

“Nucleobase” means a heterocyclic moiety capable of pairing with a base of another nucleic acid.

“Nucleobase sequence” means the order of contiguous nucleobases independent of any sugar, linkage, or nucleobase modification.

“Nucleoside” means a nucleobase linked to a sugar.

“Nucleoside mimetic” includes those structures used to replace the sugar or the sugar and the base and not necessarily the linkage at one or more positions of an oligomeric compound; such as, for example, nucleoside mimetics having morpholino, cyclohexenyl, cyclohexyl, tetrahydropyranyl, bicyclo or tricyclo sugar mimetics e.g. non furanose sugar units.

“Nucleotide” means a nucleoside having a phosphate group covalently linked to the sugar portion of the nucleoside.

“Nucleotide mimetic” includes those structures used to replace the nucleoside and the linkage at one or more positions of an oligomeric compound; such as, for example, peptide nucleic acids or morpholinos (morpholinos linked by —N(H)—C(═O)—O— or other non-phosphodiester linkage).

“Organ damage” or “end organ damage” refers to damage occurring in major organs fed by the circulatory system such as the heart (e.g., heart muscle hypertrophy, reduced heart function and/or heart failure), kidney (e.g., albuminurea, proteinurea, reduced renal function and/or renal failure), eyes (e.g., hypertensive retinopathy), brain (e.g., stroke) and the like. The organs can be damaged by hypertension in an animal. In certain embodiments, the heart damage is fibrosis, heart cell and/or muscle hypertrophy leading to heart enlargement.

“Oligomeric compound” or “oligomer” refers to a polymeric structure comprising two or more sub-structures (monomers) and capable of hybridizing to a region of a nucleic acid molecule. In certain embodiments, oligomeric compounds are oligonucleosides. In certain embodiments, oligomeric compounds are oligonucleotides. In certain embodiments, oligomeric compounds are antisense compounds. In certain embodiments, oligomeric compounds are antisense oligonucleotides. In certain embodiments, oligomeric compounds are chimeric oligonucleotides.

“Oligonucleotide” means a polymer of linked nucleosides each of which can be modified or unmodified, independent one from another.

“Parenteral administration” means administration through injection or infusion. Parenteral administration includes subcutaneous administration, intravenous administration, intramuscular administration, intra-arterial administration, intraperitoneal administration, or intracranial administration, e.g., intrathecal or intracerebroventricular administration. Administration can be continuous, or chronic, or short or intermittent.

“Peptide” refers to a molecule formed by linking at least two amino acids by amide bonds. Peptide refers to polypeptides and proteins.

“Pharmaceutical composition” means a mixture of substances suitable for administering to an individual. For example, a pharmaceutical composition may comprise one or more active pharmaceutical agents and a sterile aqueous solution.

“Pharmaceutically acceptable carrier” means a medium or diluent that does not interfere with the structure of the oligonucleotide. Certain of such carriers enable pharmaceutical compositions to be formulated as, for example, tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspension and lozenges for the oral ingestion by a subject. For example, a pharmaceutically acceptable carrier can be a sterile aqueous solution, such as sterile water or PBS.

“Pharmaceutically acceptable derivative” encompasses pharmaceutically acceptable salts, conjugates, prodrugs or isomers of the compounds described herein.

“Pharmaceutically acceptable salts” means physiologically and pharmaceutically acceptable salts of antisense compounds, i.e., salts that retain the desired biological activity of the parent oligonucleotide and do not impart undesired toxicological effects thereto.

“Phosphorothioate linkage” means a linkage between nucleosides where the phosphodiester bond is modified by replacing one of the non-bridging oxygen atoms with a sulfur atom. A phosphorothioate linkage is a modified internucleoside linkage.

“Portion” means a defined number of contiguous (i.e. linked) nucleobases of a nucleic acid. In certain embodiments, a portion is a defined number of contiguous nucleobases of a target nucleic acid. In certain embodiments, a portion is a defined number of contiguous nucleobases of an antisense compound.

“Prevent” refers to delaying or forestalling the onset, development, or progression of a disease, disorder, or condition for a period of time from minutes to indefinitely. Prevent also means reducing risk of developing a disease, disorder, or condition.

“Prodrug” means a therapeutic agent that is prepared in an inactive form that is converted to an active form within the body or cells thereof by the action of endogenous enzymes or other chemicals or conditions.

“Renin-angiotensin-aldosterone system”, “Renin-angiotensin-aldosterone system pathway”, “RAAS pathway” or “RAAS” refer to a multi-component enzymatic pathway where a precursor component (angiotensinogen) is converted by various enzymes such as renin and enzyme angiotensin-converting-enzyme (ACE) into downstream components such as angiotensin I and angiotensin II. Angiotensin I stimulates secretion of the steroid aldosterone in the pathway. The RAAS pathway regulates blood pressure and fluid balance in a body.

“Renin-angiotensin System”, or “RAS” or “RAS pathway” refer to a portion of the RAAS pathway. Various components of this pathway have been targeted by agonists or antagonists to block the production of the components. For example renin inhibitors, ACE inhibitors, angiotensin-receptor blockers (ARBs) and the like have been developed to inhibit or block the RAS pathway. However, commercially available therapies targeting various RAS pathway components have been ineffective in completely inhibiting or blocking the RAS pathway due to various mechanisms (Nobakht et al., Nat Rev Nephrol, 2011, 7:356-359).

“RAAS related disease, disorder and/or condition” or “RAAS pathway related disease, disorder and/or condition” refers to any disease, disorder or condition related to RAAS in an animal. Examples of RAAS related diseases, disorders and/or conditions include shortened life expectancy, hypertension (e.g. nonresistant hypertension, resistant hypertension), kidney disease (e.g., chronic kidney disease, polycystic kidney disease), stroke, heart disease (e.g., myocardial infarction, heart failure, valvular heart disease), aneurysms of the blood vessels (e.g. aortic aneurysm), peripheral artery disease, organ damage (e.g., heart damage or hypertrophy), tissue fibrosis and other cardiovascular diseases, disorders and/or conditions or symptoms thereof. In certain embodiments, RAAS related disease, disorder and/or condition does not include hypertension.

“Resistant hypertension” or “RHTN” is defined as (1) blood pressure ≥140 mmHg SBP or ≥90 mmHg DBP despite concurrent use of 3 anti-hypertensive agents from different drug classes or (2) use of ≥4 anti-hypertensive drugs regardless of blood pressure.

“Side effects” means physiological disease and/or conditions attributable to a treatment other than the desired effects. In certain embodiments, side effects include injection site reactions, liver function test abnormalities, renal function abnormalities, liver toxicity, renal toxicity, central nervous system abnormalities, myopathies, and malaise. For example, increased aminotransferase levels in serum may indicate liver toxicity or liver function abnormality. For example, increased bilirubin may indicate liver toxicity or liver function abnormality.

“Single-stranded oligonucleotide” means an oligonucleotide which is not hybridized to a complementary strand.

“Specifically hybridizable” refers to an antisense compound having a sufficient degree of complementarity between an antisense oligonucleotide and a target nucleic acid to induce a desired effect, while exhibiting minimal or no effects on non-target nucleic acids under conditions in which specific binding is desired, e.g., under physiological conditions in the case of in vivo assays and therapeutic treatments. In an example, an antisense compound is specifically hybridizable to a target when binding of the compound to the target nucleic acid interferes with the normal function of the target nucleic acid to cause a loss of activity, and there is a sufficient degree of complementarity to avoid non-specific binding of the antisense compound to non-target nucleic acid sequences under conditions in which specific binding is desired.

“Subcutaneous administration” means administration just below the skin.

“Targeting” or “targeted” means the process of design and selection of an antisense compound that will specifically hybridize to a target nucleic acid and induce a desired effect.

“Target nucleic acid,” “target RNA,” and “target RNA transcript” all refer to a nucleic acid capable of being targeted by antisense compounds.

“Target segment” means the sequence of nucleotides of a target nucleic acid to which an antisense compound is targeted. “5′ target site” refers to the 5′-most nucleotide of a target segment. “3′ target site” refers to the 3′-most nucleotide of a target segment.

“Therapeutically effective amount” means an amount of a pharmaceutical agent that provides a therapeutic benefit to an animal.

“Treat” refers to administering a pharmaceutical composition to an animal in order to effect an alteration or improvement of a disease, disorder, or condition in the animal. In certain embodiments, one or more pharmaceutical compositions can be administered to the animal.

“Unmodified nucleotide” means a nucleotide composed of naturally occurring nucleobases, sugar moieties, and internucleoside linkages. In certain embodiments, an unmodified nucleotide is an RNA nucleotide (i.e. β-D-ribonucleotide) or a DNA nucleotide (i.e. β-D-deoxyribonucleotide).

Certain Embodiments

Certain embodiments provide compounds specifically modulating AGT. In certain embodiments, the AGT specific modulators are AGT specific inhibitors, for use in treating, preventing, or ameliorating a RAAS related disease, disorder and/or condition. In certain embodiments, AGT specific inhibitors are nucleic acid compounds capable of inhibiting the expression of AGT mRNA and/or AGT protein. In certain embodiments, the nucleic acid compounds are oligomeric compounds. In certain embodiments, the oligomeric compounds are antisense oligonucleotides. In certain embodiments, the antisense oligonucleotides are modified antisense oligonucleotides. In certain embodiments, the modified antisense oligonucleotides are chimeric antisense oligonucleotides.

In certain embodiments, the compounds target an AGT nucleic acid. In certain embodiments, the AGT nucleic acid is any of the human sequences set forth in GENBANK Accession No. NM_000029.3 (incorporated herein as SEQ ID NO: 1), the complement of the nucleotides 24354000 to 24370100 of GENBANK Accession No. NT 167186.1 (incorporated herein as SEQ ID NO: 2), GENBANK Accession No. AK307978.1 (incorporated herein as SEQ ID NO: 3), GENBANK Accession No. AK303755.1 (incorporated herein as SEQ ID NO: 4), GENBANK Accession No. AK293507.1 (incorporated herein as SEQ ID NO: 5), and GENBANK Accession No. CR606672.1 (incorporated herein as SEQ ID NO: 6).

Certain embodiments disclosed herein provide a compound comprising a modified oligonucleotide targeting a nucleic acid sequence encoding AGT. In certain embodiments, the compound targets an AGT sequence as shown in the nucleobase sequences of any of SEQ ID NOs: 1-6.

Certain embodiments disclosed herein provide a compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides having a nucleobase sequence comprising at least 8, least 9, least 10, least 11, at least 12, least 13, at least 14, at least 15, at least 16, least 17, least 18, least 19, or 20 contiguous nucleobases complementary to an equal length portion of SEQ ID NOs: 1-6.

In certain embodiments, the nucleobase sequence of the modified oligonucleotide is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% complementary to an equal length portion of any of SEQ ID NOs: 1-6. In certain embodiments, the modified oligonucleotide comprises a nucleobase sequence 100% complementary to an equal length portion of any of SEQ ID NOs: 1-6.

Certain embodiments disclosed herein provide a compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides having a nucleobase sequence comprising a portion of at least 8 contiguous nucleobases complementary to an equal length portion of nucleobases 2027-2068 of SEQ ID NO: 1, wherein the nucleobase sequence of the modified oligonucleotide is at least 80% complementary to SEQ ID NO: 1.

Certain embodiments disclosed herein provide a compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides having a nucleobase sequence comprising a portion of at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 contiguous nucleobases complementary to an equal length portion of nucleobases 2027 to 2068 of SEQ ID NO: 1, wherein the nucleobase sequence of the modified oligonucleotide is at least 80% complementary to SEQ ID NO: 1.

Certain embodiments disclosed herein provide a compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides having a nucleobase sequence comprising a portion of at least 8 contiguous nucleobases complementary to an equal length portion of nucleobases 2250 to 2337 of SEQ ID NO: 1, wherein the nucleobase sequence of the modified oligonucleotide is at least 80% complementary to SEQ ID NO: 1.

Certain embodiments disclosed herein provide a compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides having a nucleobase sequence comprising a portion of at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 contiguous nucleobases complementary to an equal length portion of nucleobases 2250 to 2337 of SEQ ID NO: 1, wherein the nucleobase sequence of the modified oligonucleotide is at least 80% complementary to SEQ ID NO: 1.

Certain embodiments disclosed herein provide a compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides having a nucleobase sequence comprising a portion of at least 8 contiguous nucleobases complementary to an equal length portion of nucleobases 2266 to 2337 of SEQ ID NO: 1, wherein the nucleobase sequence of the modified oligonucleotide is at least 80% complementary to SEQ ID NO: 1.

Certain embodiments disclosed herein provide a compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides having a nucleobase sequence comprising a portion of at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 contiguous nucleobases complementary to an equal length portion of nucleobases 2266 to 2337 of SEQ ID NO: 1, wherein the nucleobase sequence of the modified oligonucleotide is at least 80% complementary to SEQ ID NO: 1.

Certain embodiments disclosed herein provide a compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides having a nucleobase sequence comprising a portion of at least 8 contiguous nucleobases complementary to an equal length portion of nucleobases 2281 to 2300 of SEQ ID NO: 1, wherein the nucleobase sequence of the modified oligonucleotide is at least 80% complementary to SEQ ID NO: 1.

Certain embodiments disclosed herein provide a compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides having a nucleobase sequence comprising a portion of at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 contiguous nucleobases complementary to an equal length portion of nucleobases 2281 to 2300 of SEQ ID NO: 1, wherein the nucleobase sequence of the modified oligonucleotide is at least 80% complementary to SEQ ID NO: 1.

Certain embodiments disclosed herein provide a compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides having a nucleobase sequence comprising a portion of at least 8 contiguous nucleobases complementary to an equal length portion of nucleobases 2324 to 2346 of SEQ ID NO: 1, wherein the nucleobase sequence of the modified oligonucleotide is at least 80% complementary to SEQ ID NO: 1.

Certain embodiments disclosed herein provide a compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides having a nucleobase sequence comprising a portion of at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 contiguous nucleobases complementary to an equal length portion of nucleobases 2324 to 2346 of SEQ ID NO: 1, wherein the nucleobase sequence of the modified oligonucleotide is at least 80% complementary to SEQ ID NO: 1.

Certain embodiments disclosed herein provide a compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides having a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or 20 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 14-2051.

Certain embodiments disclosed herein provide a compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides having a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or 20 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 40, 42, 46, 47, 49, 53 to 55, 61, 62, 68, 71, 76, 82, 84, 85, 89, 93, 96 to 98, 102, 109, 114, 119, 127, 129, 130 to 135, 137 to 140, 142, 143, 160, 162 to 207, 209, 210, 223, 225 to 227, 230 to 243, 252 to 254, 257, 258, 262 to 273, 276, 278, 279, 281, 284, 452, 463, 464, 466, 467, 470, 477, 480, 500, 502, 512, 517, 525, 526, 726, 728, 868, 905, 906, 954, 961, 962, 963, 965, 966, 971, 973, 986, 987, 989, 990, 991, 994, 997, 998, 1000, 1001, 1011, 1015, 1021, 1024, 1035, 1080, 1085, 1150, 1258, 1259 to 1262, 1293, 1294, 1299, 1325, 1326, 1354, 1355 to 1357, 1370, 1384, 1391, 1393 to 1395, 1406 to 1408, 1431, 1467, 1468, 1470, 1472 to 1474, 1476, 1488, 1489, 1500, 1503, 1504, 1522, 1524, 1526, 1528, 1535, 1536, 1539, 1542, 1543, 1545, 1585, 1592, 1594, 1595, 1599, 1604, 1610 to 1612, 1615, 1618, 1619 to 1624, 1626, 1628, 1629, 1631, 1632, 1635 to 1637, 1640, 1658, 1662, 1665 to 1671, 1673, 1676 to 1679, 1681 to 1683, 1686, 1687, 1699 to 1710, 1712, 1714 to 1721, 1724 to 1726, 1728 to 1731, 1735, 1736, 1739 to 1741, 1751, 1755, 1771, 1778, 1781 to 1783, 1827, 1834, 1836, 1843 to 1846, 1872, 1874, 1875 to 1888, 1890 to 1895, 1897, 1898, 1900, 1904 to 1927, 1931 to 1933, 1937, 1939, 1940, 1943, 1950, 1951, 1953, 1955 to 1959, 1962, 1964 to 1967, 1969 to 1971, 1973, 1977 to 1981, 1984 to 1991, 1993 to 1996, 2000 to 2005, 2007 to 2012, 2014 to 2025, 2027, 2028, 2030, 2032 to 2037, 2039-2045, 2047, 2051.

Certain embodiments disclosed herein provide a compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides having a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or 20 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 46, 53, 54, 68, 76, 85, 96, 97, 114, 127, 129 to 132, 134, 135, 137 to 139, 142, 162 to 207, 225, 226, 230 to 243, 252, 264, 266 to 270, 284, 464, 467, 962, 963, 965, 966, 973, 990, 991, 997, 1000, 1001, 1011, 1261, 1299, 1355, 1356, 1470, 1472, 1473, 1503, 1504, 1522, 1526, 1535, 1536, 1542, 1543, 1545, 1595, 1599, 1604, 1620, 1623, 1624, 1626, 1640, 1662, 1666, 1667, 1669, 1670, 1673, 1682, 1683, 1687, 1699 to 1706, 1708, 1712, 1714 to 1716, 1719 to 1721, 1724 to 1726, 1729, 1730, 1736, 1778, 1783, 1836, 1843, 1875 to 1888, 1893 to 1895, 1897, 1900, 1904 to 1908, 1911, 1914 to 1918, 1920, 1922, 1923, 1925, 1926, 1931 to 1933, 1937, 1939, 1955, 1958, 1959, 1962, 1966, 1967, 1970, 1971, 1973, 1977, 1978 to 1981, 1985, 1986, 1987, 1988, 1990, 1991, 1994, 1996, 2000, 2002 to 2005, 2010, 2011, 2014 to 2025, 2027, 2028, 2035 to 2037, 2039, 2041 to 2045.

Certain embodiments disclosed herein provide a compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides having a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or 20 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 96, 127, 129 to 132, 139, 162 to 169, 171 to 189, 191 to 193, 195, 196, 198 to 206, 234, 236, 238 to 240, 267 to 270, 966, 1000, 1522, 1542, 1623, 1624, 1667, 1682, 1683, 1700, 1703, 1704, 1708, 1714, 1719, 1720, 1724 to 1726, 1729, 1875, 1876, 1878, 1884 to 1886, 1893, 1894, 1906, 1908, 1914, 1917, 1918, 1922, 1923, 1925, 1926, 1932, 1933, 1967, 1970, 1978 to 1981, 1985, 1986, 1988, 1990, 1991, 2003, 2010, 2015, 2016, 2018, 2020, 2021, 2024, 2025, 2027, 2028, 2035, 2037, 2039, 2044.

Certain embodiments disclosed herein provide a compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides having a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or 20 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 129, 130, 132, 163 to 168, 171, 172, 175 to 186, 188, 189, 192, 193, 195, 198 to 206, 238, 239, 966, 1703, 1720, 1726, 1923, 1925, 2003, 2015.

Certain embodiments disclosed herein provide a compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides having a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or 20 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 46, 53-54, 61, 68, 76, 83, 85, 93, 96-97, 109, 127, 129-130, 132, 134-15, 137-39, 142, 163-172, 180-184, 186, 189, 234, 236, 238-239, 267, 313, 411, 452, 463-470, 475-478, 480, 500-503, 512, 517-518, 524-526, 654, 689, 702, 725-726, 728, 738, 779, 786-787, 800, 808, 810-811, 825, 865, 868, 889, 894, 903, 905, 909, 954, 966, 1011, 1015, 1021, 1024, 1080, 1085, 1258-1259, 1261-1262, 1293-1294, 1299, 1325, 1470, 1472-1473, 1522, 1542, 1604, 1623-1624, 1667, 1670, 1682-1683, 1687, 1700, 1703-1704, 1708, 1714, 1716, 1719-1720, 1724-1726, 1729-1730, 1827, 1936, 1843-1844, 1846, 1886, 1893-1894, 1914, 1923, 1925, 1932, 1979, 1986, 1988, 1990, 2003, 2015, 2018, 2020, 2027-2028, 2035, 2037, 2039, 2044. Certain embodiments disclosed herein provide a compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides having a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or 20 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 238, 1714, 1719, 1893-1894, 1914, 1923, 1925, 2003.

In certain embodiments, the compound comprises a modified oligonucleotide consisting of 8 to 80, 20 to 80, 10 to 50, 20 to 35, 10 to 30, 12 to 30, 15 to 30, 16 to 30, 20 to 30, 20 to 29, 20 to 28, 20 to 27, 20 to 26, 20 to 25, 20 to 24, 20 to 23, 20 to 22, 20 to 21, 15 to 25, 16 to 25, 15 to 24, 16 to 24, 17 to 24, 18 to 24, 19 to 24, 19 to 22, 16 to 21, 18 to 21 or 16 to 20 linked nucleobases. In certain embodiments, the compound comprises a modified oligonucleotide consisting of 16 linked nucleosides. In certain embodiments, the compound comprises a modified oligonucleotide consisting of 20 linked nucleosides.

In certain embodiments, the compound comprises a modified oligonucleotide consisting of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, or 80 linked nucleobases in length, or a range defined by any two of the above values.

In certain embodiments, the modified oligonucleotide is single-stranded.

In certain embodiments, the modified oligonucleotide comprises at least one modified internucleoside linkage. In certain embodiments, the modified internucleoside linkage is a phosphorothioate internucleoside linkage. In certain embodiments, at least one modified internucleoside linkage is a phosphorothioate internucleoside linkage. In certain embodiments, each modified internucleoside linkage is a phosphorothioate internucleoside linkage.

In certain embodiments, the modified oligonucleotide comprises at least one nucleoside comprising a modified sugar. In certain embodiments, at least one modified sugar comprises a bicyclic sugar. In certain embodiments, at least one modified sugar comprises a 2′-O-methoxyethyl, a constrained ethyl, a 3′-fluoro-HNA or a 4′-(CH2)n—O-2′ bridge, wherein n is 1 or 2.

In certain embodiments, the modified oligonucleotide comprises at least one nucleoside comprising a modified nucleobase. In certain embodiments, the modified nucleobase is a 5-methylcytosine.

In certain embodiments, the modified oligonucleotide comprises a conjugate group. In certain embodiments, the conjugate is a carbohydrate moiety. In certain embodiments, the conjugate is a GalNAc moiety. In certain embodiments, the GalNAc is 5′-Trishexylamino-(THA)-C6 GalNAc3. In certain embodiments, the 5′-Trishexylamino-(THA)-C6 GalNAc3 conjugate has the formula

In certain embodiments, the modified oligonucleotide is linked to the 5′-Trishexylamino-(THA)-C6 GalNAc3 conjugate by a cleavable moiety. In certain embodiments, the cleavable moiety is a phosphate group.

In certain embodiments, the compound comprises a modified oligonucleotide consisting of 12 to 30 linked nucleosides and targeted to or complementary to an equal length portion of region 2250 to 2337 of SEQ ID NO: 1, wherein the modified oligonucleotide comprises: (a) a gap segment consisting of linked deoxynucleosides; (b) a 5′ wing segment consisting of linked nucleosides; and (c) a 3′ wing segment consisting of linked nucleosides; wherein the gap segment is positioned immediately adjacent to and between the 5′ wing segment and the 3′ wing segment and wherein each nucleoside of each wing segment comprises a modified sugar. In certain embodiments, the modified oligonucleotide further comprises at least one phosphorothioate internucleoside linkage. In certain embodiments, each internucleoside linkage is a phosphorothioate linkage. In certain embodiments, the modified oligonucleotide further comprises a GalNAc conjugate. In certain embodiments, the conjugate is a 5′-Trishexylamino-(THA)-C6 GalNAc3 conjugate. In certain embodiments, the modified oligonucleotide is linked to the 5′-Trishexylamino-(THA)-C6 GalNAc3 conjugate by a cleavable moiety. In certain embodiments, the cleavable moiety is a phosphate group.

In certain embodiments, the compound comprises a modified oligonucleotide consisting of 12 to 30 linked nucleosides and targeted to or complementary to an equal length portion of region 2266 to 2337 of SEQ ID NO: 1, wherein the modified oligonucleotide comprises: (a) a gap segment consisting of linked deoxynucleosides; (b) a 5′ wing segment consisting of linked nucleosides; and (c) a 3′ wing segment consisting of linked nucleosides; wherein the gap segment is positioned immediately adjacent to and between the 5′ wing segment and the 3′ wing segment and wherein each nucleoside of each wing segment comprises a modified sugar. In certain embodiments, the modified oligonucleotide further comprises at least one phosphorothioate internucleoside linkage. In certain embodiments, each internucleoside linkage is a phosphorothioate linkage. In certain embodiments, the modified oligonucleotide further comprises a GalNAc conjugate. In certain embodiments, the conjugate is a 5′-Trishexylamino-(THA)-C6 GalNAc3 conjugate. In certain embodiments, the modified oligonucleotide is linked to the 5′-Trishexylamino-(THA)-C6 GalNAc3 conjugate by a cleavable moiety. In certain embodiments, the cleavable moiety is a phosphate group.

In certain embodiments, the compound comprises a modified oligonucleotide consisting of 12 to 30 linked nucleosides and targeted to or complementary to an equal length portion of region 2281 to 2300 of SEQ ID NO: 1, wherein the modified oligonucleotide comprises: (a) a gap segment consisting of linked deoxynucleosides; (b) a 5′ wing segment consisting of linked nucleosides; and (c) a 3′ wing segment consisting of linked nucleosides; wherein the gap segment is positioned immediately adjacent to and between the 5′ wing segment and the 3′ wing segment and wherein each nucleoside of each wing segment comprises a modified sugar. In certain embodiments, the modified oligonucleotide further comprises at least one phosphorothioate internucleoside linkage. In certain embodiments, each internucleoside linkage is a phosphorothioate linkage. In certain embodiments, the modified oligonucleotide further comprises a GalNAc conjugate. In certain embodiments, the conjugate is a 5′-Trishexylamino-(THA)-C6 GalNAc3 conjugate. In certain embodiments, the modified oligonucleotide is linked to the 5′-Trishexylamino-(THA)-C6 GalNAc3 conjugate by a cleavable moiety. In certain embodiments, the cleavable moiety is a phosphate group.

In certain embodiments, the compound comprises a modified oligonucleotide consisting of 20 linked nucleosides and targeted to or complementary to an equal length portion of region 2027 to 2068 of SEQ ID NO: 1, wherein the modified oligonucleotide comprises: (a) a gap segment consisting of linked deoxynucleosides; (b) a 5′ wing segment consisting of linked nucleosides; and (c) a 3′ wing segment consisting of linked nucleosides; wherein the gap segment is positioned immediately adjacent to and between the 5′ wing segment and the 3′ wing segment, wherein each nucleoside of each wing segment comprises a 2′-O-methoxyethyl sugar, wherein at least one internucleoside linkage is a phosphorothioate linkage and wherein each cytosine residue is a 5-methylcytosine. In certain embodiments, each internucleoside linkage is a phosphorothioate linkage. In certain embodiments, the modified oligonucleotide further comprises a GalNAc conjugate. In certain embodiments, the conjugate is a 5′-Trishexylamino-(THA)-C6 GalNAc3 conjugate. In certain embodiments, the modified oligonucleotide is linked to the 5′-Trishexylamino-(THA)-C6 GalNAc3 conjugate by a cleavable moiety. In certain embodiments, the cleavable moiety is a phosphate group.

In certain embodiments, the compound comprising a modified oligonucleotide consisting of 16 to 20 linked nucleosides and having a nucleobase sequence comprising at least 8 contiguous nucleobases of SEQ ID NOs: 14-2051, wherein the modified oligonucleotide comprises: (a) a gap segment consisting of linked deoxynucleosides; (b) a 5′ wing segment consisting of linked nucleosides; and (c) a 3′ wing segment consisting of linked nucleosides; wherein the gap segment is positioned immediately adjacent to and between the 5′ wing segment and the 3′ wing segment, wherein each nucleoside of each wing segment comprises a modified sugar, wherein at least one internucleoside linkage is a phosphorothioate linkage and wherein each cytosine residue is a 5-methylcytosine. In certain embodiments, each internucleoside linkage is a phosphorothioate linkage. In certain embodiments, the modified oligonucleotide further comprises a GalNAc conjugate. In certain embodiments, the conjugate is a 5′-Trishexylamino-(THA)-C6 GalNAc3 conjugate. In certain embodiments, the modified oligonucleotide is linked to the 5′-Trishexylamino-(THA)-C6 GalNAc3 conjugate by a cleavable moiety. In certain embodiments, the cleavable moiety is a phosphate group. In certain embodiments, the compound comprising a modified oligonucleotide consisting of 16 to 20 linked nucleosides and having a nucleobase sequence comprising at least 8 contiguous nucleobases of SEQ ID NOs: 40, 42, 46, 47, 49, 53 to 55, 61, 62, 68, 71, 76, 82, 84, 85, 89, 93, 96 to 98, 102, 109, 114, 119, 127, 129, 130 to 135, 137 to 140, 142, 143, 160, 162 to 207, 209, 210, 223, 225 to 227, 230 to 243, 252 to 254, 257, 258, 262 to 273, 276, 278, 279, 281, 284, 452, 463, 464, 466, 467, 470, 477, 480, 500, 502, 512, 517, 525, 526, 726, 728, 868, 905, 906, 954, 961, 962, 963, 965, 966, 971, 973, 986, 987, 989, 990, 991, 994, 997, 998, 1000, 1001, 1011, 1015, 1021, 1024, 1035, 1080, 1085, 1150, 1258, 1259 to 1262, 1293, 1294, 1299, 1325, 1326, 1354, 1355 to 1357, 1370, 1384, 1391, 1393 to 1395, 1406 to 1408, 1431, 1467, 1468, 1470, 1472 to 1474, 1476, 1488, 1489, 1500, 1503, 1504, 1522, 1524, 1526, 1528, 1535, 1536, 1539, 1542, 1543, 1545, 1585, 1592, 1594, 1595, 1599, 1604, 1610 to 1612, 1615, 1618, 1619 to 1624, 1626, 1628, 1629, 1631, 1632, 1635 to 1637, 1640, 1658, 1662, 1665 to 1671, 1673, 1676 to 1679, 1681 to 1683, 1686, 1687, 1699 to 1710, 1712, 1714 to 1721, 1724 to 1726, 1728 to 1731, 1735, 1736, 1739 to 1741, 1751, 1755, 1771, 1778, 1781 to 1783, 1827, 1834, 1836, 1843 to 1846, 1872, 1874, 1875 to 1888, 1890 to 1895, 1897, 1898, 1900, 1904 to 1927, 1931 to 1933, 1937, 1939, 1940, 1943, 1950, 1951, 1953, 1955 to 1959, 1962, 1964 to 1967, 1969 to 1971, 1973, 1977 to 1981, 1984 to 1991, 1993 to 1996, 2000 to 2005, 2007 to 2012, 2014 to 2025, 2027, 2028, 2030, 2032 to 2037, 2039-2045, 2047, 2051, wherein the modified oligonucleotide comprises: (a) a gap segment consisting of linked deoxynucleosides; (b) a 5′ wing segment consisting of linked nucleosides; and (c) a 3′ wing segment consisting of linked nucleosides; wherein the gap segment is positioned immediately adjacent to and between the 5′ wing segment and the 3′ wing segment, wherein each nucleoside of each wing segment comprises a modified sugar, wherein at least one internucleoside linkage is a phosphorothioate linkage and wherein each cytosine residue is a 5-methylcytosine. In certain embodiments, each internucleoside linkage is a phosphorothioate linkage. In certain embodiments, the modified oligonucleotide further comprises a GalNAc conjugate. In certain embodiments, the conjugate is a 5′-Trishexylamino-(THA)-C6 GalNAc3 conjugate. In certain embodiments, the modified oligonucleotide is linked to the 5′-Trishexylamino-(THA)-C6 GalNAc3 conjugate by a cleavable moiety. In certain embodiments, the cleavable moiety is a phosphate group.

In certain embodiments, the compound comprising a modified oligonucleotide consisting of 16 to 20 linked nucleosides and having a nucleobase sequence comprising at least 8 contiguous nucleobases of SEQ ID NOs: 46, 53, 54, 68, 76, 85, 96, 97, 114, 127, 129 to 132, 134, 135, 137 to 139, 142, 162 to 207, 225, 226, 230 to 243, 252, 264, 266 to 270, 284, 464, 467, 962, 963, 965, 966, 973, 990, 991, 997, 1000, 1001, 1011, 1261, 1299, 1355, 1356, 1470, 1472, 1473, 1503, 1504, 1522, 1526, 1535, 1536, 1542, 1543, 1545, 1595, 1599, 1604, 1620, 1623, 1624, 1626, 1640, 1662, 1666, 1667, 1669, 1670, 1673, 1682, 1683, 1687, 1699 to 1706, 1708, 1712, 1714 to 1716, 1719 to 1721, 1724 to 1726, 1729, 1730, 1736, 1778, 1783, 1836, 1843, 1875 to 1888, 1893 to 1895, 1897, 1900, 1904 to 1908, 1911, 1914 to 1918, 1920, 1922, 1923, 1925, 1926, 1931 to 1933, 1937, 1939, 1955, 1958, 1959, 1962, 1966, 1967, 1970, 1971, 1973, 1977, 1978 to 1981, 1985, 1986, 1987, 1988, 1990, 1991, 1994, 1996, 2000, 2002 to 2005, 2010, 2011, 2014 to 2025, 2027, 2028, 2035 to 2037, 2039, 2041 to 2045, wherein the modified oligonucleotide comprises: (a) a gap segment consisting of linked deoxynucleosides; (b) a 5′ wing segment consisting of linked nucleosides; and (c) a 3′ wing segment consisting of linked nucleosides; wherein the gap segment is positioned immediately adjacent to and between the 5′ wing segment and the 3′ wing segment, wherein each nucleoside of each wing segment comprises a modified sugar, wherein at least one internucleoside linkage is a phosphorothioate linkage and wherein each cytosine residue is a 5-methylcytosine. In certain embodiments, each internucleoside linkage is a phosphorothioate linkage. In certain embodiments, the modified oligonucleotide further comprises a GalNAc conjugate. In certain embodiments, the conjugate is a 5′-Trishexylamino-(THA)-C6 GalNAc3 conjugate. In certain embodiments, the modified oligonucleotide is linked to the 5′-Trishexylamino-(THA)-C6 GalNAc3 conjugate by a cleavable moiety. In certain embodiments, the cleavable moiety is a phosphate group.

In certain embodiments, the compound comprising a modified oligonucleotide consisting of 16 to 20 linked nucleosides and having a nucleobase sequence comprising at least 8 contiguous nucleobases of SEQ ID NOs: 96, 127, 129 to 132, 139, 162 to 169, 171 to 189, 191 to 193, 195, 196, 198 to 206, 234, 236, 238 to 240, 267 to 270, 966, 1000, 1522, 1542, 1623, 1624, 1667, 1682, 1683, 1700, 1703, 1704, 1708, 1714, 1719, 1720, 1724 to 1726, 1729, 1875, 1876, 1878, 1884 to 1886, 1893, 1894, 1906, 1908, 1914, 1917, 1918, 1922, 1923, 1925, 1926, 1932, 1933, 1967, 1970, 1978 to 1981, 1985, 1986, 1988, 1990, 1991, 2003, 2010, 2015, 2016, 2018, 2020, 2021, 2024, 2025, 2027, 2028, 2035, 2037, 2039, 2044, wherein the modified oligonucleotide comprises: (a) a gap segment consisting of linked deoxynucleosides; (b) a 5′ wing segment consisting of linked nucleosides; and (c) a 3′ wing segment consisting of linked nucleosides; wherein the gap segment is positioned immediately adjacent to and between the 5′ wing segment and the 3′ wing segment, wherein each nucleoside of each wing segment comprises a modified sugar, wherein at least one internucleoside linkage is a phosphorothioate linkage and wherein each cytosine residue is a 5-methylcytosine. In certain embodiments, each internucleoside linkage is a phosphorothioate linkage. In certain embodiments, the modified oligonucleotide further comprises a GalNAc conjugate. In certain embodiments, the conjugate is a 5′-Trishexylamino-(THA)-C6 GalNAc3 conjugate. In certain embodiments, the modified oligonucleotide is linked to the 5′-Trishexylamino-(THA)-C6 GalNAc3 conjugate by a cleavable moiety. In certain embodiments, the cleavable moiety is a phosphate group.

In certain embodiments, the compound comprising a modified oligonucleotide consisting of 16 to 20 linked nucleosides and having a nucleobase sequence comprising at least 8 contiguous nucleobases of SEQ ID NOs: 129, 130, 132, 163 to 168, 171, 172, 175 to 186, 188, 189, 192, 193, 195, 198 to 206, 238, 239, 966, 1703, 1720, 1726, 1923, 1925, 2003, 2015, wherein the modified oligonucleotide comprises: (a) a gap segment consisting of linked deoxynucleosides; (b) a 5′ wing segment consisting of linked nucleosides; and (c) a 3′ wing segment consisting of linked nucleosides; wherein the gap segment is positioned immediately adjacent to and between the 5′ wing segment and the 3′ wing segment, wherein each nucleoside of each wing segment comprises a modified sugar, wherein at least one internucleoside linkage is a phosphorothioate linkage and wherein each cytosine residue is a 5-methylcytosine. In certain embodiments, each internucleoside linkage is a phosphorothioate linkage. In certain embodiments, the modified oligonucleotide further comprises a GalNAc conjugate. In certain embodiments, the conjugate is a 5′-Trishexylamino-(THA)-C6 GalNAc3 conjugate. In certain embodiments, the modified oligonucleotide is linked to the 5′-Trishexylamino-(THA)-C6 GalNAc3 conjugate by a cleavable moiety. In certain embodiments, the cleavable moiety is a phosphate group.

In certain embodiments, the compound comprising a modified oligonucleotide consisting of 16 to 20 linked nucleosides and having a nucleobase sequence comprising at least 8 contiguous nucleobases of SEQ ID NOs: 46, 53-54, 61, 68, 76, 83, 85, 93, 96-97, 109, 127, 129-130, 132, 134-15, 137-39, 142, 163-172, 180-184, 186, 189, 234, 236, 238-239, 267, 313, 411, 452, 463-470, 475-478, 480, 500-503, 512, 517-518, 524-526, 654, 689, 702, 725-726, 728, 738, 779, 786-787, 800, 808, 810-811, 825, 865, 868, 889, 894, 903, 905, 909, 954, 966, 1011, 1015, 1021, 1024, 1080, 1085, 1258-1259, 1261-1262, 1293-1294, 1299, 1325, 1470, 1472-1473, 1522, 1542, 1604, 1623-1624, 1667, 1670, 1682-1683, 1687, 1700, 1703-1704, 1708, 1714, 1716, 1719-1720, 1724-1726, 1729-1730, 1827, 1936, 1843-1844, 1846, 1886, 1893-1894, 1914, 1923, 1925, 1932, 1979, 1986, 1988, 1990, 2003, 2015, 2018, 2020, 2027-2028, 2035, 2037, 2039, 2044, wherein the modified oligonucleotide comprises: (a) a gap segment consisting of linked deoxynucleosides; (b) a 5′ wing segment consisting of linked nucleosides; and (c) a 3′ wing segment consisting of linked nucleosides; wherein the gap segment is positioned immediately adjacent to and between the 5′ wing segment and the 3′ wing segment, wherein each nucleoside of each wing segment comprises a modified sugar, wherein at least one internucleoside linkage is a phosphorothioate linkage and wherein each cytosine residue is a 5-methylcytosine. In certain embodiments, each internucleoside linkage is a phosphorothioate linkage. In certain embodiments, the modified oligonucleotide further comprises a GalNAc conjugate. In certain embodiments, the conjugate is a 5′-Trishexylamino-(THA)-C6 GalNAc3 conjugate. In certain embodiments, the modified oligonucleotide is linked to the 5′-Trishexylamino-(THA)-C6 GalNAc3 conjugate by a cleavable moiety. In certain embodiments, the cleavable moiety is a phosphate group.

In certain embodiments, the compound comprising a modified oligonucleotide consisting of 16 to 20 linked nucleosides and having a nucleobase sequence comprising at least 8 contiguous nucleobases of SEQ ID NOs: 238, 1714, 1719, 1893-1894, 1914, 1923, 1925, 2003, wherein the modified oligonucleotide comprises: (a) a gap segment consisting of linked deoxynucleosides; (b) a 5′ wing segment consisting of linked nucleosides; and (c) a 3′ wing segment consisting of linked nucleosides; wherein the gap segment is positioned immediately adjacent to and between the 5′ wing segment and the 3′ wing segment, wherein each nucleoside of each wing segment comprises a modified sugar, wherein at least one internucleoside linkage is a phosphorothioate linkage and wherein each cytosine residue is a 5-methylcytosine. In certain embodiments, each internucleoside linkage is a phosphorothioate linkage. In certain embodiments, the modified oligonucleotide further comprises a GalNAc conjugate. In certain embodiments, the conjugate is a 5′-Trishexylamino-(THA)-C6 GalNAc3 conjugate. In certain embodiments, the modified oligonucleotide is linked to the 5′-Trishexylamino-(THA)-C6 GalNAc3 conjugate by a cleavable moiety. In certain embodiments, the cleavable moiety is a phosphate group.

In certain embodiments, the compound comprising a modified oligonucleotide consisting of 20 linked nucleosides and having a nucleobase sequence comprising at least 8 contiguous nucleobases of SEQ ID NO: 1914, wherein the modified oligonucleotide comprises: (a) a gap segment consisting of ten linked deoxynucleosides; (b) a 5′ wing segment consisting of five linked nucleosides; and (c) a 3′ wing segment consisting of five linked nucleosides; wherein the gap segment is positioned immediately adjacent to and between the 5′ wing segment and the 3′ wing segment, wherein each nucleoside of each wing segment comprises a 2′-O-methoxyethyl sugar, wherein at least one internucleoside linkage is a phosphorothioate linkage and wherein each cytosine residue is a 5-methylcytosine. In certain embodiments, each internucleoside linkage is a phosphorothioate linkage. In certain embodiments, the modified oligonucleotide further comprises a GalNAc conjugate. In certain embodiments, the conjugate is a 5′-Trishexylamino-(THA)-C6 GalNAc3 conjugate. In certain embodiments, the modified oligonucleotide is linked to the 5′-Trishexylamino-(THA)-C6 GalNAc3 conjugate by a cleavable moiety. In certain embodiments, the cleavable moiety is a phosphate group.

Certain embodiments disclosed herein provide a compound comprising a modified oligonucleotide according to the following formula: mCes Aes mCes Aes Aes Ads mCds Ads Ads Gds mCds Tds Gds Gds Tds mCes Ges Ges Tes Te (SEQ ID NO: 1914); wherein, A is an adenine, mC is a 5′-methylcytosine, G is a guanine, T is a thymine, e is a 2′-O-methoxyethyl modified nucleoside, d is a 2′-deoxynucleoside, and s is a phosphorothioate internucleoside linkage. In certain embodiments, the modified oligonucleotide further comprises a GalNAc conjugate. In certain embodiments, the conjugate is a 5′-Trishexylamino-(THA)-C6 GalNAc3 conjugate. In certain embodiments, the modified oligonucleotide is linked to the 5′-Trishexylamino-(THA)-C6 GalNAc3 conjugate by a cleavable moiety. In certain embodiments, the cleavable moiety is a phosphate group.

Certain embodiments disclosed herein provide a compound comprising a modified oligonucleotide with the following formula:

In certain embodiments, the compounds or compositions disclosed herein comprise a salt of the modified oligonucleotide.

In certain embodiments, the compounds or compositions disclosed herein further comprise a pharmaceutically acceptable carrier or diluent.

In certain embodiments, the animal is a human.

Certain embodiments provide a composition or compound comprising a modified oligonucleotide as described herein, wherein the viscosity level is less than 40 cP. In certain embodiments, the composition has a viscosity level less than 15 cP. In certain embodiments, the composition has a viscosity level less than 12 cP. In certain embodiments, the composition has a viscosity level less than 10 cP.

Certain embodiments disclosed herein provide compounds and compositions comprising a modified oligonucleotide targeting AGT for use in reducing AGT in a cell, tissue, organ or animal. In certain embodiments, reducing AGT treats, prevents, slows the progression, delays the onset of, and/or reduces a RAAS pathway related disease, disorder and/or condition, or symptom thereof. In certain embodiments, reducing AGT decreases hypertension. In certain embodiments, reducing AGT decreases or prevents fibrosis. In certain embodiments, reducing AGT modulates a symptom or marker of a RAAS pathway related disease, disorder and/or condition. In certain embodiments, the marker can be selected from one or more of shortened life expectancy, hypertension, chronic kidney disease, stroke, myocardial infarction, heart failure, valvular heart disease, aneurysms of the blood vessels, peripheral artery disease, organ damage and other cardiovascular diseases, disorders and/or conditions or symptoms thereof.

In certain embodiments, provided are compounds and compositions comprising a modified oligonucleotide targeting AGT for use in therapy. In certain embodiments, the compounds and compositions comprising a modified oligonucleotide targeting AGT are administered to an animal in a therapeutically effective amount.

In certain embodiments, provided are compounds and compositions comprising a modified oligonucleotide targeting AGT for use in the preparation of a medicament. In certain embodiments, the medicament is used for treating, preventing, slowing the progression, delaying the onset of, and/or reducing a RAAS pathway related disease, disorder and/or condition, or symptom thereof.

In certain embodiments, provided is a kit for treating, preventing, or ameliorating a RAAS pathway related disease and/or condition, disease, disorder or condition, wherein the kit comprises: (i) an AGT specific inhibitor as described herein; and optionally (ii) an additional agent or therapy as described herein. A kit of the present invention may further include instructions for using the kit to treat, prevent, or ameliorate a RAAS pathway related disease, disorder or condition as described herein.

In certain embodiments, the RAAS pathway related disease, disorder or condition is shortened life expectancy, hypertension, kidney disease (e.g., chronic kidney disease), stroke, cardiac disease (e.g., myocardial infarction, heart failure, valvular heart disease), aneurysms of the blood vessels, peripheral artery disease, organ damage and other RAAS related diseases, disorders and/or conditions or symptoms thereof. In certain embodiments, the hypertension is nonresistant hypertension or resistant hypertension. In certain embodiments, the aneurysm of the blood vessels is aortic aneurysm. In certain embodiments, the organ damage is heart muscle hypertrophy or fibrosis in an organ or tissue. In certain embodiments, the organ is heart, liver or kidney and the tissue is derived from the heart, liver or kidney.

The compound can be used in combination therapy with one or more additional agent or therapy as described herein. Agents or therapies can be administered concomitantly or sequentially to an animal. In certain embodiments, the composition or compound comprising a modified oligonucleotide targeting AGT is co-administered with one or more second agent(s). In certain embodiments the second agent includes procedures to reduce hypertension, diet changes, lifestyle changes, anti-fibrotic drugs and anti-hypertensive drugs such as RAS or RAAS inhibitors, diuretics, calcium channel blockers, adrenergic receptor antagonists, adrenergic agonists and vasodilators. In certain embodiments, the second agent is a second antisense compound. In further embodiments, the second antisense compound targets AGT. In other embodiments, the second antisense compound targets a non-AGT compound.

Antisense Compounds

Oligomeric compounds include, but are not limited to, oligonucleotides, oligonucleosides, oligonucleotide analogs, oligonucleotide mimetics, antisense compounds, antisense oligonucleotides, and siRNAs. An oligomeric compound can be “antisense” to a target nucleic acid, meaning that it is capable of undergoing hybridization to a target nucleic acid through hydrogen bonding.

In certain embodiments, an antisense compound has a nucleobase sequence that, when written in the 5′ to 3′ direction, comprises the reverse complement of the target segment of a target nucleic acid to which it is targeted. In certain such embodiments, an antisense oligonucleotide has a nucleobase sequence that, when written in the 5′ to 3′ direction, comprises the reverse complement of the target segment of a target nucleic acid to which it is targeted.

In certain embodiments, an antisense compound targeted to AGT nucleic acid is 10 to 30 nucleotides in length. In other words, antisense compounds are from 10 to 30 linked nucleobases. In other embodiments, the antisense compound comprises a modified oligonucleotide consisting of 8 to 80, 10 to 80, 12 to 50, 15 to 30, 18 to 24, 19 to 22, or 20 linked nucleobases. In certain such embodiments, the antisense compound comprises a modified oligonucleotide consisting of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, or 80 linked nucleobases in length, or a range defined by any two of the above values. In some embodiments, the antisense compound is an antisense oligonucleotide.

In certain embodiments, the antisense compound comprises a shortened or truncated modified oligonucleotide. The shortened or truncated modified oligonucleotide can have a single nucleoside deleted from the 5′ end (5′ truncation), the central portion or alternatively from the 3′ end (3′ truncation). A shortened or truncated oligonucleotide can have two or more nucleosides deleted from the 5′ end, two or more nucleosides deleted from the central portion or alternatively can have two or more nucleosides deleted from the 3′ end. Alternatively, the deleted nucleosides can be dispersed throughout the modified oligonucleotide, for example, in an antisense compound having one or more nucleoside deleted from the 5′ end, one or more nucleoside deleted from the central portion and/or one or more nucleoside deleted from the 3′ end.

When a single additional nucleoside is present in a lengthened oligonucleotide, the additional nucleoside can be located at the 5′ end, 3′ end or central portion of the oligonucleotide. When two or more additional nucleosides are present, the added nucleosides can be adjacent to each other, for example, in an oligonucleotide having two nucleosides added to the 5′ end (5′ addition), to the 3′ end (3′ addition) or the central portion, of the oligonucleotide. Alternatively, the added nucleoside can be dispersed throughout the antisense compound, for example, in an oligonucleotide having one or more nucleoside added to the 5′ end, one or more nucleoside added to the 3′ end, and/or one or more nucleoside added to the central portion. It is possible to increase or decrease the length of an antisense compound, such as an antisense oligonucleotide, and/or introduce mismatch bases without eliminating activity. For example, in Woolf et al. (Proc. Natl. Acad. Sci. USA 89:7305-7309, 1992), a series of antisense oligonucleotides 13-25 nucleobases in length were tested for their ability to induce cleavage of a target RNA in an oocyte injection model. Antisense oligonucleotides 25 nucleobases in length with 8 or 11 mismatch bases near the ends of the antisense oligonucleotides were able to direct specific cleavage of the target mRNA, albeit to a lesser extent than the antisense oligonucleotides that contained no mismatches. Similarly, target specific cleavage was achieved using 13 nucleobase antisense oligonucleotides, including those with 1 or 3 mismatches.

Gautschi et al (J. Natl. Cancer Inst. 93:463-471, March 2001) demonstrated the ability of an oligonucleotide having 100% complementarity to the bcl-2 mRNA and having 3 mismatches to the bcl-xL mRNA to reduce the expression of both bcl-2 and bcl-xL in vitro and in vivo. Furthermore, this oligonucleotide demonstrated potent anti-tumor activity in vivo.

Maher and Dolnick (Nuc. Acid. Res. 16:3341-3358, 1988) tested a series of tandem 14 nucleobase antisense oligonucleotides, and a 28 and 42 nucleobase antisense oligonucleotides comprised of the sequence of two or three of the tandem antisense oligonucleotides, respectively, for their ability to arrest translation of human DHFR in a rabbit reticulocyte assay. Each of the three 14 nucleobase antisense oligonucleotides alone was able to inhibit translation, albeit at a more modest level than the 28 or 42 nucleobase antisense oligonucleotides.

Certain Antisense Compound Motifs and Mechanisms

In certain embodiments, antisense compounds have chemically modified subunits arranged in patterns, or motifs, to confer to the antisense compounds properties such as enhanced inhibitory activity, increased binding affinity for a target nucleic acid, or resistance to degradation by in vivo nucleases.

Chimeric antisense compounds typically contain at least one region modified so as to confer increased resistance to nuclease degradation, increased cellular uptake, increased binding affinity for the target nucleic acid, and/or increased inhibitory activity. A second region of a chimeric antisense compound may confer another desired property e.g., serve as a substrate for the cellular endonuclease RNase H, which cleaves the RNA strand of an RNA:DNA duplex.

Antisense activity may result from any mechanism involving the hybridization of the antisense compound (e.g., oligonucleotide) with a target nucleic acid, wherein the hybridization ultimately results in a biological effect. In certain embodiments, the amount and/or activity of the target nucleic acid is modulated. In certain embodiments, the amount and/or activity of the target nucleic acid is reduced. In certain embodiments, hybridization of the antisense compound to the target nucleic acid ultimately results in target nucleic acid degradation. In certain embodiments, hybridization of the antisense compound to the target nucleic acid does not result in target nucleic acid degradation. In certain such embodiments, the presence of the antisense compound hybridized with the target nucleic acid (occupancy) results in a modulation of antisense activity. In certain embodiments, antisense compounds having a particular chemical motif or pattern of chemical modifications are particularly suited to exploit one or more mechanisms. In certain embodiments, antisense compounds function through more than one mechanism and/or through mechanisms that have not been elucidated. Accordingly, the antisense compounds described herein are not limited by particular mechanism.

Antisense mechanisms include, without limitation, RNase H mediated antisense; RNAi mechanisms, which utilize the RISC pathway and include, without limitation, siRNA, ssRNA and microRNA mechanisms; and occupancy based mechanisms. Certain antisense compounds may act through more than one such mechanism and/or through additional mechanisms.

RNase H-Mediated Antisense

In certain embodiments, antisense activity results at least in part from degradation of target RNA by RNase H. RNase H is a cellular endonuclease that cleaves the RNA strand of an RNA:DNA duplex. It is known in the art that single-stranded antisense compounds which are “DNA-like” elicit RNase H activity in mammalian cells. Accordingly, antisense compounds comprising at least a portion of DNA or DNA-like nucleosides may activate RNase H, resulting in cleavage of the target nucleic acid. In certain embodiments, antisense compounds that utilize RNase H comprise one or more modified nucleosides. In certain embodiments, such antisense compounds comprise at least one block of 1-8 modified nucleosides. In certain such embodiments, the modified nucleosides do not support RNase H activity. In certain embodiments, such antisense compounds are gapmers, as described herein. In certain such embodiments, the gap of the gapmer comprises DNA nucleosides. In certain such embodiments, the gap of the gapmer comprises DNA-like nucleosides. In certain such embodiments, the gap of the gapmer comprises DNA nucleosides and DNA-like nucleosides.

Certain antisense compounds having a gapmer motif are considered chimeric antisense compounds. In a gapmer an internal region having a plurality of nucleotides that supports RNaseH cleavage is positioned between external regions having a plurality of nucleotides that are chemically distinct from the nucleosides of the internal region. In the case of an antisense oligonucleotide having a gapmer motif, the gap segment generally serves as the substrate for endonuclease cleavage, while the wing segments comprise modified nucleosides. In certain embodiments, the regions of a gapmer are differentiated by the types of sugar moieties comprising each distinct region. The types of sugar moieties that are used to differentiate the regions of a gapmer may in some embodiments include β-D-ribonucleosides, β-D-deoxyribonucleosides, 2′-modified nucleosides (such 2′-modified nucleosides may include 2′-MOE and 2′-O—CH3, among others), and bicyclic sugar modified nucleosides (such bicyclic sugar modified nucleosides may include those having a constrained ethyl). In certain embodiments, nucleosides in the wings may include several modified sugar moieties, including, for example 2′-MOE and bicyclic sugar moieties such as constrained ethyl (cEt) or LNA. In certain embodiments, wings may include several modified and unmodified sugar moieties. In certain embodiments, wings may include various combinations of 2′-MOE nucleosides, bicyclic sugar moieties such as constrained ethyl nucleosides or LNA nucleosides, and 2′-deoxynucleosides.

Each distinct region may comprise uniform sugar moieties, variant, or alternating sugar moieties. The wing-gap-wing motif is frequently described as “X-Y-Z”, where “X” represents the length of the 5′-wing, “Y” represents the length of the gap, and “Z” represents the length of the 3′-wing. “X” and “Z” may comprise uniform, variant, or alternating sugar moieties. In certain embodiments, “X” and “Y” may include one or more 2′-deoxynucleosides. “Y” may comprise 2′-deoxynucleosides. As used herein, a gapmer described as “X-Y-Z” has a configuration such that the gap is positioned immediately adjacent to each of the 5′-wing and the 3′ wing. Thus, no intervening nucleotides exist between the 5′-wing and gap, or the gap and the 3′-wing. Any of the antisense compounds described herein can have a gapmer motif. In certain embodiments, “X” and “Z” are the same; in other embodiments they are different. In certain embodiments, “Y” is between 8 and 15 nucleosides. X, Y, or Z can be any of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30 or more nucleosides.

In certain embodiments, the antisense compound targeted to an AGT nucleic acid has a gapmer motif in which the gap consists of 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16 linked nucleosides.

In certain embodiments, the antisense oligonucleotide has a sugar motif described by Formula A as follows: (J)m-(B)n-(J)p-(B)r-(A)t-(D)g-(A)v-(B)w-(J)x-(B)y-(J)z

wherein:

each A is independently a 2′-substituted nucleoside;

each B is independently a bicyclic nucleoside;

each J is independently either a 2′-substituted nucleoside or a 2′-deoxynucleoside;

each D is a 2′-deoxynucleoside;

m is 0-4; n is 0-2; p is 0-2; r is 0-2; t is 0-2; v is 0-2; w is 0-4; x is 0-2; y is 0-2; z is 0-4; g is 6-14; provided that:

at least one of m, n, and r is other than 0;

at least one of w and y is other than 0;

the sum of m, n, p, r, and t is from 2 to 5; and

the sum of v, w, x, y, and z is from 2 to 5.

RNAi Compounds

In certain embodiments, antisense compounds are interfering RNA compounds (RNAi), which include double-stranded RNA compounds (also referred to as short-interfering RNA or siRNA) and single-stranded RNAi compounds (or ssRNA). Such compounds work at least in part through the RISC pathway to degrade and/or sequester a target nucleic acid (thus, include microRNA/microRNA-mimic compounds). In certain embodiments, antisense compounds comprise modifications that make them particularly suited for such mechanisms.

i. ssRNA Compounds

In certain embodiments, antisense compounds including those particularly suited for use as single-stranded RNAi compounds (ssRNA) comprise a modified 5′-terminal end. In certain such embodiments, the 5′-terminal end comprises a modified phosphate moiety. In certain embodiments, such modified phosphate is stabilized (e.g., resistant to degradation/cleavage compared to unmodified 5′-phosphate). In certain embodiments, such 5′-terminal nucleosides stabilize the 5′-phosphorous moiety. Certain modified 5′-terminal nucleosides may be found in the art, for example in WO 2011/139702.

In certain embodiments, the 5′-nucleoside of an ssRNA compound has Formula IIc:

wherein:

T1 is an optionally protected phosphorus moiety;

T2 is an internucleoside linking group linking the compound of Formula IIc to the oligomeric compound;

A has one of the formulas:

Q1 and Q2 are each, independently, H, halogen, C1-C6 alkyl, substituted C1-C6 alkyl, C1-C6 alkoxy, substituted C1-C6 alkoxy, C2-C6 alkenyl, substituted C2-C6 alkenyl, C2-C6 alkynyl, substituted C2-C6 alkynyl or N(R3)(R4);

Q3 is O, S, N(R5) or C(R6)(R7);

each R3, R4 R5, R6 and R7 is, independently, H, C1-C6 alkyl, substituted C1-C6 alkyl or C1-C6 alkoxy;

M3 is O, S, NR14, C(R15)(R16), C(R15)(R16)C(R17)(R18), C(R15)═C(R17), OC(R15)(R16) or OC(R15)(Bx2);

R14 is H, C1-C6 alkyl, substituted C1-C6 alkyl, C1-C6 alkoxy, substituted C1-C6 alkoxy, C2-C6 alkenyl, substituted C2-C6 alkenyl, C2-C6 alkynyl or substituted C2-C6 alkynyl;

R15, R16, R17 and R18 are each, independently, H, halogen, C1-C6 alkyl, substituted C1-C6 alkyl, C1-C6 alkoxy, substituted C1-C6 alkoxy, C2-C6 alkenyl, substituted C2-C6 alkenyl, C2-C6 alkynyl or substituted C2-C6 alkynyl;

Bx1 is a heterocyclic base moiety;

or if Bx2 is present then Bx2 is a heterocyclic base moiety and Bx1 is H, halogen, C1-C6 alkyl, substituted C1-C6 alkyl, C1-C6 alkoxy, substituted C1-C6 alkoxy, C2-C6 alkenyl, substituted C2-C6 alkenyl, C2-C6 alkynyl or substituted C2-C6 alkynyl;

J4, J5, J6 and J7 are each, independently, H, halogen, C1-C6 alkyl, substituted C1-C6 alkyl, C1-C6 alkoxy, substituted C1-C6 alkoxy, C2-C6 alkenyl, substituted C2-C6 alkenyl, C2-C6 alkynyl or substituted C2-C6 alkynyl;

or J4 forms a bridge with one of J5 or J7 wherein said bridge comprises from 1 to 3 linked biradical groups selected from O, S, NR19, C(R20)(R21), C(R20)═C(R21), C[═C(R20)(R21)] and C(═O) and the other two of J5, J6 and J7 are each, independently, H, halogen, C1-C6 alkyl, substituted C1-C6 alkyl, C1-C6 alkoxy, substituted C1-C6 alkoxy, C2-C6 alkenyl, substituted C2-C6 alkenyl, C2-C6 alkynyl or substituted C2-C6 alkynyl;

each R19, R20 and R21 is, independently, H, C1-C6 alkyl, substituted C1-C6 alkyl, C1-C6 alkoxy, substituted C1-C6 alkoxy, C2-C6 alkenyl, substituted C2-C6 alkenyl, C2-C6 alkynyl or substituted C2-C6 alkynyl;

G is H, OH, halogen or O—[C(R8)(R9)]n—[(C═O)m—X1]j—Z;

each R8 and R9 is, independently, H, halogen, C1-C6 alkyl or substituted C1-C6 alkyl;

X1 is O, S or N(E1);

Z is H, halogen, C1-C6 alkyl, substituted C1-C6 alkyl, C2-C6 alkenyl, substituted C2-C6 alkenyl, C2-C6 alkynyl, substituted C2-C6 alkynyl or N(E2)(E3);

E1, E2 and E3 are each, independently, H, C1-C6 alkyl or substituted C1-C6 alkyl;

n is from 1 to about 6;

m is 0 or 1;

j is 0 or 1;

each substituted group comprises one or more optionally protected substituent groups independently selected from halogen, OJ1, N(J1)(J2), ═NJ1, SJ1, N3, CN, OC(═X2)J1, OC(═X2)N(J1)(J2) and C(═X2)N(J1)(J2); X2 is O, S or NJ3;

each J1, J2 and J3 is, independently, H or C1-C6 alkyl;

when j is 1 then Z is other than halogen or N(E2)(E3); and

wherein said oligomeric compound comprises from 8 to 40 monomeric subunits and is hybridizable to at least a portion of a target nucleic acid.

In certain embodiments, M3 is O, CH═CH, OCH2 or OC(H)(Bx2). In certain embodiments, M3 is O.

In certain embodiments, J4, J5, J6 and J7 are each H. In certain embodiments, J4 forms a bridge with one of J5 or J7.

In certain embodiments, A has one of the formulas:

wherein:

Q1 and Q2 are each, independently, H, halogen, C1-C6 alkyl, substituted C1-C6 alkyl, C1-C6 alkoxy or substituted C1-C6 alkoxy. In certain embodiments, Q1 and Q2 are each H. In certain embodiments, Q1 and Q2 are each, independently, H or halogen. In certain embodiments, Q1 and Q2 is H and the other of Q1 and Q2 is F, CH3 or OCH3.

In certain embodiments, T1 has the formula:

wherein:

Ra and Rc are each, independently, protected hydroxyl, protected thiol, C1-C6 alkyl, substituted C1-C6 alkyl, C1-C6 alkoxy, substituted C1-C6 alkoxy, protected amino or substituted amino; and

Rb, is O or S. In certain embodiments, Rb, is O and R. and Rc are each, independently, OCH3, OCH2CH3 or CH(CH3)2.

In certain embodiments, G is halogen, OCH3, OCH2F, OCHF2, OCF3, OCH2CH3, O(CH2)2F, OCH2CHF2, OCH2CF3, OCH2—CH═CH2, O(CH2)2—OCH3, O(CH2)2—SCH3, O(CH2)2—OCF3, O(CH2)3—N(R10)(R11), O(CH2)2—ON(R10)(R11), O(CH2)2—O(CH2)2—N(R10)(R11), OCH2C(═O)—N(R10)(R11), OCH2C(═O)—N(R12)—(CH2)2—N(R10)(R11) or O(CH2)2—N(R12)—C(═NR13)[N(R10)(Rii)] wherein R10, R11, R12 and R13 are each, independently, H or C1-C6 alkyl. In certain embodiments, G is halogen, OCH3, OCF3, OCH2CH3, OCH2CF3, OCH2—CH═CH2, O(CH2)2—OCH3, O(CH2)2—O(CH2)2—N(CH3)2, OCH2C(═O)—N(H)CH3, OCH2C(═O)—N(H)—(CH2)2—N(CH3)2 or OCH2—N(H)—C(═NH)NH2. In certain embodiments, G is F, OCH3 or O(CH2)2—OCH3. In certain embodiments, G is O(CH2)2—OCH3.

In certain embodiments, the 5′-terminal nucleoside has Formula Ile:

In certain embodiments, antisense compounds, including those particularly suitable for ssRNA comprise one or more type of modified sugar moieties and/or naturally occurring sugar moieties arranged along an oligonucleotide or region thereof in a defined pattern or sugar modification motif. Such motifs may include any of the sugar modifications discussed herein and/or other known sugar modifications.

In certain embodiments, the oligonucleotides comprise or consist of a region having uniform sugar modifications. In certain such embodiments, each nucleoside of the region comprises the same RNA-like sugar modification. In certain embodiments, each nucleoside of the region is a 2′-F nucleoside. In certain embodiments, each nucleoside of the region is a 2′-OMe nucleoside. In certain embodiments, each nucleoside of the region is a 2′-MOE nucleoside. In certain embodiments, each nucleoside of the region is a cEt nucleoside. In certain embodiments, each nucleoside of the region is an LNA nucleoside. In certain embodiments, the uniform region constitutes all or essentially all of the oligonucleotide. In certain embodiments, the region constitutes the entire oligonucleotide except for 1-4 terminal nucleosides.

In certain embodiments, oligonucleotides comprise one or more regions of alternating sugar modifications, wherein the nucleosides alternate between nucleotides having a sugar modification of a first type and nucleotides having a sugar modification of a second type. In certain embodiments, nucleosides of both types are RNA-like nucleosides. In certain embodiments the alternating nucleosides are selected from: 2′-OMe, 2′-F, 2′-MOE, LNA, and cEt. In certain embodiments, the alternating modifications are 2′-F and 2′-OMe. Such regions may be contiguous or may be interrupted by differently modified nucleosides or conjugated nucleosides.

In certain embodiments, the alternating region of alternating modifications each consist of a single nucleoside (i.e., the pattern is (AB)xAy wherein A is a nucleoside having a sugar modification of a first type and B is a nucleoside having a sugar modification of a second type; x is 1-20 and y is 0 or 1). In certain embodiments, one or more alternating regions in an alternating motif includes more than a single nucleoside of a type. For example, oligonucleotides may include one or more regions of any of the following nucleoside motifs:

AABBAA;

ABBABB;

AABAAB;

ABBABAABB;

ABABAA;

AABABAB;

ABABAA;

ABBAABBABABAA;

BABBAABBABABAA; or

ABABBAABBABABAA;

wherein A is a nucleoside of a first type and B is a nucleoside of a second type. In certain embodiments, A and B are each selected from 2′-F, 2′-OMe, BNA, and MOE.

In certain embodiments, oligonucleotides having such an alternating motif also comprise a modified 5′ terminal nucleoside, such as those of formula IIc or IIe.

In certain embodiments, oligonucleotides comprise a region having a 2-2-3 motif. Such regions comprises the following motif:


-(A)2-(B)x-(A)2-(C)y-(A)3-

wherein: A is a first type of modified nucleoside;

B and C, are nucleosides that are differently modified than A, however, B and C may have the same or different modifications as one another;

x and y are from 1 to 15.

In certain embodiments, A is a 2′-OMe modified nucleoside. In certain embodiments, B and C are both 2′-F modified nucleosides. In certain embodiments, A is a 2′-OMe modified nucleoside and B and C are both 2′-F modified nucleosides.

In certain embodiments, oligonucleosides have the following sugar motif:


5′-Q)-(AB)xAy-(D)z

wherein:

Q is a nucleoside comprising a stabilized phosphate moiety. In certain embodiments, Q is a nucleoside having Formula IIc or IIe;

A is a first type of modified nucleoside;

B is a second type of modified nucleoside;

D is a modified nucleoside comprising a modification different from the nucleoside adjacent to it.

Thus, if y is 0, then D must be differently modified than B and if y is 1, then D must be differently modified than A. In certain embodiments, D differs from both A and B.

X is 5-15;

Y is 0 or 1;

Z is 0-4.

In certain embodiments, oligonucleosides have the following sugar motif:


5′-(Q)-(A)x-(D)z

wherein:

Q is a nucleoside comprising a stabilized phosphate moiety. In certain embodiments, Q is a nucleoside having Formula IIc or IIe;

A is a first type of modified nucleoside;

D is a modified nucleoside comprising a modification different from A.

X is 11-30;

Z is 0-4.

In certain embodiments A, B, C, and D in the above motifs are selected from: 2′-OMe, 2′-F, 2′-MOE, LNA, and cEt. In certain embodiments, D represents terminal nucleosides. In certain embodiments, such terminal nucleosides are not designed to hybridize to the target nucleic acid (though one or more might hybridize by chance). In certain embodiments, the nucleobase of each D nucleoside is adenine, regardless of the identity of the nucleobase at the corresponding position of the target nucleic acid. In certain embodiments the nucleobase of each D nucleoside is thymine.

In certain embodiments, antisense compounds, including those particularly suited for use as ssRNA comprise modified internucleoside linkages arranged along the oligonucleotide or region thereof in a defined pattern or modified internucleoside linkage motif. In certain embodiments, oligonucleotides comprise a region having an alternating internucleoside linkage motif. In certain embodiments, oligonucleotides comprise a region of uniformly modified internucleoside linkages. In certain such embodiments, the oligonucleotide comprises a region that is uniformly linked by phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide is uniformly linked by phosphorothioate internucleoside linkages. In certain embodiments, each internucleoside linkage of the oligonucleotide is selected from phosphodiester and phosphorothioate. In certain embodiments, each internucleoside linkage of the oligonucleotide is selected from phosphodiester and phosphorothioate and at least one internucleoside linkage is phosphorothioate.

In certain embodiments, the oligonucleotide comprises at least 6 phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least 8 phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least 10 phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least one block of at least 6 consecutive phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least one block of at least 8 consecutive phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least one block of at least 10 consecutive phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least one block of at least one 12 consecutive phosphorothioate internucleoside linkages. In certain such embodiments, at least one such block is located at the 3′ end of the oligonucleotide. In certain such embodiments, at least one such block is located within 3 nucleosides of the 3′ end of the oligonucleotide.

Oligonucleotides having any of the various sugar motifs described herein, may have any linkage motif. For example, the oligonucleotides, including but not limited to those described above, may have a linkage motif selected from non-limiting the table below:

5′ most linkage Central region 3′-region PS Alternating PO/PS 6 PS PS Alternating PO/PS 7 PS PS Alternating PO/PS 8 PS

ii. siRNA Compounds

In certain embodiments, antisense compounds are double-stranded RNAi compounds (siRNA). In such embodiments, one or both strands may comprise any modification motif described above for ssRNA. In certain embodiments, ssRNA compounds may be unmodified RNA. In certain embodiments, siRNA compounds may comprise unmodified RNA nucleosides, but modified internucleoside linkages.

Several embodiments relate to double-stranded compositions wherein each strand comprises a motif defined by the location of one or more modified or unmodified nucleosides. In certain embodiments, compositions are provided comprising a first and a second oligomeric compound that are fully or at least partially hybridized to form a duplex region and further comprising a region that is complementary to and hybridizes to a nucleic acid target. It is suitable that such a composition comprise a first oligomeric compound that is an antisense strand having full or partial complementarity to a nucleic acid target and a second oligomeric compound that is a sense strand having one or more regions of complementarity to and forming at least one duplex region with the first oligomeric compound.

The compositions of several embodiments modulate gene expression by hybridizing to a nucleic acid target resulting in loss of its normal function. In some embodiments, the target nucleic acid is AGT. In certain embodiment, the degradation of the targeted AGT is facilitated by an activated RISC complex that is formed with compositions of the invention.

Several embodiments are directed to double-stranded compositions wherein one of the strands is useful in, for example, influencing the preferential loading of the opposite strand into the RISC (or cleavage) complex. The compositions are useful for targeting selected nucleic acid molecules and modulating the expression of one or more genes. In some embodiments, the compositions of the present invention hybridize to a portion of a target RNA resulting in loss of normal function of the target RNA.

Certain embodiments are drawn to double-stranded compositions wherein both the strands comprises a hemimer motif, a fully modified motif, a positionally modified motif or an alternating motif. Each strand of the compositions of the present invention can be modified to fulfil a particular role in for example the siRNA pathway. Using a different motif in each strand or the same motif with different chemical modifications in each strand permits targeting the antisense strand for the RISC complex while inhibiting the incorporation of the sense strand. Within this model, each strand can be independently modified such that it is enhanced for its particular role. The antisense strand can be modified at the 5′-end to enhance its role in one region of the RISC while the 3′-end can be modified differentially to enhance its role in a different region of the RISC.

The double-stranded oligonucleotide molecules can be a double-stranded polynucleotide molecule comprising self-complementary sense and antisense regions, wherein the antisense region comprises nucleotide sequence that is complementary to nucleotide sequence in a target nucleic acid molecule or a portion thereof and the sense region having nucleotide sequence corresponding to the target nucleic acid sequence or a portion thereof. The double-stranded oligonucleotide molecules can be assembled from two separate oligonucleotides, where one strand is the sense strand and the other is the antisense strand, wherein the antisense and sense strands are self-complementary (i.e. each strand comprises nucleotide sequence that is complementary to nucleotide sequence in the other strand; such as where the antisense strand and sense strand form a duplex or double-stranded structure, for example wherein the double-stranded region is about 15 to about 30, e.g., about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 base pairs; the antisense strand comprises nucleotide sequence that is complementary to nucleotide sequence in a target nucleic acid molecule or a portion thereof and the sense strand comprises nucleotide sequence corresponding to the target nucleic acid sequence or a portion thereof (e.g., about 15 to about 25 or more nucleotides of the double-stranded oligonucleotide molecule are complementary to the target nucleic acid or a portion thereof). Alternatively, the double-stranded oligonucleotide is assembled from a single oligonucleotide, where the self-complementary sense and antisense regions of the siRNA are linked by means of a nucleic acid based or non-nucleic acid-based linker(s).

The double-stranded oligonucleotide can be a polynucleotide with a duplex, asymmetric duplex, hairpin or asymmetric hairpin secondary structure, having self-complementary sense and antisense regions, wherein the antisense region comprises nucleotide sequence that is complementary to nucleotide sequence in a separate target nucleic acid molecule or a portion thereof and the sense region having nucleotide sequence corresponding to the target nucleic acid sequence or a portion thereof. The double-stranded oligonucleotide can be a circular single-stranded polynucleotide having two or more loop structures and a stem comprising self-complementary sense and antisense regions, wherein the antisense region comprises nucleotide sequence that is complementary to nucleotide sequence in a target nucleic acid molecule or a portion thereof and the sense region having nucleotide sequence corresponding to the target nucleic acid sequence or a portion thereof, and wherein the circular polynucleotide can be processed either in vivo or in vitro to generate an active siRNA molecule capable of mediating RNAi.

In certain embodiments, the double-stranded oligonucleotide comprises separate sense and antisense sequences or regions, wherein the sense and antisense regions are covalently linked by nucleotide or non-nucleotide linkers molecules as is known in the art, or are alternately non-covalently linked by ionic interactions, hydrogen bonding, van der waals interactions, hydrophobic interactions, and/or stacking interactions. In certain embodiments, the double-stranded oligonucleotide comprises nucleotide sequence that is complementary to nucleotide sequence of a target gene. In another embodiment, the double-stranded oligonucleotide interacts with nucleotide sequence of a target gene in a manner that causes inhibition of expression of the target gene.

As used herein, double-stranded oligonucleotides need not be limited to those molecules containing only RNA, but further encompasses chemically modified nucleotides and non-nucleotides. In certain embodiments, the short interfering nucleic acid molecules lack 2′-hydroxy (2′-OH) containing nucleotides. In certain embodiments short interfering nucleic acids optionally do not include any ribonucleotides (e.g., nucleotides having a 2′-OH group). Such double-stranded oligonucleotides that do not require the presence of ribonucleotides within the molecule to support RNAi can however have an attached linker or linkers or other attached or associated groups, moieties, or chains containing one or more nucleotides with 2′-OH groups. Optionally, double-stranded oligonucleotides can comprise ribonucleotides at about 5, 10, 20, 30, 40, or 50% of the nucleotide positions. As used herein, the term siRNA is meant to be equivalent to other terms used to describe nucleic acid molecules that are capable of mediating sequence specific RNAi, for example short interfering RNA (siRNA), double-stranded RNA (dsRNA), micro-RNA (miRNA), short hairpin RNA (shRNA), short interfering oligonucleotide, short interfering nucleic acid, short interfering modified oligonucleotide, chemically modified siRNA, post-transcriptional gene silencing RNA (ptgsRNA), and others. In addition, as used herein, the term RNAi is meant to be equivalent to other terms used to describe sequence specific RNA interference, such as post transcriptional gene silencing, translational inhibition, or epigenetics. For example, double-stranded oligonucleotides can be used to epigenetically silence genes at both the post-transcriptional level and the pre-transcriptional level. In a non-limiting example, epigenetic regulation of gene expression by siRNA molecules of the invention can result from siRNA mediated modification of chromatin structure or methylation pattern to alter gene expression (see, for example, Verdel et al., 2004, Science, 303, 672-676; Pal-Bhadra et al., 2004, Science, 303, 669-672; Allshire, 2002, Science, 297, 1818-1819; Volpe et al., 2002, Science, 297, 1833-1837; Jenuwein, 2002, Science, 297, 2215-2218; and Hall et al., 2002, Science, 297, 2232-2237).

It is contemplated that compounds and compositions of several embodiments provided herein can target AGT by a dsRNA-mediated gene silencing or RNAi mechanism, including, e.g., “hairpin” or stem-loop double-stranded RNA effector molecules in which a single RNA strand with self-complementary sequences is capable of assuming a double-stranded conformation, or duplex dsRNA effector molecules comprising two separate strands of RNA. In various embodiments, the dsRNA consists entirely of ribonucleotides or consists of a mixture of ribonucleotides and deoxynucleotides, such as the RNA/DNA hybrids disclosed, for example, by WO 00/63364, filed Apr. 19, 2000, or U.S. Ser. No. 60/130,377, filed Apr. 21, 1999. The dsRNA or dsRNA effector molecule may be a single molecule with a region of self-complementarity such that nucleotides in one segment of the molecule base pair with nucleotides in another segment of the molecule. In various embodiments, a dsRNA that consists of a single molecule consists entirely of ribonucleotides or includes a region of ribonucleotides that is complementary to a region of deoxyribonucleotides. Alternatively, the dsRNA may include two different strands that have a region of complementarity to each other.

In various embodiments, both strands consist entirely of ribonucleotides, one strand consists entirely of ribonucleotides and one strand consists entirely of deoxyribonucleotides, or one or both strands contain a mixture of ribonucleotides and deoxyribonucleotides. In certain embodiments, the regions of complementarity are at least 70, 80, 90, 95, 98, or 100% complementary to each other and to a target nucleic acid sequence. In certain embodiments, the region of the dsRNA that is present in a double-stranded conformation includes at least 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 50, 75, 100, 200, 500, 1000, 2000 or 5000 nucleotides or includes all of the nucleotides in a cDNA or other target nucleic acid sequence being represented in the dsRNA. In some embodiments, the dsRNA does not contain any single stranded regions, such as single stranded ends, or the dsRNA is a hairpin. In other embodiments, the dsRNA has one or more single stranded regions or overhangs. In certain embodiments, RNA/DNA hybrids include a DNA strand or region that is an antisense strand or region (e.g, has at least 70, 80, 90, 95, 98, or 100% complementarity to a target nucleic acid) and an RNA strand or region that is a sense strand or region (e.g, has at least 70, 80, 90, 95, 98, or 100% identity to a target nucleic acid), and vice versa.

In various embodiments, the RNA/DNA hybrid is made in vitro using enzymatic or chemical synthetic methods such as those described herein or those described in WO 00/63364, filed Apr. 19, 2000, or U.S. Ser. No. 60/130,377, filed Apr. 21, 1999. In other embodiments, a DNA strand synthesized in vitro is complexed with an RNA strand made in vivo or in vitro before, after, or concurrent with the transformation of the DNA strand into the cell. In yet other embodiments, the dsRNA is a single circular nucleic acid containing a sense and an antisense region, or the dsRNA includes a circular nucleic acid and either a second circular nucleic acid or a linear nucleic acid (see, for example, WO 00/63364, filed Apr. 19, 2000, or U.S. Ser. No. 60/130,377, filed Apr. 21, 1999.) Exemplary circular nucleic acids include lariat structures in which the free 5′ phosphoryl group of a nucleotide becomes linked to the 2′ hydroxyl group of another nucleotide in a loop back fashion.

In other embodiments, the dsRNA includes one or more modified nucleotides in which the 2′ position in the sugar contains a halogen (such as fluorine group) or contains an alkoxy group (such as a methoxy group) which increases the half-life of the dsRNA in vitro or in vivo compared to the corresponding dsRNA in which the corresponding 2′ position contains a hydrogen or an hydroxyl group. In yet other embodiments, the dsRNA includes one or more linkages between adjacent nucleotides other than a naturally-occurring phosphodiester linkage. Examples of such linkages include phosphoramide, phosphorothioate, and phosphorodithioate linkages. The dsRNAs may also be chemically modified nucleic acid molecules as taught in U.S. Pat. No. 6,673,661. In other embodiments, the dsRNA contains one or two capped strands, as disclosed, for example, by WO 00/63364, filed Apr. 19, 2000, or U.S. Ser. No. 60/130,377, filed Apr. 21, 1999.

In other embodiments, the dsRNA can be any of the at least partially dsRNA molecules disclosed in WO 00/63364, as well as any of the dsRNA molecules described in U.S. Provisional Application 60/399,998; and U.S. Provisional Application 60/419,532, and PCT/US2003/033466, the teaching of which is hereby incorporated by reference. Any of the dsRNAs may be expressed in vitro or in vivo using the methods described herein or standard methods, such as those described in WO 00/63364.

Occupancy

In certain embodiments, antisense compounds are not expected to result in cleavage or the target nucleic acid via RNase H or to result in cleavage or sequestration through the RISC pathway. In certain such embodiments, antisense activity may result from occupancy, wherein the presence of the hybridized antisense compound disrupts the activity of the target nucleic acid. In certain such embodiments, the antisense compound may be uniformly modified or may comprise a mix of modifications and/or modified and unmodified nucleosides.

Target Nucleic Acids, Target Regions and Nucleotide Sequences

Nucleotide sequences that encode AGT include, without limitation, the following: GENBANK Accession No. NM 000029.3 (incorporated herein as SEQ ID NO: 1), the complement of the nucleotides 24354000 to 24370100 of GENBANK Accession No. NT 167186.1 (incorporated herein as SEQ ID NO: 2), GENBANK Accession No. AK307978.1 (incorporated herein as SEQ ID NO: 3), GENBANK Accession No. AK303755.1 (incorporated herein as SEQ ID NO: 4), GENBANK Accession No. AK293507.1 (incorporated herein as SEQ ID NO: 5), and GENBANK Accession No. CR606672.1 (incorporated herein as SEQ ID NO: 6). In certain embodiments, an antisense compound described herein targets a nucleic acid sequence encoding AGT. In certain embodiments, an antisense compound described herein targets the sequence of any of SEQ ID NOs: 1-6.

It is understood that the sequence set forth in each SEQ ID NO in the examples contained herein is independent of any modification to a sugar moiety, an internucleoside linkage, or a nucleobase. As such, antisense compounds defined by a SEQ ID NO may comprise, independently, one or more modifications to a sugar moiety, an internucleoside linkage, or a nucleobase. Antisense compounds described by Isis Number (Isis No) indicate a combination of nucleobase sequence and motif.

In certain embodiments, a target region is a structurally defined region of the target nucleic acid. For example, a target region may encompass a 3′ UTR, a 5′ UTR, an exon, an intron, an exon/intron junction, a coding region, a translation initiation region, translation termination region, or other defined nucleic acid region. The structurally defined regions for AGT can be obtained by accession number from sequence databases such as NCBI and such information is incorporated herein by reference. In certain embodiments, a target region may encompass the sequence from a 5′ target site of one target segment within the target region to a 3′ target site of another target segment within the target region. In certain embodiments, a target region may encompass at least 8 consecutive nucleobases selected from within an antisense compound at least 8 consecutive nucleobases from the 5′-terminus of the antisense compound (the remaining nucleobases being a consecutive stretch the beginning immediately upstream of the 5′-terminus of the antisense compound which is specifically hybridizable to the target nucleic acid and continuing until the region contains about 8 to about 80 nucleobases). In certain embodiments, a target region may encompass at least 8 consecutive nucleobases selected from within an antisense compound at least 8 consecutive nucleobases from the 3′-terminus of the antisense compound (the remaining nucleobases being a consecutive stretch beginning immediately downstream of the 3′-terminus of the antisense compound which is specifically hybridizable to the target nucleic acid and continuing until the region contains about 8 to about 80 nucleobases). In certain embodiments, the target region comprises at least 8 consecutive nucleobases selected from any of SEQ ID NOs: 14-2051 and continues up to 80 nucleobases 5′ or 3′ of the 8 consecutive nucleobase sequence.

In certain embodiments, a “target segment” is a smaller, sub-portion of a target region within a nucleic acid. For example, a target segment can be the sequence of nucleotides of a target nucleic acid to which one or more antisense compound is targeted. “5′ target site” refers to the 5′-most nucleotide of a target segment. “3′ target site” refers to the 3′-most nucleotide of a target segment.

Targeting includes determination of at least one target segment to which an antisense compound hybridizes, such that a desired effect occurs. In certain embodiments, the desired effect is a reduction in mRNA target nucleic acid levels. In certain embodiments, the desired effect is reduction of levels of protein encoded by the target nucleic acid or a phenotypic change associated with the target nucleic acid.

A target region may contain one or more target segments. Multiple target segments within a target region may be overlapping. Alternatively, they may be non-overlapping. In certain embodiments, target segments within a target region are separated by no more than about 300 nucleotides. In certain embodiments, target segments within a target region are separated by a number of nucleotides that is, is about, is no more than, is no more than about, 250, 200, 150, 100, 90, 80, 70, 60, 50, 40, 30, 20, or 10 nucleotides on the target nucleic acid, or is a range defined by any two of the preceeding values. In certain embodiments, target segments within a target region are separated by no more than, or no more than about, 5 nucleotides on the target nucleic acid. In certain embodiments, target segments are contiguous. Contemplated are target regions defined by a range having a starting nucleic acid that is any of the 5′ target sites or 3′ target sites listed herein.

Suitable target segments may be found within a 5′ UTR, a coding region, a 3′ UTR, an intron, an exon, or an exon/intron junction. Target segments containing a start codon or a stop codon are also suitable target segments. A suitable target segment may specifically exclude a certain structurally defined region such as the start codon or stop codon.

The determination of suitable target segments may include a comparison of the sequence of a target nucleic acid to other sequences throughout the genome. For example, the BLAST algorithm may be used to identify regions of similarity amongst different nucleic acids. This comparison can prevent the selection of antisense compound sequences that may hybridize in a non-specific manner to sequences other than a selected target nucleic acid (i.e., non-target or off-target sequences).

There may be variation in activity (e.g., as defined by percent reduction of target nucleic acid levels) of the antisense compounds within an active target region. In certain embodiments, reductions in AGT mRNA levels are indicative of inhibition of AGT expression. Reductions in levels of an AGT protein are also indicative of inhibition of AGT expression. Further, phenotypic changes are indicative of inhibition of AGT expression. For example, a decrease in fibrosis in tissues can be indicative of inhibition of AGT expression. In another example, an decrease in hypertension can be indicative of inhibition of AGT expression.

Hybridization

In some embodiments, hybridization occurs between an antisense compound disclosed herein and an AGT nucleic acid. The most common mechanism of hybridization involves hydrogen bonding (e.g., Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding) between complementary nucleobases of the nucleic acid molecules.

Hybridization can occur under varying conditions. Stringent conditions are sequence-dependent and are determined by the nature and composition of the nucleic acid molecules to be hybridized.

Methods of determining whether a sequence is specifically hybridizable to a target nucleic acid are well known in the art (Sambrook and Russell, Molecular Cloning: A Laboratory Manual, 3rd Ed., 2001). In certain embodiments, the antisense compounds provided herein are specifically hybridizable with an AGT nucleic acid.

Complementarity

An antisense compound and a target nucleic acid are complementary to each other when a sufficient number of nucleobases of the antisense compound can hydrogen bond with the corresponding nucleobases of the target nucleic acid, such that a desired effect will occur (e.g., antisense inhibition of a target nucleic acid, such as an AGT nucleic acid).

Non-complementary nucleobases between an antisense compound and an AGT nucleic acid may be tolerated provided that the antisense compound remains able to specifically hybridize to the AGT nucleic acid. Moreover, an antisense compound may hybridize over one or more segments of an AGT nucleic acid such that intervening or adjacent segments are not involved in the hybridization event (e.g., a loop structure, mismatch or hairpin structure).

In certain embodiments, the antisense compounds provided herein, or a specified portion thereof, are, or are at least 70%, at least 80%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% complementary to an AGT nucleic acid, a target region, target segment, or specified portion thereof. Percent complementarity of an antisense compound with a target nucleic acid can be determined using routine methods. For example, an antisense compound in which 18 of 20 nucleobases of the antisense compound are complementary to a target region, and would therefore specifically hybridize, would represent 90 percent complementarity. In this example, the remaining noncomplementary nucleobases may be clustered or interspersed with complementary nucleobases and need not be contiguous to each other or to complementary nucleobases. As such, an antisense compound which is 18 nucleobases in length having 4 (four) noncomplementary nucleobases which are flanked by two regions of complete complementarity with the target nucleic acid would have 77.8% overall complementarity with the target nucleic acid and would thus fall within the scope of the present invention.

Percent complementarity of an antisense compound with a region of a target nucleic acid can be determined routinely using BLAST programs (basic local alignment search tools) and PowerBLAST programs known in the art (Altschul et al., J. Mol. Biol., 1990, 215, 403 410; Zhang and Madden, Genome Res., 1997, 7, 649 656). Percent homology, sequence identity or complementarity, can be determined by, for example, the Gap program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, Madison Wis.), using default settings, which uses the algorithm of Smith and Waterman (Adv. Appl. Math., 1981, 2, 482 489).

In certain embodiments, the antisense compounds provided herein, or specified portions thereof, are fully complementary (i.e. 100% complementary) to a target nucleic acid, or specified portion thereof. For example, antisense compound may be fully complementary to an AGT nucleic acid, or a target region, or a target segment or target sequence thereof. As used herein, “fully complementary” means each nucleobase of an antisense compound is capable of precise base pairing with the corresponding nucleobases of a target nucleic acid. For example, a 20 nucleobase antisense compound is fully complementary to a target sequence that is 400 nucleobases long, so long as there is a corresponding 20 nucleobase portion of the target nucleic acid that is fully complementary to the antisense compound. Fully complementary can also be used in reference to a specified portion of the first and/or the second nucleic acid. For example, a 20 nucleobase portion of a 30 nucleobase antisense compound can be “fully complementary” to a target sequence that is 400 nucleobases long. The 20 nucleobase portion of the 30 nucleobase oligonucleotide is fully complementary to the target sequence if the target sequence has a corresponding 20 nucleobase portion wherein each nucleobase is complementary to the 20 nucleobase portion of the antisense compound. At the same time, the entire 30 nucleobase antisense compound may or may not be fully complementary to the target sequence, depending on whether the remaining 10 nucleobases of the antisense compound are also complementary to the target sequence.

The location of a non-complementary nucleobase may be at the 5′ end or 3′ end of the antisense compound. Alternatively, the non-complementary nucleobase or nucleobases may be at an internal position of the antisense compound. When two or more non-complementary nucleobases are present, they may be contiguous (i.e. linked) or non-contiguous. In one embodiment, a non-complementary nucleobase is located in the wing segment of a gapmer antisense oligonucleotide.

In certain embodiments, antisense compounds that are, or are up to, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleobases in length comprise no more than 4, no more than 3, no more than 2, or no more than 1 non-complementary nucleobase(s) relative to a target nucleic acid, such as an AGT nucleic acid, or specified portion thereof.

In certain embodiments, antisense compounds that are, or are up to, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleobases in length comprise no more than 6, no more than 5, no more than 4, no more than 3, no more than 2, or no more than 1 non-complementary nucleobase(s) relative to a target nucleic acid, such as an AGT nucleic acid, or specified portion thereof.

The antisense compounds provided herein also include those which are complementary to a portion of a target nucleic acid. As used herein, “portion” refers to a defined number of contiguous (i.e. linked) nucleobases within a region or segment of a target nucleic acid. A “portion” can also refer to a defined number of contiguous nucleobases of an antisense compound. In certain embodiments, the antisense compounds, are complementary to at least an 8 nucleobase portion of a target segment. In certain embodiments, the antisense compounds are complementary to at least a 12 nucleobase portion of a target segment. In certain embodiments, the antisense compounds are complementary to at least a 15 nucleobase portion of a target segment. Also contemplated are antisense compounds that are complementary to at least a 9, at least a 10, at least an 11, at least a 12, at least a 13, at least a 14, at least a 15, at least a 16, at least a 17, at least an 18, at least a 19, at least a 20, or more nucleobase portion of a target segment, or a range defined by any two of these values.

Identity

The antisense compounds provided herein may also have a defined percent identity to a particular nucleotide sequence, SEQ ID NO, or compound represented by a specific Isis number, or portion thereof. As used herein, an antisense compound is identical to the sequence disclosed herein if it has the same nucleobase pairing ability. For example, a RNA which contains uracil in place of thymidine in a disclosed DNA sequence would be considered identical to the DNA sequence since both uracil and thymidine pair with adenine. Shortened and lengthened versions of the antisense compounds described herein as well as compounds having non-identical bases relative to the antisense compounds provided herein also are contemplated. The non-identical bases may be adjacent to each other or dispersed throughout the antisense compound. Percent identity of an antisense compound is calculated according to the number of bases that have identical base pairing relative to the sequence to which it is being compared.

In certain embodiments, the antisense compounds, or portions thereof, are at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% identical to one or more of the antisense compounds or SEQ ID NOs, or a portion thereof, disclosed herein.

Modifications

A nucleoside is a base-sugar combination. The nucleobase (also known as base) portion of the nucleoside is normally a heterocyclic base moiety. Nucleotides are nucleosides that further include a phosphate group covalently linked to the sugar portion of the nucleoside. For those nucleosides that include a pentofuranosyl sugar, the phosphate group can be linked to the 2′, 3′ or 5′ hydroxyl moiety of the sugar. Oligonucleotides are formed through the covalent linkage of adjacent nucleosides to one another, to form a linear polymeric oligonucleotide. Within the oligonucleotide structure, the phosphate groups are commonly referred to as forming the internucleoside linkages of the oligonucleotide.

Modifications to antisense compounds encompass substitutions or changes to internucleoside linkages, sugar moieties, or nucleobases. Modified antisense compounds are often preferred over native forms because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for nucleic acid target, increased stability in the presence of nucleases, or increased inhibitory activity.

Chemically modified nucleosides may also be employed to increase the binding affinity of a shortened or truncated antisense oligonucleotide for its target nucleic acid. Consequently, comparable results can often be obtained with shorter antisense compounds that have such chemically modified nucleosides.

Modified Internucleoside Linkages

The naturally occurring internucleoside linkage of RNA and DNA is a 3′ to 5′ phosphodiester linkage. Antisense compounds having one or more modified, i.e. non-naturally occurring, internucleoside linkages are often selected over antisense compounds having naturally occurring internucleoside linkages because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for target nucleic acids, and increased stability in the presence of nucleases.

Oligonucleotides having modified internucleoside linkages include internucleoside linkages that retain a phosphorus atom as well as internucleoside linkages that do not have a phosphorus atom. Representative phosphorus containing internucleoside linkages include, but are not limited to, phosphodiesters, phosphotriesters, methylphosphonates, phosphoramidate, and phosphorothioates. Methods of preparation of phosphorous-containing and non-phosphorous-containing linkages are well known.

In certain embodiments, antisense compounds targeted to an AGT nucleic acid comprise one or more modified internucleoside linkages. In certain embodiments, at least one of the modified internucleoside linkages are phosphorothioate linkages. In certain embodiments, each internucleoside linkage of an antisense compound is a phosphorothioate internucleoside linkage.

Modified Sugar Moieties

Antisense compounds of the invention can optionally contain one or more nucleosides wherein the sugar group has been modified. Such sugar modified nucleosides may impart enhanced nuclease stability, increased binding affinity, or some other beneficial biological property to the antisense compounds. In certain embodiments, nucleosides comprise chemically modified ribofuranose ring moieties. Examples of chemically modified ribofuranose rings include without limitation, addition of substitutent groups (including 5′ and 2′ substituent groups, bridging of non-geminal ring atoms to form bicyclic nucleic acids (BNA), replacement of the ribosyl ring oxygen atom with S, N(R), or C(R1)(R2) (R, R1 and R2 are each independently H, C1-C12 alkyl or a protecting group) and combinations thereof. Examples of chemically modified sugars include 2′-F-5′-methyl substituted nucleoside (see PCT International Application WO 2008/101157 Published on Aug. 21, 2008 for other disclosed 5′,2′-bis substituted nucleosides) or replacement of the ribosyl ring oxygen atom with S with further substitution at the 2′-position (see published U.S. Patent Application US2005-0130923, published on Jun. 16, 2005) or alternatively 5′-substitution of a BNA (see PCT International Application WO 2007/134181 Published on Nov. 22, 2007 wherein LNA is substituted with for example a 5′-methyl or a 5′-vinyl group).

Examples of nucleosides having modified sugar moieties include without limitation nucleosides comprising 5′-vinyl, 5′-methyl (R or S), 4′-S, 2′-F, 2′-OCH3, 2′-OCH2CH3, 2′-OCH2CH2F and 2′-O(CH2)2OCH3 substituent groups. The substituent at the 2′ position can also be selected from allyl, amino, azido, thio, O-allyl, O—C1-C10 alkyl, OCF3, OCH2F, O(CH2)2SCH3, O(CH2)2—O—N(Rm)(Rn), O—CH2—C(═O)—N(Rm)(Rn), and O—CH2—C(═O)—N(R1)—(CH2)2—N(Rm)(Rn), where each R1, Rm and Rn is, independently, H or substituted or unsubstituted C1-C10 alkyl.

As used herein, “bicyclic nucleosides” refer to modified nucleosides comprising a bicyclic sugar moiety. Examples of bicyclic nucleic acids (BNAs) include without limitation nucleosides comprising a bridge between the 4′ and the 2′ ribosyl ring atoms. In certain embodiments, antisense compounds provided herein include one or more BNA nucleosides wherein the bridge comprises one of the formulas: 4′-(CH2)—O-2′ (LNA); 4′-(CH2)—S-2; 4′-(CH2)2—O-2′ (ENA); 4′-CH(CH3)—O-2′ (cEt) and 4′-CH(CH2OCH3)—O-2′ (and analogs thereof see U.S. Pat. No. 7,399,845, issued on Jul. 15, 2008); 4′-C(CH3)(CH3)—O-2′ (and analogs thereof see PCT/US2008/068922 published as WO/2009/006478, published Jan. 8, 2009); 4′-CH2—N(OCH3)-2′ (and analogs thereof see PCT/US2008/064591 published as WO/2008/150729, published Dec. 11, 2008); 4′-CH2—O—N(CH3)-2′ (see published U.S. Patent Application US2004-0171570, published Sep. 2, 2004); 4′-CH2—N(R)—O-2′, wherein R is H, C1-C12 alkyl, or a protecting group (see U.S. Pat. No. 7,427,672, issued on Sep. 23, 2008); 4′-CH2—C(H)(CH3)-2′ (see Zhou et al., J. Org. Chem., 2009, 74, 118-134); and 4′-CH2—C(═CH2)-2′ (and analogs thereof see PCT/US2008/066154 published as WO 2008/154401, published on Dec. 8, 2008).

Further bicyclic nucleosides have been reported in published literature (see for example: Srivastava et al., J. Am. Chem. Soc., 2007, 129(26) 8362-8379; Frieden et al., Nucleic Acids Research, 2003, 21, 6365-6372; Elayadi et al., Curr. Opinion Invens. Drugs, 2001, 2, 558-561; Braasch et al., Chem. Biol., 2001, 8, 1-7; Orum et al., Curr. Opinion Mol. Ther., 2001, 3, 239-243; Wahlestedt et al., Proc. Natl. Acad. Sci. U S. A., 2000, 97, 5633-5638; Singh et al., Chem. Commun., 1998, 4, 455-456; Koshkin et al., Tetrahedron, 1998, 54, 3607-3630; Kumar et al., Bioorg. Med. Chem. Lett., 1998, 8, 2219-2222; Singh et al., J. Org. Chem., 1998, 63, 10035-10039; U.S. Pat. Nos. 7,399,845; 7,053,207; 7,034,133; 6,794,499; 6,770,748; 6,670,461; 6,525,191; 6,268,490; U.S. Patent Publication Nos.: US2008-0039618; US2007-0287831; US2004-0171570; U.S. patent application Ser. Nos. 12/129,154; 61/099,844; 61/097,787; 61/086,231; 61/056,564; 61/026,998; 61/026,995; 60/989,574; International applications WO 2007/134181; WO 2005/021570; WO 2004/106356; WO 99/14226; and PCT International Applications Nos.: PCT/US2008/068922; PCT/US-2008/066154; and PCT/US2008/064591). Each of the foregoing bicyclic nucleosides can be prepared having one or more stereochemical sugar configurations including for example α-L-ribofuranose and β-D-ribofuranose (see PCT international application PCT/DK98/00393, published on Mar. 25, 1999 as WO 99/14226).

As used herein, “monocyclic nucleosides” refer to nucleosides comprising modified sugar moieties that are not bicyclic sugar moieties. In certain embodiments, the sugar moiety, or sugar moiety analogue, of a nucleoside may be modified or substituted at any position.

As used herein, “4′-2′ bicyclic nucleoside” or “4′ to 2′ bicyclic nucleoside” refers to a bicyclic nucleoside comprising a furanose ring comprising a bridge connecting two carbon atoms of the furanose ring connects the 2′ carbon atom and the 4′ carbon atom of the sugar ring.

In certain embodiments, bicyclic sugar moieties of BNA nucleosides include, but are not limited to, compounds having at least one bridge between the 4′ and the 2′ carbon atoms of the pentofuranosyl sugar moiety including without limitation, bridges comprising 1 or from 1 to 4 linked groups independently selected from —[C(Ra)(Rb)]n—, —C(Ra)═C(Rb)—, —C(Ra)═N—, —C(═NRa)—, —C(═O)—, —C(═S)—, —O—, —Si(Ra)2—, —S(═O)x—, and —N(Ra)—; wherein: x is 0, 1, or 2; n is 1, 2, 3, or 4; each Ra and Rb, is, independently, H, a protecting group, hydroxyl, C1-C12 alkyl, substituted C1-C12 alkyl, C2-C12 alkenyl, substituted C2-C12 alkenyl, C2-C12 alkynyl, substituted C2-C12 alkynyl, C5-C20 aryl, substituted C5-C20 aryl, heterocycle radical, substituted heterocycle radical, heteroaryl, substituted heteroaryl, C5-C7 alicyclic radical, substituted C5-C7 alicyclic radical, halogen, OJ1, NJ1J2, SJ1, N3, COOJ1, acyl (C(═O)—H), substituted acyl, CN, sulfonyl (S(═O)2-J1), or sulfoxyl (S(═O)-J1); and each J1 and J2 is, independently, H, C1-C12 alkyl, substituted C1-C12 alkyl, C2-C12 alkenyl, substituted C2-C12 alkenyl, C2-C12 alkynyl, substituted C2-C12 alkynyl, C5-C20 aryl, substituted C5-C20 aryl, acyl (C(═O)—H), substituted acyl, a heterocycle radical, a substituted heterocycle radical, C1-C12 aminoalkyl, substituted C1-C12 aminoalkyl or a protecting group.

In certain embodiments, the bridge of a bicyclic sugar moiety is,  [C(Ra)(Rb)]n—, —[C(Ra)(Rb)]n—O—, —C(RaRb)—N(R)—O— or —C(RaRb)—O—N(R)—. In certain embodiments, the bridge is 4′-CH2-2′, 4′-(CH2)2-2′, 4′-(CH2)3-2′, 4′-CH2—O-2′, 4′-(CH2)2—O-2′, 4′-CH2—O—N(R)-2′ and 4′-CH2—N(R)—O-2′- wherein each R is, independently, H, a protecting group or C1-C12 alkyl.

In certain embodiments, bicyclic nucleosides are further defined by isomeric configuration. For example, a nucleoside comprising a 4′-(CH2)—O-2′ bridge, may be in the α-L configuration or in the β-D configuration. Previously, α-L-methyleneoxy (4′-CH2—O-2′) BNA's have been incorporated into antisense oligonucleotides that showed antisense activity (Frieden et al., Nucleic Acids Research, 2003, 21, 6365-6372).

In certain embodiments, bicyclic nucleosides include those having a 4′ to 2′ bridge wherein such bridges include without limitation, α-L-4′-(CH2)—O-2′, β-D-4′-CH2—O-2′, 4′-(CH2)2—O-2′, 4′-CH2—O—N(R)-2′, 4′-CH2—N(R)—O-2′, 4′-CH(CH3)—O-2′, 4′-CH2—S-2′, 4′-CH2—N(R)-2′, 4′-CH2—CH(CH3)-2′, and 4′-(CH2)3-2′, wherein R is H, a protecting group or C1-C12 alkyl.

In certain embodiment, bicyclic nucleosides have the formula:

wherein:

Bx is a heterocyclic base moiety;

-Qa-Qb-Qc- is —CH2—N(Rc)—CH2—, —C(═O)—N(Rc)—CH2—, —CH2—O—N(Rc)—, —CH2—N(Rc)—O— or —N(Rc)—O—CH2;

Rc is C1-C12 alkyl or an amino protecting group; and

Ta and Tb are each, independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety or a covalent attachment to a support medium.

In certain embodiments, bicyclic nucleosides have the formula:

wherein:

Bx is a heterocyclic base moiety;

Ta and Tb are each, independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety or a covalent attachment to a support medium;

Za is C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, substituted C1-C6 alkyl, substituted C2-C6 alkenyl, substituted C2-C6 alkynyl, acyl, substituted acyl, substituted amide, thiol or substituted thiol.

In one embodiment, each of the substituted groups, is, independently, mono or poly substituted with substituent groups independently selected from halogen, oxo, hydroxyl, OJc, NJcJd, SJc, N3, OC(═X)Jc, and NJeC(═X)NJcJd, wherein each Jc, Jd and Je is, independently, H, C1-C6 alkyl, or substituted C1-C6 alkyl and X is O or NJc.

In certain embodiments, bicyclic nucleosides have the formula:

wherein:

Bx is a heterocyclic base moiety;

Ta and Tb are each, independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety or a covalent attachment to a support medium;

Zb is C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, substituted C1-C6 alkyl, substituted C2-C6 alkenyl, substituted C2-C6 alkynyl or substituted acyl (C(═O)—).

In certain embodiments, bicyclic nucleosides have the formula:

wherein:

Bx is a heterocyclic base moiety;

Ta and Tb are each, independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety or a covalent attachment to a support medium;

Rd is C1-C6 alkyl, substituted C1-C6 alkyl, C2-C6 alkenyl, substituted C2-C6 alkenyl, C2-C6 alkynyl or substituted C2-C6 alkynyl;

each qa, qb, qc and qd is, independently, H, halogen, C1-C6 alkyl, substituted C1-C6 alkyl, C2-C6 alkenyl, substituted C2-C6 alkenyl, C2-C6 alkynyl or substituted C2-C6 alkynyl, C1-C6 alkoxyl, substituted C1-C6 alkoxyl, acyl, substituted acyl, C1-C6 aminoalkyl or substituted C1-C6 aminoalkyl;

In certain embodiments, bicyclic nucleosides have the formula:

wherein:

Bx is a heterocyclic base moiety;

Ta and Tb are each, independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety or a covalent attachment to a support medium;

qa, qb, qc and qd are each, independently, hydrogen, halogen, C1-C12 alkyl, substituted C1-C12 alkyl, C1-C12 alkenyl, substituted C2-C12 alkenyl, C2-C12 alkynyl, substituted C2-C12 alkynyl, C1-C12 alkoxy, substituted C1-C12 alkoxy, OJj, SJj, SOJj, SO2Jj, NJjJk, N3, CN, C(═O)OJj, C(═O)NJjJk, C(═O)Jj, O—C(═O)NJjJk, N(H)C(═NH)NJjJk, N(H)C(═O)NJjJk or N(H)C(═S)NJjJk;

or qe and qf together are ═C(qg)(qh);

qg and qh are each, independently, H, halogen, C1-C12 alkyl or substituted C1-C12 alkyl.

The synthesis and preparation of adenine, cytosine, guanine, 5-methyl-cytosine, thymine and uracil bicyclic nucleosides having a 4′-CH2—O-2′ bridge, along with their oligomerization, and nucleic acid recognition properties have been described (Koshkin et al., Tetrahedron, 1998, 54, 3607-3630). The synthesis of bicyclic nucleosides has also been described in WO 98/39352 and WO 99/14226.

Analogs of various bicyclic nucleosides that have 4′ to 2′ bridging groups such as 4′-CH2—O-2′ and 4′-CH2—S-2′, have also been prepared (Kumar et al., Bioorg. Med. Chem. Lett., 1998, 8, 2219-2222). Preparation of oligodeoxyribonucleotide duplexes comprising bicyclic nucleosides for use as substrates for nucleic acid polymerases has also been described (Wengel et al., WO 99/14226). Furthermore, synthesis of 2′-amino-BNA, a novel conformationally restricted high-affinity oligonucleotide analog has been described in the art (Singh et al., J. Org. Chem., 1998, 63, 10035-10039). In addition, 2′-amino- and 2′-methylamino-BNA's have been prepared and the thermal stability of their duplexes with complementary RNA and DNA strands has been previously reported.

In certain embodiments, bicyclic nucleosides have the formula:

wherein:

Bx is a heterocyclic base moiety;

Ta and Tb are each, independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety or a covalent attachment to a support medium;

    • each qi, qj, qk and ql is, independently, H, halogen, C1-C12 alkyl, substituted C1-C12 alkyl, C2-C12 alkenyl, substituted C2-C12 alkenyl, C2-C12 alkynyl, substituted C2-C12 alkynyl, C1-C12 alkoxyl, substituted C1-C12 alkoxyl, OJj, SJj, SOJj, SO2Jj, NJjJk, N3, CN, C(═O)OJj, C(═O)NJjJk, C(═O)Jj, O—C(═O)NJjJk, N(H)C(═NH)NJjJk, N(H)C(═O)NJjJk or N(H)C(═S)NJjJk; and

qi and qj or ql and qk together are ═C(qg)(qh), wherein qg and qh are each, independently, H, halogen, C1-C12 alkyl or substituted C1-C12 alkyl.

One carbocyclic bicyclic nucleoside having a 4′-(CH2)3-2′ bridge and the alkenyl analog bridge 4′-CH═CH—CH2-2′ have been described (Frier et al., Nucleic Acids Research, 1997, 25(22), 4429-4443 and Albaek et al., J. Org. Chem., 2006, 71, 7731-7740). The synthesis and preparation of carbocyclic bicyclic nucleosides along with their oligomerization and biochemical studies have also been described (Srivastava et al., J. Am. Chem. Soc. 2007, 129(26), 8362-8379).

In certain embodiments, bicyclic nucleosides include, but are not limited to, (A) α-L-methyleneoxy (4′-CH2—O-2′) BNA, (B) β-D-methyleneoxy (4′-CH2—O-2′) BNA, (C) ethyleneoxy (4′-(CH2)2—O-2′) BNA, (D) aminooxy (4′-CH2—O—N(R)-2′) BNA, (E) oxyamino (4′-CH2—N(R)—O-2′) BNA, (F) methyl(methyleneoxy) (4′-CH(CH3)—O-2′) BNA (also referred to as constrained ethyl or cEt), (G) methylene-thio (4′-CH2—S-2′) BNA, (H) methylene-amino (4′-CH2—N(R)-2′) BNA, (I) methyl carbocyclic (4′-CH2—CH(CH3)-2′) BNA, (J) propylene carbocyclic (4′-(CH2)3-2′) BNA, and (K) vinyl BNA as depicted below.

wherein Bx is the base moiety and R is, independently, H, a protecting group, C1-C6 alkyl or C1-C6 alkoxy.

As used herein, the term “modified tetrahydropyran nucleoside” or “modified THP nucleoside” means a nucleoside having a six-membered tetrahydropyran “sugar” substituted for the pentofuranosyl residue in normal nucleosides and can be referred to as a sugar surrogate. Modified THP nucleosides include, but are not limited to, what is referred to in the art as hexitol nucleic acid (HNA), anitol nucleic acid (ANA), manitol nucleic acid (MNA) (see Leumann, Bioorg. Med. Chem., 2002, 10, 841-854) or fluoro HNA (F-HNA) having a tetrahydropyranyl ring system as illustrated below.

In certain embodiment, sugar surrogates are selected having the formula:

wherein:

Bx is a heterocyclic base moiety;

T3 and T4 are each, independently, an internucleoside linking group linking the tetrahydropyran nucleoside analog to the oligomeric compound or one of T3 and T4 is an internucleoside linking group linking the tetrahydropyran nucleoside analog to an oligomeric compound or oligonucleotide and the other of T3 and T4 is H, a hydroxyl protecting group, a linked conjugate group or a 5′ or 3′-terminal group;

q1, q2, q3, q4, q5, q6 and q7 are each independently, H, C1-C6 alkyl, substituted C1-C6 alkyl, C2-C6 alkenyl, substituted C2-C6 alkenyl, C2-C6 alkynyl or substituted C2-C6 alkynyl; and

one of R1 and R2 is hydrogen and the other is selected from halogen, substituted or unsubstituted alkoxy, NJ1J2, SJ1, N3, OC(═X)J1, OC(═X)NJ1J2, NJ3C(═X)NJ1J2 and CN, wherein X is O, S or NJ1 and each J1, J2 and J3 is, independently, H or C1-C6 alkyl.

In certain embodiments, q1, q2, q3, q4, q5, q6 and q7 are each H. In certain embodiments, at least one of q1, q2, q3, q4, q5, q6 and q7 is other than H. In certain embodiments, at least one of q1, q2, q3, q4, q5, q6 and q7 is methyl. In certain embodiments, THP nucleosides are provided wherein one of R1 and R2 is F. In certain embodiments, R1 is fluoro and R2 is H; R1 is methoxy and R2 is H, and R1 is methoxyethoxy and R2 is H.

In certain embodiments, sugar surrogates comprise rings having more than 5 atoms and more than one heteroatom. For example nucleosides comprising morpholino sugar moieties and their use in oligomeric compounds has been reported (see for example: Braasch et al., Biochemistry, 2002, 41, 4503-4510; and U.S. Pat. Nos. 5,698,685; 5,166,315; 5,185,444; and 5,034,506). As used here, the term “morpholino” means a sugar surrogate having the following formula:

In certain embodiments, morpholinos may be modified, for example by adding or altering various substituent groups from the above morpholino structure. Such sugar surrogates are referred to herein as “modified morpholinos.”

Combinations of modifications are also provided without limitation, such as 2′-F-5′-methyl substituted nucleosides (see PCT International Application WO 2008/101157 published on Aug. 21, 2008 for other disclosed 5′, 2′-bis substituted nucleosides) and replacement of the ribosyl ring oxygen atom with S and further substitution at the 2′-position (see published U.S. Patent Application US2005-0130923, published on Jun. 16, 2005) or alternatively 5′-substitution of a bicyclic nucleic acid (see PCT International Application WO 2007/134181, published on Nov. 22, 2007 wherein a 4′-CH2—O-2′ bicyclic nucleoside is further substituted at the 5′ position with a 5′-methyl or a 5′-vinyl group). The synthesis and preparation of carbocyclic bicyclic nucleosides along with their oligomerization and biochemical studies have also been described (see, e.g., Srivastava et al., J. Am. Chem. Soc. 2007, 129(26), 8362-8379).

In certain embodiments, antisense compounds comprise one or more modified cyclohexenyl nucleosides, which is a nucleoside having a six-membered cyclohexenyl in place of the pentofuranosyl residue in naturally occurring nucleosides. Modified cyclohexenyl nucleosides include, but are not limited to those described in the art (see for example commonly owned, published PCT Application WO 2010/036696, published on Apr. 10, 2010, Robeyns et al., J. Am. Chem. Soc., 2008, 130(6), 1979-1984; Horvath et al., Tetrahedron Letters, 2007, 48, 3621-3623; Nauwelaerts et al., J. Am. Chem. Soc., 2007, 129(30), 9340-9348; Gu et al., Nucleosides, Nucleotides & Nucleic Acids, 2005, 24(5-7), 993-998; Nauwelaerts et al., Nucleic Acids Research, 2005, 33(8), 2452-2463; Robeyns et al., Acta Crystallographica, Section F: Structural Biology and Crystallization Communications, 2005, F61(6), 585-586; Gu et al., Tetrahedron, 2004, 60(9), 2111-2123; Gu et al., Oligonucleotides, 2003, 13(6), 479-489; Wang et al., J. Org. Chem., 2003, 68, 4499-4505; Verbeure et al., Nucleic Acids Research, 2001, 29(24), 4941-4947; Wang et al., J. Org. Chem., 2001, 66, 8478-82; Wang et al., Nucleosides, Nucleotides & Nucleic Acids, 2001, 20(4-7), 785-788; Wang et al., J. Am. Chem., 2000, 122, 8595-8602; Published PCT application, WO 06/047842; and Published PCT Application WO 01/049687; the text of each is incorporated by reference herein, in their entirety). Certain modified cyclohexenyl nucleosides have Formula X.

wherein independently for each of said at least one cyclohexenyl nucleoside analog of Formula X:

Bx is a heterocyclic base moiety;

T3 and T4 are each, independently, an internucleoside linking group linking the cyclohexenyl nucleoside analog to an antisense compound or one of T3 and T4 is an internucleoside linking group linking the tetrahydropyran nucleoside analog to an antisense compound and the other of T3 and T4 is H, a hydroxyl protecting group, a linked conjugate group, or a 5′- or 3′-terminal group; and q1, q2, q3, q4, q5, q6, q7, q8 and q9 are each, independently, H, C1-C6 alkyl, substituted C1-C6 alkyl, C2-C6 alkenyl, substituted C2-C6 alkenyl, C2-C6 alkynyl, substituted C2-C6 alkynyl or other sugar substituent group.

Many other monocyclic, bicyclic and tricyclic ring systems are known in the art and are suitable as sugar surrogates that can be used to modify nucleosides for incorporation into oligomeric compounds as provided herein (see for example review article: Leumann, Christian J. Bioorg. & Med. Chem., 2002, 10, 841-854). Such ring systems can undergo various additional substitutions to further enhance their activity.

As used herein, “2′-modified sugar” means a furanosyl sugar modified at the 2′ position. In certain embodiments, such modifications include substituents selected from: a halide, including, but not limited to substituted and unsubstituted alkoxy, substituted and unsubstituted thioalkyl, substituted and unsubstituted amino alkyl, substituted and unsubstituted alkyl, substituted and unsubstituted allyl, and substituted and unsubstituted alkynyl. In certain embodiments, 2′ modifications are selected from substituents including, but not limited to: O[(CH2)nO]mCH3, O(CH2)nNH2, O(CH2)nCH3, O(CH2)nF, O(CH2)nONH2, OCH2C(═O)N(H)CH3, and O(CH2)nON[(CH2)nCH3]2, where n and m are from 1 to about 10. Other 2′-substituent groups can also be selected from: C1-C12 alkyl, substituted alkyl, alkenyl, alkynyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH3, OCN, Cl, Br, CN, F, CF3, OCF3, SOCH3, SO2CH3, ONO2, NO2, N3, NH2, heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted silyl, an RNA cleaving group, a reporter group, an intercalator, a group for improving pharmacokinetic properties, or a group for improving the pharmacodynamic properties of an antisense compound, and other substituents having similar properties. In certain embodiments, modified nucleosides comprise a 2′-MOE side chain (Baker et al., J. Biol. Chem., 1997, 272, 11944-12000). Such 2′-MOE substitution have been described as having improved binding affinity compared to unmodified nucleosides and to other modified nucleosides, such as 2′-O-methyl, O-propyl, and O-aminopropyl. Oligonucleotides having the 2′-MOE substituent also have been shown to be antisense inhibitors of gene expression with promising features for in vivo use (Martin, Helv. Chim. Acta, 1995, 78, 486-504; Altmann et al., Chimia, 1996, 50, 168-176; Altmann et al., Biochem. Soc. Trans., 1996, 24, 630-637; and Altmann et al., Nucleosides Nucleotides, 1997, 16, 917-926).

As used herein, “2′-modified” or “2′-substituted” refers to a nucleoside comprising a sugar comprising a substituent at the 2′ position other than H or OH. 2′-modified nucleosides, include, but are not limited to, nucleosides with non-bridging 2′substituents, such as allyl, amino, azido, thio, O-allyl, O—C1-C10 alkyl, —OCF3, O—(CH2)2—O—CH3, 2′-O(CH2)2SCH3, O—(CH2)2—O—N(Rm)(Rn), or O—CH2—C(═O)—N(Rm)(Rn), where each Rm and R11 is, independently, H or substituted or unsubstituted C1-C10 alkyl. 2′-modified nucleosides may further comprise other modifications, for example at other positions of the sugar and/or at the nucleobase.

As used herein, “2′-F” refers to a nucleoside comprising a sugar comprising a fluoro group at the 2′ position of the sugar ring.

As used herein, “2′-OMe” or “2′-OCH3”, “2′-O-methyl” or “2′-methoxy” each refers to a nucleoside comprising a sugar comprising an —OCH3 group at the 2′ position of the sugar ring.

As used herein, “MOE” or “2′-MOE” or “2′-OCH2CH2OCH3” or “2′-O-methoxyethyl” each refers to a nucleoside comprising a sugar comprising a —OCH2CH2OCH3 group at the 2′ position of the sugar ring.

Methods for the preparations of modified sugars are well known to those skilled in the art. Some representative U.S. patents that teach the preparation of such modified sugars include without limitation, U.S.: 4,981,957; 5,118,800; 5,319,080; 5,359,044; 5,393,878; 5,446,137; 5,466,786; 5,514,785; 5,519,134; 5,567,811; 5,576,427; 5,591,722; 5,597,909; 5,610,300; 5,627,053; 5,639,873; 5,646,265; 5,670,633; 5,700,920; 5,792,847 and 6,600,032 and International Application PCT/US2005/019219, filed Jun. 2, 2005 and published as WO 2005/121371 on Dec. 22, 2005, and each of which is herein incorporated by reference in its entirety.

As used herein, “oligonucleotide” refers to a compound comprising a plurality of linked nucleosides. In certain embodiments, one or more of the plurality of nucleosides is modified. In certain embodiments, an oligonucleotide comprises one or more ribonucleosides (RNA) and/or deoxyribonucleosides (DNA).

In nucleotides having modified sugar moieties, the nucleobase moieties (natural, modified or a combination thereof) are maintained for hybridization with an appropriate nucleic acid target.

In certain embodiments, antisense compounds comprise one or more nucleosides having modified sugar moieties. In certain embodiments, the modified sugar moiety is 2′-MOE. In certain embodiments, the 2′-MOE modified nucleosides are arranged in a gapmer motif. In certain embodiments, the modified sugar moiety is a bicyclic nucleoside having a (4′-CH(CH3)—O-2′) bridging group. In certain embodiments, the (4′-CH(CH3)—O-2′) modified nucleosides are arranged throughout the wings of a gapmer motif.

Modified Nucleobases

Nucleobase (or base) modifications or substitutions are structurally distinguishable from, yet functionally interchangeable with, naturally occurring or synthetic unmodified nucleobases. Both natural and modified nucleobases are capable of participating in hydrogen bonding. Such nucleobase modifications may impart nuclease stability, binding affinity or some other beneficial biological property to antisense compounds. Modified nucleobases include synthetic and natural nucleobases such as, for example, 5-methylcytosine (5-me-C). Certain nucleobase substitutions, including 5-methylcytosine substitutions, are particularly useful for increasing the binding affinity of an antisense compound for a target nucleic acid. For example, 5-methylcytosine substitutions have been shown to increase nucleic acid duplex stability by 0.6-1.2° C. (Sanghvi, Y. S., Crooke, S. T. and Lebleu, B., eds., Antisense Research and Applications, CRC Press, Boca Raton, 1993, pp. 276-278).

Additional unmodified nucleobases include 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyl (—C═C—CH3) uracil and cytosine and other alkynyl derivatives of pyrimidine bases, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo particularly 5-bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 2-F-adenine, 2-amino-adenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and 7-deazaadenine and 3-deazaguanine and 3-deazaadenine.

Heterocyclic base moieties may also include those in which the purine or pyrimidine base is replaced with other heterocycles, for example 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine and 2-pyridone. Nucleobases that are particularly useful for increasing the binding affinity of antisense compounds include 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and O-6 substituted purines, including 2 aminopropyladenine, 5-propynyluracil and 5-propynylcytosine.

In certain embodiments, antisense compounds targeted to an AGT nucleic acid comprise one or more modified nucleobases. In certain embodiments, gap-widened antisense oligonucleotides targeted to an AGT nucleic acid comprise one or more modified nucleobases. In certain embodiments, at least one of the modified nucleobases is 5-methylcytosine. In certain embodiments, each cytosine is a 5-methylcytosine.

Compositions and Methods for Formulating Pharmaceutical Compositions

Antisense oligonucleotides may be admixed with pharmaceutically acceptable active or inert substance for the preparation of pharmaceutical compositions or formulations. Compositions and methods for the formulation of pharmaceutical compositions are dependent upon a number of criteria, including, but not limited to, route of administration, extent of disease, or dose to be administered.

Antisense compound targeted to an AGT nucleic acid can be utilized in pharmaceutical compositions by combining the antisense compound with a suitable pharmaceutically acceptable diluent or carrier. A pharmaceutically acceptable diluent includes water e.g., water-for-injection (WFI). A pharmaceutically acceptable diluent includes saline e.g., phosphate-buffered saline (PBS). Water or saline is a diluent suitable for use in compositions to be delivered parenterally. Accordingly, in one embodiment, employed in the methods described herein is a pharmaceutical composition comprising an antisense compound targeted to an AGT nucleic acid and a pharmaceutically acceptable diluent. In certain embodiments, the pharmaceutically acceptable diluent is water or saline. In certain embodiments, the antisense compound is an antisense oligonucleotide.

Pharmaceutical compositions comprising antisense compounds encompass any pharmaceutically acceptable salts, esters, or salts of such esters, or any other oligonucleotide which, upon administration to an animal, including a human, is capable of providing (directly or indirectly) the biologically active metabolite or residue thereof. Accordingly, for example, the disclosure herein is also drawn to pharmaceutically acceptable salts of antisense compounds, prodrugs, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents. Suitable pharmaceutically acceptable salts include, but are not limited to, sodium and potassium salts.

Pharmaceutically acceptable salts of the compounds described herein may be prepared by methods well-known in the art. For a review of pharmaceutically acceptable salts, see Stahl and Wermuth, Handbook of Pharmaceutical Salts: Properties, Selection and Use (Wiley-VCH, Weinheim, Germany, 2002). Sodium salts of antisense oligonucleotides are useful and are well accepted for therapeutic administration to humans. Accordingly, in one embodiment the compounds described herein are in the form of a sodium salt.

A prodrug can include the incorporation of additional nucleosides at one or both ends of an antisense compound which are cleaved by endogenous nucleases within the body, to form the active antisense compound.

Dosing

In certain embodiments, pharmaceutical compositions are administered according to a dosing regimen (e.g., dose, dose frequency, and duration) wherein the dosing regimen can be selected to achieve a desired effect. The desired effect can be, for example, reduction of AGT or the prevention, reduction, amelioration or slowing the progression of a disease, disorder or condition associated with AGT.

In certain embodiments, the variables of the dosing regimen are adjusted to result in a desired concentration of pharmaceutical composition in a subject. “Concentration of pharmaceutical composition” as used with regard to dose regimen can refer to the compound, oligonucleotide, or active ingredient of the pharmaceutical composition. For example, in certain embodiments, dose and dose frequency are adjusted to provide a tissue concentration or plasma concentration of a pharmaceutical composition at an amount sufficient to achieve a desired effect.

Dosing is dependent on severity and responsiveness of the disease state to be treated, with the course of treatment lasting from several days to several months, or until a cure is effected or a diminution of the disease state is achieved. Dosing is also dependent on drug potency and metabolism. In certain embodiments, dosage is from 0.01 μg to 100 mg per kg of body weight, or within a range of 0.001 mg to 1000 mg dosing, and may be given once or more daily, weekly, biweekly, monthly, quarterly, semi-annually or yearly, or even once every 2 to 20 years. Following successful treatment, it may be desirable to have the patient undergo maintenance therapy to prevent the recurrence of the disease state, wherein the oligonucleotide is administered in maintenance doses, ranging from 0.01 μg to 100 mg per kg of body weight, once or more daily, to once every 20 years or ranging from 0.001 mg to 1000 mg dosing.

Administration

The compounds or pharmaceutical compositions of the present invention can be administered in a number of ways depending upon whether local or systemic treatment is desired and upon the area to be treated. Administration can be inhaled (i.e., pulmonary), enteral (i.e., enteric), parenteral or topical.

In certain embodiments, the compounds and compositions as described herein are administered parenterally. Parenteral administration includes, but is not limited to, intravenous, intra-arterial, subcutaneous, intraperitoneal, intraocular, intramuscular, intracranial, intrathecal, intramedullary, intraventricular or intratumoral injection or infusion. Parenteral administration also includes intranasal administration.

In certain embodiments, parenteral administration is by infusion. Infusion can be chronic or continuous or short or intermittent. In certain embodiments, infused pharmaceutical agents are delivered with a pump.

In certain embodiments, parenteral administration is by injection. The injection can be delivered with a syringe or a pump. In certain embodiments, the injection is a bolus injection. In certain embodiments, the injection is administered directly to a tissue or organ.

In certain embodiments, formulations for parenteral administration can include sterile aqueous solutions which can also contain buffers, diluents and other suitable additives such as, but not limited to, penetration enhancers, carrier compounds and other pharmaceutically acceptable carriers or excipients.

In certain embodiments, the compounds and compositions as described herein are administered enterally. Enteric administration includes, but is not limited to, oral, transmucosal, intestinal or rectal (e.g., suppository, enema). In certain embodiments, formulations for enteral administration of the compounds or compositions can include, but is not limited to, pharmaceutical carriers, excipients, powders or granules, microparticulates, nanoparticulates, suspensions or solutions in water or non-aqueous media, capsules, gel capsules, sachets, tablets or minitablets. Thickeners, flavoring agents, diluents, emulsifiers, dispersing aids or binders can be desirable. In certain embodiments, enteral formulations are those in which compounds provided herein are administered in conjunction with one or more penetration enhancers, surfactants and chelators.

In certain embodiments, administration includes pulmonary administration. In certain embodiments, pulmonary administration comprises delivery of aerosolized oligonucleotide to the lung of a subject by inhalation. Following inhalation by a subject of aerosolized oligonucleotide, oligonucleotide distributes to cells of both normal and inflamed lung tissue, including alveolar macrophages, eosinophils, epithelium, blood vessel endothelium, and bronchiolar epithelium. A suitable device for the delivery of a pharmaceutical composition comprising a modified oligonucleotide includes, but is not limited to, a standard nebulizer device. Additional suitable devices include dry powder inhalers or metered dose inhalers.

In certain embodiments, pharmaceutical compositions are administered to achieve local rather than systemic exposures. For example, pulmonary administration delivers a pharmaceutical composition to the lung, with minimal systemic exposure.

Conjugated Antisense Compounds

In certain embodiments, the oligonucleotides or oligomeric compounds as provided herein are modified by covalent attachment of one or more conjugate groups. In general, conjugate groups modify one or more properties of the attached oligonucleotide or oligomeric compound including but not limited to pharmacodynamics, pharmacokinetics, stability, binding, absorption, cellular distribution, cellular uptake, charge and clearance. As used herein, “conjugate group” means a radical group comprising a group of atoms that are attached to an oligonucleotide or oligomeric compound. In general, conjugate groups modify one or more properties of the compound to which they are attached, including, but not limited to pharmacodynamic, pharmacokinetic, binding, absorption, cellular distribution, cellular uptake, charge and/or clearance properties. Conjugate groups are routinely used in the chemical arts and can include a conjugate linker that covalently links the conjugate group to an oligonucleotide or oligomeric compound. In certain embodiments, conjugate groups include a cleavable moiety that covalently links the conjugate group to an oligonucleotide or oligomeric compound. In certain embodiments, conjugate groups include a conjugate linker and a cleavable moiety to covalently link the conjugate group to an oligonucleotide or oligomeric compound. In certain embodiments, a conjugate group has the general formula:

wherein n is from 1 to about 3, m is 0 when n is 1 or m is 1 when n is 2 or 3, j is 1 or 0, k is 1 or 0 and the sum of j and k is at least one.

In certain embodiments, n is 1, j is 1 and k is 0. In certain embodiments, n is 1, j is 0 and k is 1. In certain embodiments, n is 1, j is 1 and k is 1. In certain embodiments, n is 2, j is 1 and k is 0. In certain embodiments, n is 2, j is 0 and k is 1. In certain embodiments, n is 2, j is 1 and k is 1. In certain embodiments, n is 3, j is 1 and k is 0. In certain embodiments, n is 3, j is 0 and k is 1. In certain embodiments, n is 3, j is 1 and k is 1.

Conjugate groups are shown herein as radicals, providing a bond for forming covalent attachment to an oligomeric compound such as an oligonucleotide. In certain embodiments, the point of attachment on the oligomeric compound is at the 3′-terminal nucleoside or modified nucleoside. In certain embodiments, the point of attachment on the oligomeric compound is the 3′-oxygen atom of the 3′-hydroxyl group of the 3′ terminal nucleoside or modified nucleoside. In certain embodiments, the point of attachment on the oligomeric compound is at the 5′-terminal nucleoside or modified nucleoside. In certain embodiments the point of attachment on the oligomeric compound is the 5′-oxygen atom of the 5′-hydroxyl group of the 5′-terminal nucleoside or modified nucleoside. In certain embodiments, the point of attachment on the oligomeric compound is at any reactive site on a nucleoside, a modified nucleoside or an internucleoside linkage.

As used herein, “cleavable moiety” and “cleavable bond” mean a cleavable bond or group of atoms that is capable of being split or cleaved under certain physiological conditions. In certain embodiments, a cleavable moiety is a cleavable bond. In certain embodiments, a cleavable moiety comprises a cleavable bond. In certain embodiments, a cleavable moiety is a group of atoms. In certain embodiments, a cleavable moiety is selectively cleaved inside a cell or sub-cellular compartment, such as a lysosome. In certain embodiments, a cleavable moiety is selectively cleaved by endogenous enzymes, such as nucleases. In certain embodiments, a cleavable moiety comprises a group of atoms having one, two, three, four, or more than four cleavable bonds.

In certain embodiments, conjugate groups comprise a cleavable moiety. In certain such embodiments, the cleavable moiety covalently attaches the oligomeric compound to the conjugate linker. In certain such embodiments, the cleavable moiety covalently attaches the oligomeric compound to the cell-targeting moiety.

In certain embodiments, a cleavable bond is selected from among: an amide, a polyamide, an ester, an ether, one or both esters of a phosphodiester, a phosphate ester, a carbamate, a di-sulfide, or a peptide. In certain embodiments, a cleavable bond is one of the esters of a phosphodiester. In certain embodiments, a cleavable bond is one or both esters of a phosphodiester. In certain embodiments, the cleavable moiety is a phosphodiester linkage between an oligomeric compound and the remainder of the conjugate group. In certain embodiments, the cleavable moiety comprises a phosphodiester linkage that is located between an oligomeric compound and the remainder of the conjugate group. In certain embodiments, the cleavable moiety comprises a phosphate or phosphodiester. In certain embodiments, the cleavable moiety is attached to the conjugate linker by either a phosphodiester or a phosphorothioate linkage. In certain embodiments, the cleavable moiety is attached to the conjugate linker by a phosphodiester linkage. In certain embodiments, the conjugate group does not include a cleavable moiety.

In certain embodiments, the cleavable moiety is a cleavable nucleoside or a modified nucleoside. In certain embodiments, the nucleoside or modified nucleoside comprises an optionally protected heterocyclic base selected from a purine, substituted purine, pyrimidine or substituted pyrimidine. In certain embodiments, the cleavable moiety is a nucleoside selected from uracil, thymine, cytosine, 4-N-benzoylcytosine, 5-methylcytosine, 4-N-benzoyl-5-methylcytosine, adenine, 6-N-benzoyladenine, guanine and 2-N-isobutyrylguanine.

In certain embodiments, the cleavable moiety is 2′-deoxy nucleoside that is attached to either the 3′ or 5′-terminal nucleoside of an oligomeric compound by a phosphodiester linkage and covalently attached to the remainder of the conjugate group by a phosphodiester or phosphorothioate linkage. In certain embodiments, the cleavable moiety is 2′-deoxy adenosine that is attached to either the 3′ or 5′-terminal nucleoside of an oligomeric compound by a phosphodiester linkage and covalently attached to the remainder of the conjugate group by a phosphodiester or phosphorothioate linkage. In certain embodiments, the cleavable moiety is 2′-deoxy adenosine that is attached to the 3′-oxygen atom of the 3′-hydroxyl group of the 3′-terminal nucleoside or modified nucleoside by a phosphodiester linkage. In certain embodiments, the cleavable moiety is 2′-deoxy adenosine that is attached to the 5′-oxygen atom of the 5′-hydroxyl group of the 5′-terminal nucleoside or modified nucleoside by a phosphodiester linkage. In certain embodiments, the cleavable moiety is attached to a 2′-position of a nucleoside or modified nucleoside of an oligomeric compound.

As used herein, “conjugate linker” in the context of a conjugate group means a portion of a conjugate group comprising any atom or group of atoms that covalently link the cell-targeting moiety to the oligomeric compound either directly or through the cleavable moiety. In certain embodiments, the conjugate linker comprises groups selected from alkyl, amino, oxo, amide, disulfide, polyethylene glycol, ether, thioether (—S—) and hydroxylamino (—O—N(H)—). In certain embodiments, the conjugate linker comprises groups selected from alkyl, amino, oxo, amide and ether groups. In certain embodiments, the conjugate linker comprises groups selected from alkyl and amide groups. In certain embodiments, the conjugate linker comprises groups selected from alkyl and ether groups. In certain embodiments, the conjugate linker comprises at least one phosphorus linking group. In certain embodiments, the conjugate linker comprises at least one phosphodiester group. In certain embodiments, the conjugate linker includes at least one neutral linking group.

In certain embodiments, the conjugate linker is covalently attached to the oligomeric compound. In certain embodiments, the conjugate linker is covalently attached to the oligomeric compound and the branching group. In certain embodiments, the conjugate linker is covalently attached to the oligomeric compound and a tethered ligand. In certain embodiments, the conjugate linker is covalently attached to the cleavable moiety. In certain embodiments, the conjugate linker is covalently attached to the cleavable moiety and the branching group. In certain embodiments, the conjugate linker is covalently attached to the cleavable moiety and a tethered ligand. In certain embodiments, the conjugate linker includes one or more cleavable bonds. In certain embodiments, the conjugate group does not include a conjugate linker.

As used herein, “branching group” means a group of atoms having at least 3 positions that are capable of forming covalent linkages to two or more tether-ligands and the remainder of the conjugate group. In general a branching group provides a plurality of reactive sites for connecting tethered ligands to the oligomeric compound through the conjugate linker and/or the cleavable moiety. In certain embodiments, the branching group comprises groups selected from alkyl, amino, oxo, amide, disulfide, polyethylene glycol, ether, thioether and hydroxylamino groups. In certain embodiments, the branching group comprises a branched aliphatic group comprising groups selected from alkyl, amino, oxo, amide, disulfide, polyethylene glycol, ether, thioether and hydroxylamino groups. In certain such embodiments, the branched aliphatic group comprises groups selected from alkyl, amino, oxo, amide and ether groups. In certain such embodiments, the branched aliphatic group comprises groups selected from alkyl, amino and ether groups. In certain such embodiments, the branched aliphatic group comprises groups selected from alkyl and ether groups. In certain embodiments, the branching group comprises a mono or polycyclic ring system.

In certain embodiments, the branching group is covalently attached to the conjugate linker. In certain embodiments, the branching group is covalently attached to the cleavable moiety. In certain embodiments, the branching group is covalently attached to the conjugate linker and each of the tethered ligands. In certain embodiments, the branching group comprises one or more cleavable bond. In certain embodiments, the conjugate group does not include a branching group.

In certain embodiments, conjugate groups as provided herein include a cell-targeting moiety that has at least one tethered ligand. In certain embodiments, the cell-targeting moiety comprises two tethered ligands covalently attached to a branching group. In certain embodiments, the cell-targeting moiety comprises three tethered ligands covalently attached to a branching group.

As used herein, “tether” means a group of atoms that connect a ligand to the remainder of the conjugate group. In certain embodiments, each tether is a linear aliphatic group comprising one or more groups selected from alkyl, substituted alkyl, ether, thioether, disulfide, amino, oxo, amide, phosphodiester and polyethylene glycol groups in any combination. In certain embodiments, each tether is a linear aliphatic group comprising one or more groups selected from alkyl, ether, thioether, disulfide, amino, oxo, amide and polyethylene glycol groups in any combination. In certain embodiments, each tether is a linear aliphatic group comprising one or more groups selected from alkyl, substituted alkyl, phosphodiester, ether and amino, oxo, amide groups in any combination. In certain embodiments, each tether is a linear aliphatic group comprising one or more groups selected from alkyl, ether and amino, oxo, amide groups in any combination. In certain embodiments, each tether is a linear aliphatic group comprising one or more groups selected from alkyl, amino and oxo groups in any combination. In certain embodiments, each tether is a linear aliphatic group comprising one or more groups selected from alkyl and oxo groups in any combination. In certain embodiments, each tether is a linear aliphatic group comprising one or more groups selected from alkyl and phosphodiester in any combination. In certain embodiments, each tether comprises at least one phosphorus linking group or neutral linking group.

In certain embodiments, tethers include one or more cleavable bond. In certain embodiments, each tethered ligand is attached to a branching group. In certain embodiments, each tethered ligand is attached to a branching group through an amide group. In certain embodiments, each tethered ligand is attached to a branching group through an ether group. In certain embodiments, each tethered ligand is attached to a branching group through a phosphorus linking group or neutral linking group. In certain embodiments, each tethered ligand is attached to a branching group through a phosphodiester group. In certain embodiments, each tether is attached to a ligand through either an amide or an ether group. In certain embodiments, each tether is attached to a ligand through an ether group.

In certain embodiments, each tether comprises from about 8 to about 20 atoms in chain length between the ligand and the branching group. In certain embodiments, each tether comprises from about 10 to about 18 atoms in chain length between the ligand and the branching group. In certain embodiments, each tether comprises about 13 atoms in chain length.

In certain embodiments, the present disclosure provides ligands wherein each ligand is covalently attached to the remainder of the conjugate group through a tether. In certain embodiments, each ligand is selected to have an affinity for at least one type of receptor on a target cell. In certain embodiments, ligands are selected that have an affinity for at least one type of receptor on the surface of a mammalian liver cell. In certain embodiments, ligands are selected that have an affinity for the hepatic asialoglycoprotein receptor (ASGP-R). In certain embodiments, each ligand is a carbohydrate. In certain embodiments, each ligand is, independently selected from galactose, N-acetyl galactoseamine, mannose, glucose, glucosamine and fucose. In certain embodiments, each ligand is N-acetyl galactoseamine (GalNAc). In certain embodiments, the targeting moiety comprises 1 to 3 ligands. In certain embodiments, the targeting moiety comprises 3 ligands. In certain embodiments, the targeting moiety comprises 2 ligands. In certain embodiments, the targeting moiety comprises 1 ligand. In certain embodiments, the targeting moiety comprises 3 N-acetyl galactoseamine ligands. In certain embodiments, the targeting moiety comprises 2 N-acetyl galactoseamine ligands. In certain embodiments, the targeting moiety comprises 1 N-acetyl galactoseamine ligand.

In certain embodiments, each ligand is a carbohydrate, carbohydrate derivative, modified carbohydrate, multivalent carbohydrate cluster, polysaccharide, modified polysaccharide, or polysaccharide derivative. In certain embodiments, each ligand is an amino sugar or a thio sugar. For example, amino sugars may be selected from any number of compounds known in the art, for example glucosamine, sialic acid, α-D-galactosamine, N-Acetylgalactosamine, 2-acetamido-2-deoxy-D-galactopyranose (GalNAc), 2-Amino-3-O—[(R)-1-carboxyethyl]-2-deoxy-β-D-glucopyranose (β-muramic acid), 2-Deoxy-2-methylamino-L-glucopyranose, 4,6-Dideoxy-4-formamido-2,3-di-O-methyl-D-mannopyranose, 2-Deoxy-2-sulfoamino-D-glucopyranose and N-sulfo-D-glucosamine, and N-Glycoloyl-α-neuraminic acid. For example, thio sugars may be selected from the group consisting of 5-Thio-β-D-glucopyranose, Methyl 2,3,4-tri-O-acetyl-1-thio-6-O-trityl-α-D-glucopyranoside, 4-Thio-β-D-galactopyranose, and ethyl 3,4,6,7-tetra-O-acetyl-2-deoxy-1,5-dithio-α-D-gluco-heptopyranoside.

In certain embodiments, conjugate groups as provided herein comprise a carbohydrate cluster. As used herein, “carbohydrate cluster” means a portion of a conjugate group wherein two or more carbohydrate residues are attached to a branching group through tether groups. (see, e.g., Maier et al., “Synthesis of Antisense Oligonucleotides Conjugated to a Multivalent Carbohydrate Cluster for Cellular Targeting,” Bioconjugate Chemistry, 2003, (14): 18-29, which is incorporated herein by reference in its entirety, or Rensen et al., “Design and Synthesis of Novel N-Acetylgalactosamine-Terminated Glycolipids for Targeting of Lipoproteins to the Hepatic Asiaglycoprotein Receptor,” J. Med. Chem. 2004, (47): 5798-5808, for examples of carbohydrate conjugate clusters).

As used herein, “modified carbohydrate” means any carbohydrate having one or more chemical modifications relative to naturally occurring carbohydrates.

As used herein, “carbohydrate derivative” means any compound which may be synthesized using a carbohydrate as a starting material or intermediate.

As used herein, “carbohydrate” means a naturally occurring carbohydrate, a modified carbohydrate, or a carbohydrate derivative.

In certain embodiments, conjugate groups are provided wherein the cell-targeting moiety has the formula:

In certain embodiments, conjugate groups are provided wherein the cell-targeting moiety has the formula:

In certain embodiments, conjugate groups are provided wherein the cell-targeting moiety has the formula:

In certain embodiments, conjugate groups have the formula:

In certain embodiments, an antisense oligonucleotide linked to the conjugate group shown in the formula above has the nucleobase sequence of SEQ ID NO: 1914.

Representative United States patents, United States patent application publications, and international patent application publications that teach the preparation of certain of the above noted conjugate groups, conjugated oligomeric compounds such as antisense compounds comprising a conjugate group, tethers, conjugate linkers, branching groups, ligands, cleavable moieties as well as other modifications include without limitation, U.S. Pat. Nos. 5,994,517, 6,300,319, 6,660,720, 6,906,182, 7,262,177, 7,491,805, 8,106,022, 7,723,509, US 2006/0148740, US 2011/0123520, WO 2013/033230, WO 2014/179620 and WO 2012/037254, each of which is incorporated by reference herein in its entirety.

Representative publications that teach the preparation of certain of the above noted conjugate groups, conjugated oligomeric compounds such as antisense compounds comprising a conjugate group, tethers, conjugate linkers, branching groups, ligands, cleavable moieties as well as other modifications include without limitation, BIESSEN et al., “The Cholesterol Derivative of a Triantennary Galactoside with High Affinity for the Hepatic Asialoglycoprotein Receptor: a Potent Cholesterol Lowering Agent” J. Med. Chem. (1995) 38:1846-1852, BIESSEN et al., “Synthesis of Cluster Galactosides with High Affinity for the Hepatic Asialoglycoprotein Receptor” J. Med. Chem. (1995) 38:1538-1546, LEE et al., “New and more efficient multivalent glyco-ligands for asialoglycoprotein receptor of mammalian hepatocytes” Bioorganic & Medicinal Chemistry (2011) 19:2494-2500, RENSEN et al., “Determination of the Upper Size Limit for Uptake and Processing of Ligands by the Asialoglycoprotein Receptor on Hepatocytes in Vitro and in Vivo” J. Biol. Chem. (2001) 276(40):37577-37584, RENSEN et al., “Design and Synthesis of Novel N-Acetylgalactosamine-Terminated Glycolipids for Targeting of Lipoproteins to the Hepatic Asialoglycoprotein Receptor” J. Med. Chem. (2004) 47:5798-5808, SLIEDREGT et al., “Design and Synthesis of Novel Amphiphilic Dendritic Galactosides for Selective Targeting of Liposomes to the Hepatic Asialoglycoprotein Receptor” J. Med. Chem. (1999) 42:609-618, and Valentijn et al., “Solid-phase synthesis of lysine-based cluster galactosides with high affinity for the Asialoglycoprotein Receptor” Tetrahedron, 1997, 53(2), 759-770, each of which is incorporated by reference herein in its entirety.

In certain embodiments, conjugate groups include without limitation, intercalators, reporter molecules, polyamines, polyamides, polyethylene glycols, thioethers, polyethers, cholesterols, thiocholesterols, cholic acid moieties, folate, lipids, phospholipids, biotin, phenazine, phenanthridine, anthraquinone, adamantane, acridine, fluoresceins, rhodamines, coumarins and dyes. Certain conjugate groups have been described previously, for example: cholesterol moiety (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556), cholic acid (Manoharan et al., Bioorg. Med. Chem. Let., 1994, 4, 1053-1060), a thioether, e.g., hexyl-S-tritylthiol (Manoharan et al., Ann. N.Y. Acad. Sci., 1992, 660, 306-309; Manoharan et al., Bioorg. Med. Chem. Let., 1993, 3, 2765-2770), a thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20, 533-538), an aliphatic chain, e.g., do-decan-diol or undecyl residues (Saison-Behmoaras et al., EMBO J., 1991, 10, 1111-1118; Kabanov et al., FEBS Lett., 1990, 259, 327-330; Svinarchuk et al., Biochimie, 1993, 75, 49-54), a phospholipid, e.g., di-hexadecyl-rac-glycerol or triethyl-ammonium 1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654; Shea et al., Nucl. Acids Res., 1990, 18, 3777-3783), a polyamine or a polyethylene glycol chain (Manoharan et al., Nucleosides & Nucleotides, 1995, 14, 969-973), or adamantane acetic acid (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654), a palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264, 229-237), or an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277, 923-937).

In certain embodiments, a conjugate group comprises an active drug substance, for example, aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fen-bufen, ketoprofen, (S)-(+)-pranoprofen, carprofen, dansylsarcosine, 2,3,5-triiodobenzoic acid, flufenamic acid, folinic acid, a benzothiadiazide, chlorothiazide, a diazepine, indo-methicin, a barbiturate, a cephalosporin, a sulfa drug, an antidiabetic, an antibacterial or an antibiotic.

Some nonlimiting examples of conjugate linkers include pyrrolidine, 8-amino-3,6-dioxaoctanoic acid (ADO), succinimidyl 4-(N-maleimidomethyl) cyclohexane-1-carboxylate (SMCC) and 6-aminohexanoic acid (AHEX or AHA). Other conjugate linkers include, but are not limited to, substituted C1-C10 alkyl, substituted or unsubstituted C2-C10 alkenyl or substituted or unsubstituted C2-C10 alkynyl, wherein a nonlimiting list of preferred substituent groups includes hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl and alkynyl.

Conjugate groups may be attached to either or both ends of an oligonucleotide (terminal conjugate groups) and/or at any internal position.

In certain embodiments, conjugate groups are at the 3′-end of an oligonucleotide of an oligomeric compound. In certain embodiments, conjugate groups are near the 3′-end. In certain embodiments, conjugates are attached at the 3′end of an oligomeric compound, but before one or more terminal group nucleosides. In certain embodiments, conjugate groups are placed within a terminal group.

In certain embodiments, conjugate groups are at the 5′-end of an oligonucleotide of an oligomeric compound. In certain embodiments, conjugate groups are near the 5′-end.

In certain embodiments, a modified oligonucleotide targeting AGT described herein further comprises a GalNAc conjugate group. In certain embodiments, the GalNAc conjugate group is 5′-Trishexylamino-(THA)-C6 GalNAc3. In certain embodiments, the 5′-Trishexylamino-(THA)-C6 GalNAc3 conjugate has the formula

In certain embodiments, the modified oligonucleotide is linked to the 5′-Trishexylamino-(THA)-C6 GalNAc3 conjugate by a cleavable moiety. In certain embodiments, the cleavable moiety is a phosphate group.

Cell Culture and Antisense Compounds Treatment

The effects of antisense compounds on the level, activity or expression of AGT nucleic acids can be tested in vitro in a variety of cell types. Cell types used for such analyses are available from commercial vendors (e.g., American Type Culture Collection, Manassas, Va.; Zen-Bio, Inc., Research Triangle Park, N.C.; Clonetics Corporation, Walkersville, Md.) and cells are cultured according to the vendor's instructions using commercially available reagents (e.g., Invitrogen Life Technologies, Carlsbad, Calif.). Illustrative cell types include, but are not limited to, HepG2 cells, Hep3B cells, Huh7 (hepatocellular carcinoma) cells, primary hepatocytes, A549 cells, GM04281 fibroblasts and LLC-MK2 cells.

In Vitro Testing of Antisense Oligonucleotides

Described herein are methods for treatment of cells with antisense oligonucleotides, which can be modified appropriately for treatment with other antisense compounds.

In general, cells are treated with antisense oligonucleotides when the cells reach approximately 60-80% confluence in culture.

One reagent commonly used to introduce antisense oligonucleotides into cultured cells includes the cationic lipid transfection reagent LIPOFECTIN® (Invitrogen, Carlsbad, Calif.). Antisense oligonucleotides are mixed with LIPOFECTIN® in OPTI-MEM® 1 (Invitrogen, Carlsbad, Calif.) to achieve the desired final concentration of antisense oligonucleotide and a LIPOFECTIN® concentration that typically ranges 2 to 12 ug/mL per 100 nM antisense oligonucleotide.

Another reagent used to introduce antisense oligonucleotides into cultured cells includes LIPOFECTAMINE 2000® (Invitrogen, Carlsbad, Calif.). Antisense oligonucleotide is mixed with LIPOFECTAMINE 2000® in OPTI-MEM® 1 reduced serum medium (Invitrogen, Carlsbad, Calif.) to achieve the desired concentration of antisense oligonucleotide and a LIPOFECTAMINE® concentration that typically ranges 2 to 12 ug/mL per 100 nM antisense oligonucleotide.

Another reagent used to introduce antisense oligonucleotides into cultured cells includes Cytofectin® (Invitrogen, Carlsbad, Calif.). Antisense oligonucleotide is mixed with Cytofectin® in OPTI-MEM® 1 reduced serum medium (Invitrogen, Carlsbad, Calif.) to achieve the desired concentration of antisense oligonucleotide and a Cytofectin® concentration that typically ranges 2 to 12 ug/mL per 100 nM antisense oligonucleotide.

Another reagent used to introduce antisense oligonucleotides into cultured cells includes Oligofectamine™ (Invitrogen Life Technologies, Carlsbad, Calif.). Antisense oligonucleotide is mixed with Oligofectamine™ in Opti-MEM™-1 reduced serum medium (Invitrogen Life Technologies, Carlsbad, Calif.) to achieve the desired concentration of oligonucleotide with an Oligofectamine™ to oligonucleotide ratio of approximately 0.2 to 0.8 μL per 100 nM.

Another reagent used to introduce antisense oligonucleotides into cultured cells includes FuGENE 6 (Roche Diagnostics Corp., Indianapolis, Ind.). Antisense oligomeric compound was mixed with FuGENE 6 in 1 mL of serum-free RPMI to achieve the desired concentration of oligonucleotide with a FuGENE 6 to oligomeric compound ratio of 1 to 4 μL of FuGENE 6 per 100 nM.

Another technique used to introduce antisense oligonucleotides into cultured cells includes electroporation (Sambrook and Russell in Molecular Cloning. A Laboratory Manual. Third Edition. Cold Spring Harbor laboratory Press, Cold Spring Harbor, N.Y. 2001).

Cells are treated with antisense oligonucleotides by routine methods. Cells are typically harvested 16-24 hours after antisense oligonucleotide treatment, at which time RNA or protein levels of target nucleic acids are measured by methods known in the art and described herein (Sambrook and Russell in Molecular Cloning. A Laboratory Manual. Third Edition. Cold Spring Harbor laboratory Press, Cold Spring Harbor, N.Y. 2001). In general, when treatments are performed in multiple replicates, the data are presented as the average of the replicate treatments.

The concentration of antisense oligonucleotide used varies from cell line to cell line. Methods to determine the optimal antisense oligonucleotide concentration for a particular cell line are well known in the art (Sambrook and Russell in Molecular Cloning. A Laboratory Manual. Third Edition. Cold Spring Harbor laboratory Press, Cold Spring Harbor, N.Y. 2001). Antisense oligonucleotides are typically used at concentrations ranging from 1 nM to 300 nM when transfected with LIPOFECTAMINE2000®, Lipofectin or Cytofectin. Antisense oligonucleotides are used at higher concentrations ranging from 625 to 20,000 nM when transfected using electroporation.

RNA Isolation

RNA analysis can be performed on total cellular RNA or poly(A)+ mRNA. Methods of RNA isolation are well known in the art (Sambrook and Russell, Molecular Cloning: A Laboratory Manual, 3rd Ed., 2001). RNA is prepared using methods well known in the art, for example, using the TRIZOL® Reagent (Invitrogen, Carlsbad, Calif.) according to the manufacturer's recommended protocols.

Analysis of Inhibition of Target Levels or Expression

Inhibition of levels or expression of an AGT nucleic acid can be assayed in a variety of ways known in the art (Sambrook and Russell, Molecular Cloning: A Laboratory Manual, 3rd Ed., 2001). For example, target nucleic acid levels can be quantitated by, e.g., Northern blot analysis, competitive polymerase chain reaction (PCR), or quantitative real-time PCR. RNA analysis can be performed on total cellular RNA or poly(A)+ mRNA. Methods of RNA isolation are well known in the art. Northern blot analysis is also routine in the art. Quantitative real-time PCR can be conveniently accomplished using the commercially available ABI PRISM® 7600, 7700, or 7900 Sequence Detection System, available from PE-Applied Biosystems, Foster City, Calif. and used according to manufacturer's instructions.

Quantitative Real-Time PCR Analysis of Target RNA Levels Quantitation of target RNA levels may be accomplished by quantitative real-time PCR using the ABI

PRISM® 7600, 7700, or 7900 Sequence Detection System (PE-Applied Biosystems, Foster City, Calif.) according to manufacturer's instructions. Methods of quantitative real-time PCR are well known in the art.

Prior to real-time PCR, the isolated RNA is subjected to a reverse transcriptase (RT) reaction, which produces complementary DNA (cDNA) that is then used as the substrate for the real-time PCR amplification. The RT and real-time PCR reactions are performed sequentially in the same sample well. RT and real-time PCR reagents are obtained from Invitrogen (Carlsbad, Calif.). RT, real-time-PCR reactions are carried out by methods well known to those skilled in the art.

Gene (or RNA) target quantities obtained by real time PCR are normalized using either the expression level of a gene whose expression is constant, such as cyclophilin A, or by quantifying total RNA using RIBOGREEN® (Invitrogen, Inc. Carlsbad, Calif.). Cyclophilin A expression is quantified by real time PCR, by being run simultaneously with the target, multiplexing, or separately. Total RNA is quantified using RIBOGREEN® RNA quantification reagent (Invitrogen, Inc. Eugene, Oreg.). Methods of RNA quantification by RIBOGREEN® are taught in Jones, L. J., et al, (Analytical Biochemistry, 1998, 265, 368-374). A CYTOFLUOR® 4000 instrument (PE Applied Biosystems) is used to measure RIBOGREEN® fluorescence.

Probes and primers are designed to hybridize to an AGT nucleic acid. Methods for designing real-time PCR probes and primers are well known in the art, and may include the use of software such as PRIMER EXPRESS® Software (Applied Biosystems, Foster City, Calif.).

Analysis of Protein Levels

Antisense inhibition of AGT nucleic acids can be assessed by measuring AGT protein levels. Protein levels of AGT can be evaluated or quantitated in a variety of ways well known in the art, such as immunoprecipitation, Western blot analysis (immunoblotting), enzyme-linked immunosorbent assay (ELISA), quantitative protein assays, protein activity assays (for example, caspase activity assays), immunohistochemistry, immunocytochemistry or fluorescence-activated cell sorting (FACS) (Sambrook and Russell, Molecular Cloning: A Laboratory Manual, 3′ Ed., 2001). Antibodies directed to a target can be identified and obtained from a variety of commercially available sources, or can be prepared via conventional monoclonal or polyclonal antibody generation methods well known in the art.

In Vivo Testing of Antisense Compounds

Antisense compounds, for example, antisense oligonucleotides, are tested in animals to assess their ability to inhibit expression of AGT and produce phenotypic changes, such as, reduced hypertension in the body. Testing can be performed in normal animals, or in experimental disease models. For administration to animals, antisense oligonucleotides are formulated in a pharmaceutically acceptable diluent, such as sterile water-for-injection or phosphate-buffered saline. Administration includes parenteral routes of administration, such as intraperitoneal, intravenous, and subcutaneous. Calculation of antisense oligonucleotide dosage and dosing frequency depends upon factors such as route of administration and animal body weight. In one embodiment, following a period of treatment with antisense oligonucleotides, RNA is isolated from liver tissue and changes in AGT nucleic acid expression are measured. Changes in AGT protein levels can be directly measured. Changes in AGT expression can also be measured by determining the level of inhibition of the RAAS pathway. RAAS pathway related diseases, disorders and/or conditions may be used as markers for determining the level of AGT inhibition.

Certain Indications

Certain embodiments of the invention provide compounds, compositions and methods of using the compounds and compositions to reduce AGT levels. In certain embodiments, the invention provides compounds, compositions and methods of using the compounds and compositions to treat a subject comprising administering a therapeutically effective amount of the compounds or compositions to the subject. In certain embodiments, the subject has, or is at risk for, a RAAS pathway related disease, disorder or condition. In certain embodiments, the compound or composition comprises and antisense compound.

In certain embodiments, administration of a therapeutically effective amount of an antisense compound targeted to an AGT nucleic acid is accompanied by monitoring of AGT levels in the serum or tissue of a subject to determine a subject's response to the antisense compound. A subject's response to administration of the antisense compound is used by a physician to determine the amount and duration of therapeutic intervention.

In certain embodiments, administration of an antisense compound targeted to an AGT nucleic acid results in reduction of AGT expression by at least 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 99% or 100% or a range defined by any two of these values. In certain embodiments, administration of an antisense compound targeted to an AGT nucleic acid results in inhibition of the RAAS pathway by at least 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 99% or 100% or a range defined by any two of these values. In certain embodiments, administration of an antisense compound targeted to an AGT nucleic acid results in a change the RAAS pathway related disease, disorder, condition, symptom or marker (e.g., hypertension or organ damage). In certain embodiments, administration of an AGT antisense compound increases or decreases the RAAS related disease, disorder, condition, symptom or marker by at least 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 99% or 100% or a range defined by any two of these values.

In certain embodiments, pharmaceutical compositions comprising an antisense compound targeted to AGT are used in the preparation of a medicament for reducing AGT levels. In certain embodiments, pharmaceutical compositions comprising an antisense compound targeted to AGT are used in the preparation of a medicament for treating a subject suffering from, or susceptible to, a RAAS related disease, disorder or condition.

In certain embodiments, reducing AGT levels in a subject treats, ameliorates, prevents, slows the progression, or delays the onset of a disease, condition or disorder. In certain embodiments, the disease, condition or disorder is shortened life expectancy, hypertension, hypertensive emergency (i.e. malignant hypertension), kidney disease (e.g., chronic kidney disease, polycystic kidney disease), pre-eclampsia, Marfan Syndrome, stroke, cardiac disease (e.g., myocardial infarction, heart failure, congestive heart failure, valvular heart disease), aneurysms of the blood vessels, abdominal aneurysm, peripheral artery disease, organ damage, pulmonary arterial hypertension, obesity, metabolic syndrome, non-alcoholic steatohepatitis (NASH), non-alcoholic fatty liver disease (NAFLD) and RAAS related diseases, disorders and/or conditions or symptoms thereof. In certain embodiments, the hypertension is nonresistant hypertension or resistant hypertension. In certain embodiments, the aneurysm of the blood vessels is aortic aneurysm. In certain embodiments, the organ damage is heart muscle hypertrophy or fibrosis in an organ or tissue. In certain embodiments, the organ is heart, liver or kidney and the tissue is derived from the heart, liver or kidney.

In certain embodiments, reducing AGT levels in a subject treats, ameliorates, prevents, slows the progression, or delays the onset of a RAAS pathway related disease, disorder or condition. In certain embodiments, the RAAS pathway related disease, disorder or condition is shortened life expectancy, hypertension, hypertensive emergency (i.e. malignant hypertension), kidney disease (e.g., chronic kidney disease, polycystic kidney disease), pre-eclampsia, Marfan Syndrome, stroke, cardiac disease (e.g., myocardial infarction, heart failure, congestive heart failure, valvular heart disease), aneurysms of the blood vessels, abdominal aneurysm, peripheral artery disease, organ damage, pulmonary arterial hypertension, obesity, metabolic syndrome, NASH, NAFLD and other RAAS related diseases, disorders and/or conditions or symptoms thereof. In certain embodiments, the hypertension is nonresistant hypertension or resistant hypertension. In certain embodiments, the aneurysm of the blood vessels is aortic aneurysm. In certain embodiments, the organ damage is heart muscle hypertrophy or fibrosis in an organ or tissue. In certain embodiments, the organ is heart, liver or kidney and the tissue is derived from the heart, liver or kidney.

In certain embodiments, provided are compounds, compositions and methods for modulating a symptom or marker of a disease, disorder and/or condition. In certain embodiments, the marker can be selected from one or more of shortened life expectancy, hypertension, hypertensive emergency (i.e. malignant hypertension), kidney disease (e.g., chronic kidney disease, polycystic kidney disease), pre-eclampsia, Marfan Syndrome, stroke, cardiac disease (e.g., myocardial infarction, heart failure, congestive heart failure, valvular heart disease), aneurysms of the blood vessels, abdominal aneurysm, peripheral artery disease, organ damage and other RAAS related diseases, disorders and/or conditions or symptoms thereof

Certain Combination Therapies

In certain embodiments, a first agent comprising an antisense compound provided herein is co-administered with one or more secondary agents. In certain embodiments, the antisense compound is an antisense oligonucleotide. In certain embodiments, the antisense oligonucleotide is a modified oligonucleotide.

In certain embodiments, such second agents are designed to treat the same RAAS pathway related disease, disorder or condition as the first agent described herein. In certain embodiments, such second agents are designed to treat a different disease, disorder, or condition as the first agent described herein. In certain embodiments, such second agents are designed to treat an undesired side effect of one or more pharmaceutical compositions as described herein. In certain embodiments, such first agents are designed to treat an undesired side effect of a second agent. In certain embodiments, second agents are co-administered with the first agent to treat an undesired effect of the first agent. In certain embodiments, second agents are co-administered with the first agent to produce a combinational or additive effect. In certain embodiments, second agents are co-administered with the first agent to produce a synergistic effect.

In certain embodiments, the co-administration of the first and second agents permits use of lower dosages than would be required to achieve a therapeutic or prophylactic effect if the agents were administered as independent therapy. In certain embodiments the dose of a co-administered second agent is the same as the dose that would be administered if the second agent was administered alone. In certain embodiments the dose of a co-administered second agent is greater than the dose that would be administered if the second agent was administered alone.

In certain embodiments, a first agent and one or more second agents are administered at the same time. In certain embodiments, the first agent and one or more second agents are administered at different times. In certain embodiments, the first agent and one or more second agents are prepared together in a single pharmaceutical formulation. In certain embodiments, the first agent and one or more second agents are prepared separately.

In certain embodiments, second agents include, but are not limited to, certain procedures to reduce hypertension, diet changes, lifestyle changes, anti-fibrotic drugs and anti-hypertensive drugs such as RAAS inhibitors, endothelin receptor antagonists, neprilysin inhibitors, diuretics, calcium channel blockers, adrenergic receptor antagonists, adrenergic agonists and vasodilators.

Examples of procedures that can reduce hypertension include, but are not limited to, renal denervation and baroreceptor activation therapy.

Examples of RAS or RAAS inhibitors include, but are not limited to ACE inhibitors (e.g., captopril, enalapril, fosinopril, lisinopril, perindopril, quinapril, ramipril, trandolapril and benazepril), angiotensin II receptor antagonists (e.g., candesartan, eprosartan, irbesartan, losartan, olmesartan, telmisartan and valsartan), renin inhibitors (e.g., aliskiren), aldosterone receptor antagonists (e.g., eplerenone, spironolactone and finerenone).

Examples of endothelin receptor antagonists include ambrisentan, sitaxentan, atrasentan, BQ-123, zibotentan, bosentan, macitentan and tezosentan.

Examples of neprilysin inhibitors include sacubitril and omapatrilat.

Examples of diuretics include loop diuretics (e.g., bumetanide, ethacrynic acid, furosemide, torsemide), thiazide diuretics (e.g., epitizide, hydrochlorothiazide, chlorothiazide and bendroflumethiazide), thiazide-like diuretics (e.g., indapamide, chlorthalidone and metolazone) and potassium-sparing diuretics (e.g., amiloride, triamterene and spironolactone).

Examples of calcium channel blockers include dihydropyridines (e.g., amlodipine, felodipine, isradipine, lercanidipine, nicardipine, nifedipine, nimodipine and nitrendipine) and non-dihydropyridines (e.g., diltiazem and verapamil).

Examples of adrenergic receptor antagonists include Beta blockers (e.g., atenolol, metoprolol, nadolol, oxprenolol, pindolol, propranolol and timolol), Alpha blockers (e.g., doxazosin, phentolamine, indoramin, phenoxybenzamine, prazosin, terazosin and tolazoline) and mixed Alpha+Beta blockers (e.g., bucindolol, carvedilol and labetalol).

Examples of vasodilators include sodium nitroprusside and hydralazine and its derivatives.

Examples of adrenergic agonists include alpha-2 agonists (e.g., clonidine, guanabenz, methyldopa and moxonidine).

Additional examples of anti-hypertensive drugs include guanethidine, reserpine and the like.

The second agents can be used in combination with the therapeutic compounds described herein to decrease a disease, disorder and/or condition such as hypertension, organ damage and the like.

Certain Compounds

Preferred antisense compounds with beneficial properties that enhance their use as therapeutic treatments in humans are demonstrated in the examples herein. For brevity, only the studies that contributed to the selection of the preferred antisense compounds are described. A non-exhaustive summary of the examples is provided below for ease of reference.

Over 2000 antisense compounds with a MOE containing and/or a cEt containing gapmer motif targeting human AGT were designed. Example 1 shows representative single dose inhibition data for the over 2000 potent antisense compounds tested in HepG2 cells for their effect on human AGT mRNA.

Of the over 2000 antisense compounds tested with a single dose in vitro, over 160 antisense compounds were chosen for testing in dose-dependent inhibition studies to determine their half maximal inhibitory concentration (IC50) in HepG2 cells (Example 2).

Base on the in vitro dose response studies, over 50 antisense compounds were selected for single dose potency and tolerability testing in human AGT transgenic (huAGT tg) mice as described in the exemplary studies in Example 3. Of the over 50 antisense compounds, about 14 antisense compounds were further selected for dose response and tolerability studies in huAGT tg mice (Example 4).

Nine antisense compounds exhibiting significant potency and tolerability in huAGT mice were chosen for further studies: in a viscosity assay (Example 5); in CD1 mice (Example 6) and Sprague-Dawlay rats (Example 7) to assess tolerability of the antisense compounds; in monkey hepatocytes to test cross-species potency in inhibiting monkey AGT (Example 8); and in cynomolgus monkeys to assess potency and tolerability (Example 9). Although the antisense compounds in the studies described in Example 9 were tested in cynomolgus monkeys, the cynomolgus monkey AGT sequence was not available for comparison to the sequences of the antisense compounds, therefore the sequences of the antisense compounds were compared to that of the closely related rhesus monkey (Example 8).

Based on the extensive characterization of the 9 antisense compounds, the sequence of antisense compound ISIS 654472 (parent compound) was selected for further study (Example 10). Six antisense compounds were designed with the sequence of parent compound ISIS 654472 but with different chemical modifications and a GalNAc conjugate. The 6 newly designed compounds were administered to CD1 mice (Example 10) and Sprague-Dawley rats (Example 11) to test their tolerability in these animal models. Of the 6 GalNAc conjugated antisense compounds, compound ISIS 757456 was selected to test in huAGT mice compared to the parent antisense compound ISIS 654472. ISIS 757456 showed an 8× improvement in potency compared to unconjugated compound ISIS 654472.

Accordingly, provided herein are antisense compounds with any one or more characteristics that are beneficial for their use as a therapeutic agent. In certain embodiments, provided herein are antisense compounds comprising a modified oligonucleotide as described herein targeted to, or specifically hybridizable with, a region of nucleotides selected from any of SEQ ID NOs: 1-6.

In certain embodiments, certain antisense compounds as described herein are efficacious by virtue of their potency in inhibiting AGT expression. In certain embodiments, the compounds or compositions inhibit AGT by at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90% or at least 95%.

In certain embodiments, certain antisense compounds as described herein are efficacious by virtue of an in vitro IC50 of less than 20 μM, less than 10 μM, less than 8 μM, less than 5 μM, less than 2 μM, less than 1 μM, less than 0.9 μM, less than 0.8 μM, less than 0.7 μM, less than 0.6 μM, or less than 0.5 μM when tested in human cells, for example, in the Hep3B cell line (as described in Example 2).

In certain embodiments, certain antisense compounds as described herein are efficacious by virtue of a median effective dose (ED50) of ≤10 mpk/wk, ≤9 mpk/wk, ≤8 mpk/wk, ≤7 mpk/wk, ≤6 mpk/wk, ≤5 mpk/wk, ≤4 mpk/wk, ≤3 mpk/wk, ≤2 mpk/wk, or ≤1 mpk/wk in vivo as shown in Example 4. In certain embodiments, a preferred antisense compound such as antisense compound ISIS 757456 has an ED50≤3 mpk/wk as shown in Example 12.

In certain embodiments, certain antisense compounds as described herein are efficacious by virtue of having a viscosity of less than 40 cP, less than 35 cP, less than 30 cP, less than 25 cP, less than 20 cP, less than 15 cP, or less than 12 cP as described in Example 5. Oligonucleotides having a viscosity greater than 40 cP would have less than optimal viscosity.

In certain embodiments, certain antisense compounds as described herein are highly tolerable, as demonstrated by the in vivo tolerability measurements described in the examples. In certain embodiments, the certain antisense compounds as described herein are highly tolerable, as demonstrated by having an increase in ALT and/or AST value of no more than 3 fold, 2 fold or 1.5 fold over saline treated animals.

In certain embodiments, certain antisense compounds as described herein are efficacious by virtue of having one or more of an inhibition potency of greater than 50%, an ED50≤5 mpk/wk, a viscosity of less than 40 cP, and no more than a 3 fold increase in ALT and/or AST in transgenic mice.

In certain embodiments, ISIS 757456 (SEQ ID NO: 1914) is preferred. This compound was found to be a potent inhibitor in AGT transgenic mice and a very tolerable antisense compound in CD-1 mice. In mice it had less than a 3 fold increase in ALT and/or AST levels over saline treated animals. It had an ED50≤3 mpk/wk in huAGT transgenic mice.

EXAMPLES Non-Limiting Disclosure and Incorporation by Reference

While certain compounds, compositions and methods described herein have been described with specificity in accordance with certain embodiments, the following examples serve only to illustrate the compounds described herein and are not intended to limit the same. Each of the references recited in the present application is incorporated herein by reference in its entirety.

Example 1: Antisense Inhibition of Human Angiotensinogen (AGT) in HepG2 Cells

Over 2000 antisense oligonucleotides were designed targeting human AGT nucleic acid and were tested for their effects on AGT mRNA in vitro in a series of experiments that had similar culture conditions. The results for representative antisense oligonucleotides are presented in tables shown below.

The newly designed chimeric antisense oligonucleotides in the Tables below were designed as MOE and/or cEt containing gapmers. The MOE containing oligonucleotides have a central gap segment comprising 2′-deoxynucleosides which is flanked by wing segments on the 5′ direction and the 3′ direction. At least one nucleoside in the 5′ wing segment and/or one nucleoside in the 3′ wing segment has a 2′-MOE sugar modification. The cEt containing oligonucleotides have a central gap segment comprising 2′-deoxynucleosides which is flanked by wing segments on the 5′ direction and the 3′ direction. At least one nucleoside in the 5′ wing segment and/or one nucleoside in the 3′ wing segment has a cEt sugar modification. In some instances oligonucleotides were designed to contain both a MOE and a cEt. The MOE and cEt containing oligonucleotides have a central gap segment comprising 2′-deoxynucleosides which is flanked by wing segments on the 5′ direction and the 3′ direction. At least one nucleoside in the 5′ wing segment and/or one nucleoside in the 3′ wing segment has a MOE and/or cEt sugar modification.

The “Chemistry” column describes the sugar modifications of each oligonucleotide. “k” indicates an cEt sugar modification; “d” indicates deoxyribose; and “e” indicates a MOE modification. The internucleoside linkages throughout each gapmer are phosphorothioate (P═S) linkages. All cytosine residues throughout each gapmer are 5-methylcytosines.

“Start site” indicates the 5′-most nucleoside to which the gapmer is targeted in the human gene sequence. “Stop site” indicates the 3′-most nucleoside to which the gapmer is targeted human gene sequence. Each gapmer listed in the Tables below is targeted to either the human AGT mRNA, designated herein as SEQ ID NO: 1 (GENBANK Accession NM_000029.3) and/or the human AGT genomic sequence, designated herein as SEQ ID NO: 2 (GENBANK Accession NT_167186.1 truncated from nucleotides 24354000 to 24370100).

Table 1 shows inhibition of AGT mRNA in HepG2 cells cultured at a density of 20,000 cells per well which were transfected using electroporation with 4500 nM antisense oligonucleotide. After a treatment period of approximately 24 hours, RNA was isolated from the cells and AGT mRNA levels were measured by quantitative real-time PCR. Human primer probe set RTS3721 (forward sequence CCCTGATGGGAGCCAGTGT, designated herein as SEQ ID NO: 8; reverse sequence AGCAGGGAGAAGCCCTTCA, designated herein as SEQ ID NO: 9; and probe sequence CCCTGGCTTTCAACACCTACGTCCACTX, where X is a fluorescent label, designated herein as SEQ ID NO: 10) was used to measure mRNA levels. AGT mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN®. Results are presented as percent inhibition of AGT, relative to untreated control cells.

TABLE 1 Inhibition of AGT mRNA by MOE and/or cEt containing gapmers targeting SEQ ID NO: 1 and/or 2 SEQ SEQ ID: SEQ SEQ ID: 1 1 ID: 2 ID 2: SEQ ISIS Start Stop % Start Stop ID NO Site Site Sequence Chemistry Inhibition Site Site NO 568518 1 16 TGCCCGCTCATGGGAT eekddddddddddkke 26 1986 2001 14 568519 20 35 GGGCCACTTCTGACCC eekddddddddddkke 34 2005 2020 15 568520 35 50 GCTTAGGCAACACGGG eekddddddddddkke 20 2020 2035 16 568521 45 60 GGAGAGTCTTGCTTAG eekddddddddddkke 26 2030 2045 17 568522 80 95 CATGCAGGCCGGAGGT eekddddddddddkke 25 2065 2080 18 568523 90 105 GCCACAGGGACATGCA eekddddddddddkke 30 2075 2090 19 568524 122 137 TGACCCAGCCCCGGGA eekddddddddddkke 40 2107 2122 20 568525 155 170 TGTGACAGCCTGAGGC eekddddddddddkke 25 2140 2155 21 568526 165 180 TCCCTAGGTGTGTGAC eekddddddddddkke 34 2150 2165 22 568527 179 194 GAAACGGGAGCATCTC eekddddddddddkke 9 2164 2179 23 568528 189 204 AAGGTTCCCAGAAACG eekddddddddddkke 19 2174 2189 24 568529 209 224 AGTTTGCAGGAGTCGG eekddddddddddkke 26 2194 2209 25 568530 229 244 TCGAGTTACACATTTA eekddddddddddkke 24 2214 2229 26 568531 248 263 AGAGTGAGCCGGTGCA eekddddddddddkke 21 2233 2248 27 568532 258 273 ACTGCTGAACAGAGTG eekddddddddddkke 19 2243 2258 28 568533 268 283 GCAGAGTTTCACTGCT eekddddddddddkke 16 2253 2268 29 568534 278 293 AGTGATCGATGCAGAG eekddddddddddkke 32 2263 2278 30 568535 288 303 AGGAAGTCTTAGTGAT eekddddddddddkke 15 2273 2288 31 568536 301 316 TGGGACCTCTTCCAGG eekddddddddddkke 31 2286 2301 32 568537 353 368 GGCCAGACCACAGGCT eekddddddddddkke 16 2338 2353 33 568538 363 378 TACATCACTTGGCCAG eekddddddddddkke 30 2348 2363 34 568539 373 388 AGAGGAGGGTTACATC eekddddddddddkke 24 2358 2373 35 568540 386 401 GTGCACAGGCTGGAGA eekddddddddddkke 43 2371 2386 36 568541 431 446 TATTTATAGCTGAGGG eekddddddddddkke 29 2416 2431 37 568542 441 456 CACGATGCCCTATTTA eekddddddddddkke 34 2426 2441 38 568543 478 493 TACCCAGAACAACGGC eekddddddddddkke 28 2463 2478 39 568544 525 540 GCCATCTCAGACTGGG eekddddddddddkke 69 5742 5757 40 568545 535 550 ACCGGCAGGAGCCATC eekddddddddddkke 42 5752 5767 41 568546 545 560 TCAGGCTCACACCGGC eekddddddddddkke 67 5762 5777 42 568547 555 570 ATGGTGGCCCTCAGGC eekddddddddddkke 39 5772 5787 43 568548 596 611 GGTCACCTGCAGCCAG eekddddddddddkke 59 5813 5828 44 568549 606 621 ATGTACACCCGGTCAC eekddddddddddkke 25 5823 5838 45 568550 643 658 GGTACTCTCATTGTGG eekddddddddddkke 76 5860 5875 46 568551 654 669 AGCTGCTCACAGGTAC eekddddddddddkke 60 5871 5886 47 568552 676 691 CTTCCCGGCATTGGCC eekddddddddddkke 50 5893 5908 48 568553 703 718 AGCAGGTATGAAGGTG eekddddddddddkke 62 5920 5935 49 568554 713 728 CCTGAATTGGAGCAGG eekddddddddddkke 43 5930 5945 50 568555 723 738 GATGTCTTGGCCTGAA eekddddddddddkke 21 5940 5955 51 568556 739 754 CTTTTCATCCACAGGG eekddddddddddkke 39 5956 5971 52 568557 762 777 AGCACCAGCTGGTCCT eekddddddddddkke 71 5979 5994 53 568558 772 787 TGCAGCGACTAGCACC eekddddddddddkke 71 5989 6004 54 568559 782 797 TGTCAAGTTTTGCAGC eekddddddddddkke 61 5999 6014 55 568560 803 818 CGGCCCTCAACTTGTC eekddddddddddkke 45 6020 6035 56 568561 815 830 TCCCGACCATTGCGGC eekddddddddddkke 25 6032 6047 57 568562 825 840 TTGGCCAGCATCCCGA eekddddddddddkke 51 6042 6057 58 568563 835 850 GCCCAAGAAGTTGGCC eekddddddddddkke 13 6052 6067 59 568564 845 860 ATATACGGAAGCCCAA eekddddddddddkke 52 6062 6077 60 568565 855 870 TGCATGCCATATATAC eekddddddddddkke 64 6072 6087 61 568566 871 886 GCCCCATAGCTCACTG eekddddddddddkke 64 6088 6103 62 568567 886 901 GGCCCCATGGACCACG eekddddddddddkke 38 6103 6118 63 568568 913 928 AAAGACAGCCGTTGGG eekddddddddddkke 58 6130 6145 64 568569 923 938 CCAGGGTGCCAAAGAC eekddddddddddkke 36 6140 6155 65 568570 937 952 CAGATAGAGAGAGGCC eekddddddddddkke 59 6154 6169 66 568571 954 969 GTGTGGTCCAAGGCTC eekddddddddddkke 37 6171 6186 67 568572 983 998 CACCCAGGATTGCCTG eekddddddddddkke 72 6200 6215 68 568573 993 1008 TTCCAAGGAACACCCA eekddddddddddkke 35 6210 6225 69 568574 1017 1032 AGCCGGGAGGTGCAGT eekddddddddddkke 53 6234 6249 70 568575 1020 1035 TCCAGCCGGGAGGTGC eekddddddddddkke 62 6237 6252 71 568576 1053 1068 ACAGCCTGCAGGGCAG eekddddddddddkke 47 6270 6285 72 568577 1070 1085 CCACTAGCAGGCCCTG eekddddddddddkke 33 6287 6302 73 568578 1088 1103 TATCAGCCCTGCCCTG eekddddddddddkke 37 6305 6320 74 568579 1098 1113 TGGGCCTGGCTATCAG eekddddddddddkke 42 6315 6330 75 568580 1114 1129 CGTGGACAGCAGCAGC eekddddddddddkke 70 6331 6346 76 568581 1131 1146 GTGAACACGCCCACCA eekddddddddddkke 48 6348 6363 77 568582 1151 1166 TCAGGTGCAGGCCTGG eekddddddddddkke 36 6368 6383 78 568583 1171 1186 GCCCTGCACAAACGGC eekddddddddddkke 16 6388 6403 79 568584 1182 1197 TAGAGAGCCAGGCCCT eekddddddddddkke 52 6399 6414 80 568585 1203 1218 CGTGGGAGGACCACAG eekddddddddddkke 47 6420 6435 81 568586 1217 1232 TGAAGTCCAGAGAGCG eekddddddddddkke 60 6434 6449 82 568587 1233 1248 GCAACATCCAGTTCTG eekddddddddddkke 50 6450 6465 83 568588 1244 1259 TCTTCTCAGCAGCAAC eekddddddddddkke 54 6461 6476 84 568589 1272 1287 CCTGTCACAGCCTGCA eekddddddddddkke 77 6489 6504 85 568590 1278 1293 TTCCATCCTGTCACAG eekddddddddddkke 51 6495 6510 86 568595 1403 1418 TGTCCACCCAGAACTC eekddddddddddkke 33 10414 10429 87 568596 1406 1421 TGTTGTCCACCCAGAA eekddddddddddkke 59 10417 10432 88 568597 1409 1424 TGCTGTTGTCCACCCA eekddddddddddkke 60 10420 10435 89 568598 1412 1427 AGGTGCTGTTGTCCAC eekddddddddddkke 57 10423 10438 90 568599 1415 1430 CTGAGGTGCTGTTGTC eekddddddddddkke 56 10426 10441 91 568600 1418 1433 ACACTGAGGTGCTGTT eekddddddddddkke 28 10429 10444 92 568601 1421 1436 CAGACACTGAGGTGCT eekddddddddddkke 67 10432 10447 93 568602 1431 1446 AGCATGGGAACAGACA eekddddddddddkke 27 10442 10457 94 568603 1443 1458 CCCATGCCAGAGAGCA eekddddddddddkke 30 10454 10469 95 568604 1462 1477 ACTCCAGTGCTGGAAG eekddddddddddkke 41 10473 10488 96 568605 1465 1480 GTCACTCCAGTGCTGG eekddddddddddkke 73 10476 10491 97 568606 1474 1489 GTCCTGGATGTCACTC eekddddddddddkke 68 10485 10500 98 568607 1484 1499 CCGAGAAGTTGTCCTG eekddddddddddkke 47 10495 10510 99 568608 1494 1509 ACTTGAGTCACCGAGA eekddddddddddkke 39 10505 10520 100 568609 1504 1519 AGTGAAGGGCACTTGA eekddddddddddkke 28 10515 10530 101 568610 1531 1546 CTGGATCAGCAGCAGG eekddddddddddkke 69 10542 10557 102 568611 1550 1565 GGTCAGAGGCATAGTG eekddddddddddkke 43 10561 10576 103 568612 1578 1593 TGGAAAGTGAGACCCT eekddddddddddkke 45 10589 10604 104 568613 1588 1603 GGAGTTTTGCTGGAAA eekddddddddddkke 53 10599 10614 105 568614 1598 1613 TCCAGTTGAGGGAGTT eekddddddddddkke 38 10609 10624 106 568615 1614 1629 GGAGATAGTTTCTTCA eekddddddddddkke 24 10625 10640 107 568616 1631 1646 TCAGGTGGATGGTCCG eekddddddddddkke 34 N/A N/A 108 568617 1653 1668 TGCAGCACCAGTTGGG eekddddddddddkke 65 12259 12274 109 568618 1663 1678 ATAAGATCCTTGCAGC eekddddddddddkke 21 12269 12284 110 568619 1680 1695 AGCAGGTCCTGCAGGT eekddddddddddkke 50 12286 12301 111 568620 1700 1715 CGGGCAGCTCAGCCTG eekddddddddddkke 39 12306 12321 112 568621 1710 1725 TGCAGAATGGCGGGCA eekddddddddddkke 57 12316 12331 113 568622 1720 1735 CAGCTCGGTGTGCAGA eekddddddddddkke 70 12326 12341 114 568623 1730 1745 TTTGCAGGTTCAGCTC eekddddddddddkke 44 12336 12351 115 568624 1745 1760 GGTCATTGCTCAATTT eekddddddddddkke 45 12351 12366 116 568625 1755 1770 ACCCTGATGCGGTCAT eekddddddddddkke 43 12361 12376 117 568626 1794 1809 GCTTCAAGCTCAAAAA eekddddddddddkke 56 13263 13278 118 568627 1827 1842 TGTTGGGTAGACTCTG eekddddddddddkke 61 13296 13311 119 568628 1841 1856 CAGGCTTGTTAAGCTG eekddddddddddkke 53 13310 13325 120 568629 1851 1866 TCCAAGACCTCAGGCT eekddddddddddkke 46 13320 13335 121 568630 1875 1890 AGGAATGGGCGGTTCA eekddddddddddkke 58 13344 13359 122 568631 1923 1938 CGGCCCAGGAAGTGCA eekddddddddddkke 30 13392 13407 123 568632 1933 1948 GTTGGCCACGCGGCCC eekddddddddddkke 11 13402 13417 124 568633 1943 1958 TGCTCAGCGGGTTGGC eekddddddddddkke 49 13412 13427 125 568634 1961 1976 GGCCCTGGCCTCATGC eekddddddddddkke 44 13430 13445 126 568635 1986 2001 GGCCTTGCCAGGCACT eekddddddddddkke 86 13455 13470 127 568636 2007 2022 GCCTCAAAGGCCAGGG eekddddddddddkke 49 13476 13491 128 568637 2046 2061 CGCTGATTTGTCCGGG eekddddddddddkke 92 13515 13530 129 568638 2056 2071 GGTGACACATCGCTGA eekddddddddddkke 86 13525 13540 130 568639 2075 2090 GAAAAGGTGGGAGACT eekddddddddddkke 39 13544 13559 131 568640 2088 2103 CGACTCATTAGAAGAA eekddddddddddkke 87 13557 13572 132 568641 2111 2126 ACGGCTGCTTTCCAGC eekddddddddddkke 64 13580 13595 133 568642 2121 2136 CCAAGGAGAAACGGCT eekddddddddddkke 79 13590 13605 134 568643 2131 2146 CACACTTAGACCAAGG eekddddddddddkke 78 13600 13615 135 568644 2166 2181 TGCCGCTGCAGGCTTC eekddddddddddkke 57 13635 13650 136 568645 2176 2191 GGTGCATTTGTGCCGC eekddddddddddkke 75 13645 13660 137 568646 2274 2289 TGGTCGGTTGGAATTC eekddddddddddkke 77 13743 13758 138 568647 2284 2299 ACAAACAAGCTGGTCG eekddddddddddkke 84 13753 13768 139 568648 2311 2326 CTTGAAAAGGGAACAC eekddddddddddkke 62 13780 13795 140 568649 2331 2346 AACCCAATTTTTGTTC eekddddddddddkke 56 13800 13815 141 568650 2362 2377 GGCAATGCAAAAATGT eekddddddddddkke 78 13831 13846 142 568651 2391 2406 TACATTCAAGACACTA eekddddddddddkke 60 13860 13875 143 568652 2402 2417 GGTCATGTTCTTACAT eekddddddddddkke 55 13871 13886 144 568653 2412 2427 ACTACACGGAGGTCAT eekddddddddddkke 55 13881 13896 145 568654 2422 2437 TATTACAGACACTACA eekddddddddddkke 35 13891 13906 146 568655 2482 2497 GGTGCTTGCATCTTTC eekddddddddddkke 58 13951 13966 147 568656 2492 2507 CAGAAATTCAGGTGCT eekddddddddddkke 47 13961 13976 148 568657 2503 2518 CCGCATTCAAACAGAA eekddddddddddkke 38 13972 13987 149 568658 2513 2528 AGCTATGGTTCCGCAT eekddddddddddkke 55 13982 13997 150 568659 2537 2552 TACTAACACAAGGGAG eekddddddddddkke 37 14006 14021 151 568660 2558 2573 TTATTGTGGCAAGACG eekddddddddddkke 48 14027 14042 152 568661 N/A N/A TTACTAATACAGCCCA eekddddddddddkke 31 3322 3337 153 568662 N/A N/A GGTTTCCCTGATGCAG eekddddddddddkke 34 3516 3531 154 568663 N/A N/A TGATAGTTGGATTCCT eekddddddddddkke 21 4783 4798 155 568664 N/A N/A TGTGGTCCCAACATGC eekddddddddddkke 41 4944 4959 156 568665 N/A N/A TTGAAGTCCTCAACCC eekddddddddddkke 26 5460 5475 157 568670 N/A N/A CTCTTGGATGTCACAG eekddddddddddkke 56 10997 11012 158 568671 N/A N/A GATGGCAAATTTTGTT eekddddddddddkke 23 11321 11336 159 568672 N/A N/A TGTGTTACTTGGGTAA eekddddddddddkke 68 11933 11948 160 568673 N/A N/A GCCACACAGTGAGGGC eekddddddddddkke 22 12189 12204 161

Table 2 shows the percent inhibition of AGT mRNA by additional gapmer oligonucleotides. Cultured HepG2 cells at a density of about 20,000 cells per well were transfected using electroporation with 4,000 nM antisense oligonucleotide. After a treatment period of approximately 24 hours, RNA was isolated from the cells and AGT mRNA levels were measured by quantitative real-time PCR. Human primer probe set RTS3721 was used to measure mRNA levels. AGT mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN®. Results are presented as percent inhibition of AGT, relative to untreated control cells.

TABLE 2 Inhibition of AGT mRNA by MOE and/or cEt containing gapmers targeting SEQ ID NO: 1 and/or 2 SEQ SEQ SEQ SEQ ID: ID: % ID: ID 1 1 Inhi- 2 2: SEQ ISIS Start Stop Se- Chem- bi- Start Stop ID NO Site Site quence istry tion Site Site NO 568637 2046 2061 CGCT eekd 92 13515 13530 129 GATT dddd TGTC dddd CGGG dkke 568637 2046 2061 CGCT eekd 91 13515 13530 129 GATT dddd TGTC dddd CGGG dkke 568637 2046 2061 CGCT eekd 97 13515 13530 129 GATT dddd TGTC dddd CGGG dkke 568637 2046 2061 CGCT eekd 94 13515 13530 129 GATT dddd TGTC dddd CGGG dkke 568637 2046 2061 CGCT eekd 92 13515 13530 129 GATT dddd TGTC dddd CGGG dkke 568638 2056 2071 GGTG eekd 82 13525 13540 130 ACAC dddd ATCG dddd CTGA dkke 594621 2022 2037 CTGC kkkd 87 13491 13506 162 TGCT dddd GGCC dddd TTTG dkkk 594622 2027 2042 GTTA kkkd 97 13496 13511 163 TCTG dddd CTGC dddd TGGC dkkk 594622 2027 2042 GTTA kkkd 99 13496 13511 163 TCTG dddd CTGC dddd TGGC dkkk 594623 2032 2047 GGGT kkkd 90 13501 13516 164 TGTT dddd ATCT dddd GCTG dkkk 594624 2046 2061 CGCT kkkd 94 13515 13530 129 GATT dddd TGTC dddd CGGG dkkk 594625 2047 2062 TCGC kkkd 91 13516 13531 165 TGAT dddd TTGT dddd CCGG dkkk 594625 2047 2062 TCGC kkkd 97 13516 13531 165 TGAT dddd TTGT dddd CCGG dkkk 594626 2049 2064 CATC kkkd  0 13518 13533 166 GCTG dddd ATTT dddd GTCC dkkk 594627 2053 2068 GACA kkkd 92 13522 13537 167 CATC dddd GCTG dddd ATTT dkkk 594628 2073 2088 AAAG kkkd 81 13542 13557 168 GTGG dddd GAGA dddd CTGG dkkk 594629 2082 2097 ATTA kkkd 84 13551 13566 169 GAAG dddd AAAA dddd GGTG dkkk 594630 2090 2105 GTCG kkkd 79 13559 13574 170 ACTC dddd ATTA dddd GAAG dkkk 594631 2095 2110 TCAA kkkd 91 13564 13579 171 AGTC dddd GACT dddd CATT dkkk 594632 2099 2114 CAGC kkkd 96 13568 13583 172 TCAA dddd AGTC dddd GACT dkkk 594641 2022 2037 CTGC eekd 61 13491 13506 162 TGCT dddd GGCC dddd TTTG dkke 594642 2027 2042 GTTA eekd 91 13496 13511 163 TCTG dddd CTGC dddd TGGC dkke 594643 2032 2047 GGGT eekd 91 13501 13516 164 TGTT dddd ATCT dddd GCTG dkke 594644 2047 2062 TCGC eekd 87 13516 13531 165 TGAT dddd TTGT dddd CCGG dkke 594645 2049 2064 CATC eekd 79 13518 13533 166 GCTG dddd ATTT dddd GTCC dkke 594646 2053 2068 GACA eekd 80 13522 13537 167 CATC dddd GCTG dddd ATTT dkke 594647 2073 2088 AAAG eekd 62 13542 13557 168 GTGG dddd GAGA dddd CTGG dkke 609078 2020 2035 GCTG kkkd 73 13489 13504 173 CTGG dddd CCTT dddd TGCC dkkk 609079 2021 2036 TGCT kkkd 69 13490 13505 174 GCTG dddd GCCT dddd TTGC dkkk 609080 2023 2038 TCTG kkkd 91 13492 13507 175 CTGC dddd TGGC dddd CTTT dkkk 609081 2024 2039 ATCT kkkd 90 13493 13508 176 GCTG dddd CTGG dddd CCTT dkkk 609082 2025 2040 TATC kkkd 84 13494 13509 177 TGCT dddd GCTG dddd GCCT dkkk 609083 2026 2041 TTAT kkkd 91 13495 13510 178 CTGC dddd TGCT dddd GGCC dkkk 609084 2028 2043 TGTT kkkd 89 13497 13512 179 ATCT dddd GCTG dddd CTGG dkkk 609085 2029 2044 TTGT kkkd 91 13498 13513 180 TATC dddd TGCT dddd GCTG dkkk 609086 2030 2045 GTTG kkkd 98 13499 13514 181 TTAT dddd CTGC dddd TGCT dkkk 609087 2031 2046 GGTT kkkd 97 13500 13515 182 GTTA dddd TCTG dddd CTGC dkkk 609088 2048 2063 ATCG kkkd 98 13517 13532 183 CTGA dddd TTTG dddd TCCG dkkk 609089 2050 2065 ACAT kkkd 92 13519 13534 184 CGCT dddd GATT dddd TGTC dkkk 609090 2051 2066 CACA kkkd 91 13520 13535 185 TCGC dddd TGAT dddd TTGT dkkk 609091 2052 2067 ACAC kkkd 96 13521 13536 186 ATCG dddd CTGA dddd TTTG dkkk 609092 2054 2069 TGAC kkkd 34 13523 13538 187 ACAT dddd CGCT dddd GATT dkkk 609093 2055 2070 GTGA kkkd 78 13524 13539 188 CACA dddd TCGC dddd TGAT dkkk 609094 2056 2071 GGTG kkkd 93 13525 13540 130 ACAC dddd ATCG dddd CTGA dkkk 609095 2057 2072 GGGT kkkd 96 13526 13541 189 GACA dddd CATC dddd GCTG dkkk 609096 2074 2089 AAAA kkkd 70 13543 13558 190 GGTG dddd GGAG dddd ACTG dkkk 609097 2075 2090 GAAA kkkd 80 13544 13559 131 AGGT dddd GGGA dddd GACT dkkk 609098 2076 2091 AGAA kkkd 85 13545 13560 191 AAGG dddd TGGG dddd AGAC dkkk 609099 2080 2095 TAGA kkkd 90 13549 13564 192 AGAA dddd AAGG dddd TGGG dkkk 609100 2081 2096 TTAG kkkd 95 13550 13565 193 AAGA dddd AAAG dddd GTGG dkkk 609101 2083 2098 CATT kkkd 76 13552 13567 194 AGAA dddd GAAA dddd AGGT dkkk 609102 2084 2099 TCAT kkkd 97 13553 13568 195 TAGA dddd AGAA dddd AAGG dkkk 609103 2085 2100 CTCA kkkd 87 13554 13569 196 TTAG dddd AAGA dddd AAAG dkkk 609104 2086 2101 ACTC kkkd 70 13555 13570 197 ATTA dddd GAAG dddd AAAA dkkk 609105 2087 2102 GACT kkkd 93 13556 13571 198 CATT dddd AGAA dddd GAAA dkkk 609106 2088 2103 CGAC kkkd 98 13557 13572 132 TCAT dddd TAGA dddd AGAA dkkk 609107 2089 2104 TCGA kkkd 97 13558 13573 199 CTCA dddd TTAG dddd AAGA dkkk 609108 2091 2106 AGTC kkkd 97 13560 13575 200 GACT dddd CATT dddd AGAA dkkk 609109 2092 2107 AAGT kkkd 96 13561 13576 201 CGAC dddd TCAT dddd TAGA dkkk 609110 2093 2108 AAAG kkkd 96 13562 13577 202 TCGA dddd CTCA dddd TTAG dkkk 609111 2094 2109 CAAA kkkd 92 13563 13578 203 GTCG dddd ACTC dddd ATTA dkkk 609112 2096 2111 CTCA kkkd 93 13565 13580 204 AAGT dddd CGAC dddd TCAT dkkk 609113 2097 2112 GCTC kkkd 97 13566 13581 205 AAAG dddd TCGA dddd CTCA dkkk 609114 2098 2113 AGCT kkkd 95 13567 13582 206 CAAA dddd GTCG dddd ACTC dkkk 609115 2020 2035 GCTG eekd 71 13489 13504 173 CTGG dddd CCTT dddd TGCC dkke 609116 2021 2036 TGCT eekd 47 13490 13505 174 GCTG dddd GCCT dddd TTGC dkke 609117 2023 2038 TCTG eekd 74 13492 13507 175 CTGC dddd TGGC dddd CTTT dkke 609118 2024 2039 ATCT eekd 81 13493 13508 176 GCTG dddd CTGG dddd CCTT dkke 609119 2025 2040 TATC eekd 76 13494 13509 177 TGCT dddd GCTG dddd GCCT dkke 609120 2026 2041 TTAT eekd 56 13495 13510 178 CTGC dddd TGCT dddd GGCC dkke 609121 2028 2043 TGTT eekd 73 13497 13512 179 ATCT dddd GCTG dddd CTGG dkke 609122 2029 2044 TTGT eekd 87 13498 13513 180 TATC dddd TGCT dddd GCTG dkke 609123 2030 2045 GTTG eekd 92 13499 13514 181 TTAT dddd CTGC dddd TGCT dkke 609124 2031 2046 GGTT eekd 90 13500 13515 182 GTTA dddd TCTG dddd CTGC dkke 609125 2048 2063 ATCG eekd 91 13517 13532 183 CTGA dddd TTTG dddd TCCG dkke 609126 2050 2065 ACAT eekd 66 13519 13534 184 CGCT dddd GATT dddd TGTC dkke 609127 2051 2066 CACA eekd 79 13520 13535 185 TCGC dddd TGAT dddd TTGT dkke 609128 2052 2067 ACAC eekd 72 13521 13536 186 ATCG dddd CTGA dddd TTTG dkke 609129 2054 2069 TGAC eekd 60 13523 13538 187 ACAT dddd CGCT dddd GATT dkke 609130 2055 2070 GTGA eekd 77 13524 13539 188 CACA dddd TCGC dddd TGAT dkke 609131 2057 2072 GGGT eekd 85 13526 13541 189 GACA dddd CATC dddd GCTG dkke 609132 2020 2035 GCTG eekk 47 13489 13504 173 CTGG dddd CCTT dddk TGCC keee 609133 2021 2036 TGCT eekk 44 13490 13505 174 GCTG dddd GCCT dddk TTGC keee 609134 2022 2037 CTGC eekk 62 13491 13506 162 TGCT dddd GGCC dddk TTTG keee 609135 2023 2038 TCTG eekk 59 13492 13507 175 CTGC dddd TGGC dddk CTTT keee 609136 2024 2039 ATCT eekk 70 13493 13508 176 GCTG dddd CTGG dddk CCTT keee 609137 2025 2040 TATC eekk 59 13494 13509 177 TGCT dddd GCTG dddk GCCT keee 609138 2026 2041 TTAT eekk 78 13495 13510 178 CTGC dddd TGCT dddk GGCC keee 609139 2027 2042 GTTA eekk 79 13496 13511 163 TCTG dddd CTGC dddk TGGC keee 609140 2028 2043 TGTT eekk 83 13497 13512 179 ATCT dddd GCTG dddk CTGG keee 609141 2029 2044 TTGT eekk 67 13498 13513 180 TATC dddd TGCT dddk GCTG keee 609142 2030 2045 GTTG eekk 68 13499 13514 181 TTAT dddd CTGC dddk TGCT keee 609143 2031 2046 GGTT eekk 81 13500 13515 182 GTTA dddd TCTG dddk CTGC keee 609144 2032 2047 GGGT eekk 81 13501 13516 164 TGTT dddd ATCT dddk GCTG keee 609145 2046 2061 CGCT eekk 53 13515 13530 129 GATT dddd TGTC dddk CGGG keee 609146 2047 2062 TCGC eekk 80 13516 13531 165 TGAT dddd TTGT dddk CCGG keee 609147 2048 2063 ATCG eekk 88 13517 13532 183 CTGA dddd TTTG dddk TCCG keee 609148 2049 2064 CATC eekk 75 13518 13533 166 GCTG dddd ATTT dddk GTCC keee 609149 2050 2065 ACAT eekk 64 13519 13534 184 CGCT dddd GATT dddk TGTC keee 609150 2051 2066 CACA eekk 77 13520 13535 185 TCGC dddd TGAT dddk TTGT keee 609151 2052 2067 ACAC eekk 57 13521 13536 186 ATCG dddd CTGA dddk TTTG keee 609152 2053 2068 GACA eekk 52 13522 13537 167 CATC dddd GCTG dddk ATTT keee 609153 2054 2069 TGAC eekk 37 13523 13538 187 ACAT dddd CGCT dddk GATT keee 609154 2055 2070 GTGA eekk 50 13524 13539 188 CACA dddd TCGC dddk TGAT keee 609155 2056 2071 GGTG eekk 60 13525 13540 130 ACAC dddd ATCG dddk CTGA keee 609156 2057 2072 GGGT eekk 54 13526 13541 189 GACA dddd CATC dddk GCTG keee 609157 2073 2088 AAAG eekk 40 13542 13557 168 GTGG dddd GAGA dddk CTGG keee 609158 2020 2035 GCTG eekk 77 13489 13504 173 CTGG dddd CCTT dddd TGCC kkee 609159 2021 2036 TGCT eekk 85 13490 13505 174 GCTG dddd GCCT dddd TTGC kkee 609160 2022 2037 CTGC eekk 81 13491 13506 162 TGCT dddd GGCC dddd TTTG kkee 609161 2023 2038 TCTG eekk 91 13492 13507 175 CTGC dddd TGGC dddd CTTT kkee 609162 2024 2039 ATCT eekk 92 13493 13508 176 GCTG dddd CTGG dddd CCTT kkee 609163 2025 2040 TATC eekk 83 13494 13509 177 TGCT dddd GCTG dddd GCCT kkee 609164 2026 2041 TTAT eekk 93 13495 13510 178 CTGC dddd TGCT dddd GGCC kkee 609165 2027 2042 GTTA eekk 93 13496 13511 163 TCTG dddd CTGC dddd TGGC kkee 609166 2028 2043 TGTT eekk 98 13497 13512 179 ATCT dddd GCTG dddd CTGG kkee 609167 2029 2044 TTGT eekk 95 13498 13513 180 TATC dddd TGCT dddd GCTG kkee 609168 2030 2045 GTTG eekk 95 13499 13514 181 TTAT dddd CTGC dddd TGCT kkee 609169 2031 2046 GGTT eekk 95 13500 13515 182 GTTA dddd TCTG dddd CTGC kkee 609170 2032 2047 GGGT eekk 96 13501 13516 164 TGTT dddd ATCT dddd GCTG kkee 609171 2046 2061 CGCT eekk 90 13515 13530 129 GATT dddd TGTC dddd CGGG kkee 609172 2047 2062 TCGC eekk 92 13516 13531 165 TGAT dddd TTGT dddd CCGG kkee 609173 2048 2063 ATCG eekk 94 13517 13532 183 CTGA dddd TTTG dddd TCCG kkee 609174 2049 2064 CATC eekk 96 13518 13533 166 GCTG dddd ATTT dddd GTCC kkee 609175 2050 2065 ACAT eekk 91 13519 13534 184 CGCT dddd GATT dddd TGTC kkee 609176 2051 2066 CACA eekk 94 13520 13535 185 TCGC dddd TGAT dddd TTGT kkee 609177 2052 2067 ACAC eekk 96 13521 13536 186 ATCG dddd CTGA dddd TTTG kkee 609178 2053 2068 GACA eekk 88 13522 13537 167 CATC dddd GCTG dddd ATTT kkee 609179 2054 2069 TGAC eekk 84 13523 13538 187 ACAT dddd CGCT dddd GATT kkee 609180 2055 2070 GTGA eekk 83 13524 13539 188 CACA dddd TCGC dddd TGAT kkee 609181 2056 2071 GGTG eekk 87 13525 13540 130 ACAC dddd ATCG dddd CTGA kkee 609182 2057 2072 GGGT eekk 90 13526 13541 189 GACA dddd CATC dddd GCTG kkee 609183 2073 2088 AAAG eekk 82 13542 13557 168 GTGG dddd GAGA dddd CTGG kkee 609184 2020 2035 GCTG ekkd 84 13489 13504 173 CTGG dddd CCTT dddd TGCC kkee 609185 2021 2036 TGCT ekkd 88 13490 13505 174 GCTG dddd GCCT dddd TTGC kkee 609186 2022 2037 CTGC ekkd 88 13491 13506 162 TGCT dddd GGCC dddd TTTG kkee 609187 2023 2038 TCTG ekkd 74 13492 13507 175 CTGC dddd TGGC dddd CTTT kkee 609188 2024 2039 ATCT ekkd 90 13493 13508 176 GCTG dddd CTGG dddd CCTT kkee 609189 2025 2040 TATC ekkd 91 13494 13509 177 TGCT dddd GCTG dddd GCCT kkee 609190 2026 2041 TTAT ekkd 87 13495 13510 178 CTGC dddd TGCT dddd GGCC kkee 609191 2027 2042 GTTA ekkd 97 13496 13511 163 TCTG dddd CTGC dddd TGGC kkee 609192 2028 2043 TGTT ekkd 95 13497 13512 179 ATCT dddd GCTG dddd CTGG kkee 609193 2029 2044 TTGT ekkd 96 13498 13513 180 TATC dddd TGCT dddd GCTG kkee 609194 2030 2045 GTTG ekkd 97 13499 13514 181 TTAT dddd CTGC dddd TGCT kkee 609195 2031 2046 GGTT ekkd 97 13500 13515 182 GTTA dddd TCTG dddd CTGC kkee 609196 2032 2047 GGGT ekkd 98 13501 13516 164 TGTT dddd ATCT dddd GCTG kkee 609197 2046 2061 CGCT ekkd 96 13515 13530 129 GATT dddd TGTC dddd CGGG kkee 609198 2047 2062 TCGC ekkd 95 13516 13531 165 TGAT dddd TTGT dddd CCGG kkee 609199 2048 2063 ATCG ekkd 96 13517 13532 183 CTGA dddd TTTG dddd TCCG kkee 609200 2049 2064 CATC ekkd 94 13518 13533 166 GCTG dddd ATTT dddd GTCC kkee 609201 2050 2065 ACAT ekkd 94 13519 13534 184 CGCT dddd GATT dddd TGTC kkee 609202 2051 2066 CACA ekkd 94 13520 13535 185 TCGC dddd TGAT dddd TTGT kkee 609203 2052 2067 ACAC ekkd 91 13521 13536 186 ATCG dddd CTGA dddd TTTG kkee 609204 2053 2068 GACA ekkd 94 13522 13537 167 CATC dddd GCTG dddd ATTT kkee 609205 2054 2069 TGAC ekkd 87 13523 13538 187 ACAT dddd CGCT dddd GATT kkee 609206 2055 2070 GTGA ekkd 91 13524 13539 188 CACA dddd TCGC dddd TGAT kkee 609207 2056 2071 GGTG ekkd 93 13525 13540 130 ACAC dddd ATCG dddd CTGA kkee 609208 2057 2072 GGGT ekkd 97 13526 13541 189 GACA dddd CATC dddd GCTG kkee 609209 2073 2088 AAAG ekkd 95 13542 13557 168 GTGG dddd GAGA dddd CTGG kkee 609983 1983 2002 AGGC eeee 75 13452 13471 207 CTTG eddd CCAG dddd GCAC ddde TGTG eeee 609984 1984 2003 GAGG eeee 54 13453 13472 208 CCTT eddd GCCA dddd GGCA ddde CTGT eeee 609985 1985 2004 AGAG eeee 63 13454 13473 209 GCCT eddd TGCC dddd AGGC ddde ACTG eeee 609986 1986 2005 CAGA eeee 63 13455 13474 210 GGCC eddd TTGC dddd CAGG ddde CACT eeee 609987 1987 2006 GCAG eeee 36 13456 13475 211 AGGC eddd CTTG dddd CCAG ddde GCAC eeee 609988 1988 2007 GGCA eeee 48 13457 13476 212 GAGG eddd CCTT dddd GCCA ddde GGCA eeee 609989 1989 2008 GGGC eeee 55 13458 13477 213 AGAG eddd GCCT dddd TGCC ddde AGGC eeee 609990 2007 2026 CTTT eeee 38 13476 13495 214 GCCT eddd CAAA dddd GGCC ddde AGGG eeee 609991 2008 2027 CCTT eeee 12 13477 13496 215 TGCC eddd TCAA dddd AGGC ddde CAGG eeee 609992 2009 2028 GCCT eeee 11 13478 13497 216 TTGC eddd CTCA dddd AAGG ddde CCAG eeee 609993 2010 2029 GGCC eeee 16 13479 13498 217 TTTG eddd CCTC dddd AAAG ddde GCCA eeee 609994 2011 2030 TGGC eeee 13 13480 13499 218 CTTT eddd GCCT dddd CAAA ddde GGCC eeee 609995 2012 2031 CTGG eeee 13 13481 13500 219 CCTT eddd TGCC dddd TCAA ddde AGGC eeee 609996 2013 2032 GCTG eeee 35 13482 13501 220 GCCT eddd TTGC dddd CTCA ddde AAGG eeee 609997 2014 2033 TGCT eeee 20 13483 13502 221 GGCC eddd TTTG dddd CCTC ddde AAAG eeee 609998 2015 2034 CTGC eeee 33 13484 13503 222 TGGC eddd CTTT dddd GCCT ddde CAAA eeee 609999 2016 2035 GCTG eeee 69 13485 13504 223 CTGG eddd CCTT dddd TGCC ddde TCAA eeee 610000 2017 2036 TGCT eeee 55 13486 13505 224 GCTG eddd GCCT dddd TTGC ddde CTCA eeee 610001 2018 2037 CTGC eeee 73 13487 13506 225 TGCT eddd GGCC dddd TTTG ddde CCTC eeee 610002 2019 2038 TCTG eeee 72 13488 13507 226 CTGC eddd TGGC dddd CTTT ddde GCCT eeee 610003 2020 2039 ATCT eeee 69 13489 13508 227 GCTG eddd CTGG dddd CCTT ddde TGCC eeee 610004 2021 2040 TATC eeee 56 13490 13509 228 TGCT eddd GCTG dddd GCCT ddde TTGC eeee 610005 2022 2041 TTAT eeee 29 13491 13510 229 CTGC eddd TGCT dddd GGCC ddde TTTG eeee 610006 2023 2042 GTTA eeee 74 13492 13511 230 TCTG eddd CTGC dddd TGGC ddde CTTT eeee 610007 2024 2043 TGTT eeee 74 13493 13512 231 ATCT eddd GCTG dddd CTGG ddde CCTT eeee 610008 2025 2044 TTGT eeee 72 13494 13513 232 TATC eddd TGCT dddd GCTG ddde GCCT eeee 610009 2026 2045 GTTG eeee 73 13495 13514 233 TTAT eddd CTGC dddd TGCT ddde GGCC eeee 610010 2027 2046 GGTT eeee 83 13496 13515 234 GTTA eddd TCTG dddd CTGC ddde TGGC eeee 610011 2028 2047 GGGT eeee 76 13497 13516 235 TGTT eddd ATCT dddd GCTG ddde CTGG eeee 610012 2046 2065 ACAT eeee 79 13515 13534 236 CGCT eddd GATT dddd TGTC ddde CGGG eeee 610013 2047 2066 CACA eeee 79 13516 13535 237 TCGC eddd TGAT dddd TTGT ddde CCGG eeee 610014 2048 2067 ACAC eeee 77 13517 13536 238 ATCG eddd CTGA dddd TTTG ddde TCCG eeee 610015 2049 2068 GACA eeee 89 13518 13537 239 CATC eddd GCTG dddd ATTT ddde GTCC eeee 610016 2050 2069 TGAC eeee 83 13519 13538 240 ACAT eddd CGCT dddd GATT ddde TGTC eeee 610017 2051 2070 GTGA eeee 74 13520 13539 241 CACA eddd TCGC dddd TGAT ddde TTGT eeee 610018 2052 2071 GGTG eeee 74 13521 13540 242 ACAC eddd ATCG dddd CTGA ddde TTTG eeee 610019 2053 2072 GGGT eeee 76 13522 13541 243 GACA eddd CATC dddd GCTG ddde ATTT eeee 610020 2073 2092 AAGA eeee 24 13542 13561 244 AAAG eddd GTGG dddd GAGA ddde CTGG eeee 610021 2074 2093 GAAG eeee 23 13543 13562 245 AAAA eddd GGTG dddd GGAG ddde ACTG eeee 610022 2075 2094 AGAA eeee 26 13544 13563 246 GAAA eddd AGGT dddd GGGA ddde GACT eeee 610023 2076 2095 TAGA eeee 24 13545 13564 247 AGAA eddd AAGG dddd TGGG ddde AGAC eeee 610024 2077 2096 TTAG eeee 19 13546 13565 248 AAGA eddd AAAG dddd GTGG ddde GAGA eeee 610025 2078 2097 ATTA eeee 30 13547 13566 249 GAAG eddd AAAA dddd GGTG ddde GGAG eeee 610026 2079 2098 CATT eeee 40 13548 13567 250 AGAA eddd GAAA dddd AGGT ddde GGGA eeee 610027 2080 2099 TCAT eeee 56 13549 13568 251 TAGA eddd AGAA dddd AAGG ddde TGGG eeee 610028 2081 2100 CTCA eeee 74 13550 13569 252 TTAG eddd AAGA dddd AAAG ddde GTGG eeee 610029 2082 2101 ACTC eeee 62 13551 13570 253 ATTA eddd GAAG dddd AAAA ddde GGTG eeee 610030 2083 2102 GACT eeee 69 13552 13571 254 CATT eddd AGAA dddd GAAA ddde AGGT eeee 610031 2084 2103 CGAC eeee 59 13553 13572 255 TCAT eddd TAGA dddd AGAA ddde AAGG eeee 610032 2085 2104 TCGA eeee 50 13554 13573 256 CTCA eddd TTAG dddd AAGA ddde AAAG eeee 610033 2086 2105 GTCG eeee 67 13555 13574 257 ACTC eddd ATTA dddd GAAG ddde AAAA eeee 610034 2087 2106 AGTC eeee 62 13556 13575 258 GACT eddd CATT dddd AGAA ddde GAAA eeee 610035 2088 2107 AAGT eeee 45 13557 13576 259 CGAC eddd TCAT dddd TAGA ddde AGAA eeee 610036 2089 2108 AAAG eeee 43 13558 13577 260 TCGA eddd CTCA dddd TTAG ddde AAGA eeee 610037 2090 2109 CAAA eeee 46 13559 13578 261 GTCG eddd ACTC dddd ATTA ddde GAAG eeee 610038 2091 2110 TCAA eeee 67 13560 13579 262 AGTC eddd GACT dddd CATT ddde AGAA eeee 610039 2092 2111 CTCA eeee 65 13561 13580 263 AAGT eddd CGAC dddd TCAT ddde TAGA eeee 610040 2093 2112 GCTC eeee 74 13562 13581 264 AAAG eddd TCGA dddd CTCA ddde TTAG eeee 610041 2094 2113 AGCT eeee 61 13563 13582 265 CAAA eddd GTCG dddd ACTC ddde ATTA eeee 610042 2095 2114 CAGC eeee 71 13564 13583 266 TCAA eddd AGTC dddd GACT ddde CATT eeee 610043 2096 2115 CCAG eeee 77 13565 13584 267 CTCA eddd AAGT dddd CGAC ddde TCAT eeee 610044 2097 2116 TCCA eeee 82 13566 13585 268 GCTC eddd AAAG dddd TCGA ddde CTCA eeee 610045 2098 2117 TTCC eeee 80 13567 13586 269 AGCT eddd CAAA dddd GTCG ddde ACTC eeee 610046 2099 2118 TTTC eeee 84 13568 13587 270 CAGC eddd TCAA dddd AGTC ddde GACT eeee 610047 2100 2119 CTTT eeee 65 13569 13588 271 CCAG eddd CTCA dddd AAGT ddde CGAC eeee 610048 2101 2120 GCTT eeee 61 13570 13589 272 TCCA eddd GCTC dddd AAAG ddde TCGA eeee 610049 2102 2121 TGCT eeee 69 13571 13590 273 TTCC eddd AGCT dddd CAAA ddde GTCG eeee 610050 2103 2122 CTGC eeee 54 13572 13591 274 TTTC eddd CAGC dddd TCAA ddde AGTC eeee 610051 2104 2123 GCTG eeee 57 13573 13592 275 CTTT eddd CCAG dddd CTCA ddde AAGT eeee 610052 2105 2124 GGCT eeee 63 13574 13593 276 GCTT eddd TCCA dddd GCTC ddde AAAG eeee 610053 2106 2125 CGGC eeee 40 13575 13594 277 TGCT eddd TTCC dddd AGCT ddde CAAA eeee 610054 2107 2126 ACGG eeee 62 13576 13595 278 CTGC eddd TTTC dddd CAGC ddde TCAA eeee 610055 2108 2127 AACG eeee 69 13577 13596 279 GCTG eddd CTTT dddd CCAG ddde CTCA eeee 610056 2109 2128 AAAC eeee 54 13578 13597 280 GGCT eddd GCTT dddd TCCA ddde GCTC eeee 610057 2110 2129 GAAA eeee 64 13579 13598 281 CGGC eddd TGCT dddd TTCC ddde AGCT eeee 610058 2111 2130 AGAA eeee 57 13580 13599 282 ACGG eddd CTGC dddd TTTC ddde CAGC eeee 610059 2112 2131 GAGA eeee 56 13581 13600 283 AACG eddd GCTG dddd CTTT ddde CCAG eeee 610060 2113 2132 GGAG eeee 73 13582 13601 284 AAAC eddd GGCT dddd GCTT ddde TCCA eeee

Table 3 shows inhibition of AGT mRNA in HepG2 cells cultured at a density of 20,000 cells per well which were transfected using electroporation with 500 nM antisense oligonucleotide. After a treatment period of approximately 24 hours, RNA was isolated from the cells and AGT mRNA levels were measured by quantitative real-time PCR. Human primer probe set RTS3721 was used to measure mRNA levels. AGT mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN®. Results are presented as percent inhibition of AGT, relative to untreated control cells.

TABLE 3 Inhibition of AGT mRNA by MOE and/or cEt containing gapmers targeting SEQ ID NO: 1 and/or 2  SEQ SEQ SEQ SEQ ID: ID: % ID: ID 1 1 Inhi- 2 2: SEQ ISIS Start Stop bi- Start Stop ID NO Site Site Sequence Chemistry tion Site Site NO 568637 2046 2061 CGCTGATTTGTCCGGG eekddddddddddkke 65 13515 13530 129 568637 2046 2061 CGCTGATTTGTCCGGG eekddddddddddkke 75 13515 13530 129 568637 2046 2061 CGCTGATTTGTCCGGG eekddddddddddkke 0 13515 13530 129 568637 2046 2061 CGCTGATTTGTCCGGG eekddddddddddkke 72 13515 13530 129 568637 2046 2061 CGCTGATTTGTCCGGG eekddddddddddkke 65 13515 13530 129 594622 2027 2042 GTTATCTGCTGCTGGC kkkddddddddddkkk 80 13496 13511 163 594622 2027 2042 GTTATCTGCTGCTGGC kkkddddddddddkkk 81 13496 13511 163 594622 2027 2042 GTTATCTGCTGCTGGC kkkddddddddddkkk 81 13496 13511 163 594622 2027 2042 GTTATCTGCTGCTGGC kkkddddddddddkkk 76 13496 13511 163 594622 2027 2042 GTTATCTGCTGCTGGC kkkddddddddddkkk 88 13496 13511 163 594625 2047 2062 TCGCTGATTTGTCCGG kkkddddddddddkkk 68 13516 13531 165 594625 2047 2062 TCGCTGATTTGTCCGG kkkddddddddddkkk 75 13516 13531 165 594625 2047 2062 TCGCTGATTTGTCCGG kkkddddddddddkkk 62 13516 13531 165 594625 2047 2062 TCGCTGATTTGTCCGG kkkddddddddddkkk 54 13516 13531 165 594625 2047 2062 TCGCTGATTTGTCCGG kkkddddddddddkkk 81 13516 13531 165 611901 1 16 TGCCCGCTCATGGGAT ekkddddddddddkke 13 1986 2001 14 611902 6 21 CCTGCTGCCCGCTCAT ekkddddddddddkke 19 1991 2006 285 611903 11 26 CTGACCCTGCTGCCCG ekkddddddddddkke 19 1996 2011 286 611904 16 31 CACTTCTGACCCTGCT ekkddddddddddkke 0 2001 2016 287 611905 35 50 GCTTAGGCAACACGGG ekkddddddddddkke 0 2020 2035 16 611906 40 55 GTCTTGCTTAGGCAAC ekkddddddddddkke 27 2025 2040 288 611907 45 60 GGAGAGTCTTGCTTAG ekkddddddddddkke 0 2030 2045 17 611908 67 82 GGTGCAGAGGGCAGAG ekkddddddddddkke 0 2052 2067 289 611909 72 87 CCGGAGGTGCAGAGGG ekkddddddddddkke 17 2057 2072 290 611910 77 92 GCAGGCCGGAGGTGCA ekkddddddddddkke 10 2062 2077 291 611911 82 97 GACATGCAGGCCGGAG ekkddddddddddkke 16 2067 2082 292 611912 87 102 ACAGGGACATGCAGGC ekkddddddddddkke 20 2072 2087 293 611913 92 107 AGGCCACAGGGACATG ekkddddddddddkke 5 2077 2092 294 611914 97 112 CCAAGAGGCCACAGGG ekkddddddddddkke 0 2082 2097 295 611915 102 117 TACCCCCAAGAGGCCA ekkddddddddddkke 0 2087 2102 296 611916 107 122 AGATGTACCCCCAAGA ekkddddddddddkke 8 2092 2107 297 611917 112 127 CCGGGAGATGTACCCC ekkddddddddddkke 16 2097 2112 298 611918 117 132 CAGCCCCGGGAGATGT ekkddddddddddkke 15 2102 2117 299 611919 122 137 TGACCCAGCCCCGGGA ekkddddddddddkke 4 2107 2122 20 611920 127 142 CCTTCTGACCCAGCCC ekkddddddddddkke 23 2112 2127 300 611921 132 147 CCAGGCCTTCTGACCC ekkddddddddddkke 20 2117 2132 301 611922 137 152 ACCACCCAGGCCTTCT ekkddddddddddkke 15 2122 2137 302 611923 142 157 GGCCAACCACCCAGGC ekkddddddddddkke 11 2127 2142 303 611924 147 162 CCTGAGGCCAACCACC ekkddddddddddkke 0 2132 2147 304 611925 152 167 GACAGCCTGAGGCCAA ekkddddddddddkke 18 2137 2152 305 611926 157 172 TGTGTGACAGCCTGAG ekkddddddddddkke 12 2142 2157 306 611927 162 177 CTAGGTGTGTGACAGC ekkddddddddddkke 23 2147 2162 307 611928 167 182 TCTCCCTAGGTGTGTG ekkddddddddddkke 9 2152 2167 308 611929 172 187 GAGCATCTCCCTAGGT ekkddddddddddkke 12 2157 2172 309 611930 177 192 AACGGGAGCATCTCCC ekkddddddddddkke 8 2162 2177 310 611931 182 197 CCAGAAACGGGAGCAT ekkddddddddddkke 9 2167 2182 311 611932 187 202 GGTTCCCAGAAACGGG ekkddddddddddkke 13 2172 2187 312 611933 192 207 GCCAAGGTTCCCAGAA ekkddddddddddkke 33 2177 2192 313 611934 208 223 GTTTGCAGGAGTCGGG ekkddddddddddkke 17 2193 2208 314 611935 213 228 CCGAAGTTTGCAGGAG ekkddddddddddkke 27 2198 2213 315 611936 218 233 ATTTACCGAAGTTTGC ekkddddddddddkke 7 2203 2218 316 611937 223 238 TACACATTTACCGAAG ekkddddddddddkke 14 2208 2223 317 611938 228 243 CGAGTTACACATTTAC ekkddddddddddkke 12 2213 2228 318 611939 233 248 AGGGTCGAGTTACACA ekkddddddddddkke 9 2218 2233 319 611940 238 253 GGTGCAGGGTCGAGTT ekkddddddddddkke 28 2223 2238 320 611941 243 258 GAGCCGGTGCAGGGTC ekkddddddddddkke 26 2228 2243 321 611942 248 263 AGAGTGAGCCGGTGCA ekkddddddddddkke 8 2233 2248 27 611943 253 268 TGAACAGAGTGAGCCG ekkddddddddddkke 16 2238 2253 322 611944 258 273 ACTGCTGAACAGAGTG ekkddddddddddkke 17 2243 2258 28 611945 263 278 GTTTCACTGCTGAACA ekkddddddddddkke 17 2248 2263 323 611946 268 283 GCAGAGTTTCACTGCT ekkddddddddddkke 0 2253 2268 29 611947 273 288 TCGATGCAGAGTTTCA ekkddddddddddkke 2 2258 2273 324 611948 278 293 AGTGATCGATGCAGAG ekkddddddddddkke 12 2263 2278 30 611949 283 298 GTCTTAGTGATCGATG ekkddddddddddkke 0 2268 2283 325 611950 288 303 AGGAAGTCTTAGTGAT ekkddddddddddkke 3 2273 2288 31 611951 293 308 CTTCCAGGAAGTCTTA ekkddddddddddkke 10 2278 2293 326 611952 299 314 GGACCTCTTCCAGGAA ekkddddddddddkke 21 2284 2299 327 611953 304 319 CGCTGGGACCTCTTCC ekkddddddddddkke 20 2289 2304 328 611954 309 324 ACTCACGCTGGGACCT ekkddddddddddkke 0 2294 2309 329 611955 314 329 GCGACACTCACGCTGG ekkddddddddddkke 21 2299 2314 330 611956 319 334 CAGAAGCGACACTCAC ekkddddddddddkke 18 2304 2319 331 611957 324 339 GATGCCAGAAGCGACA ekkddddddddddkke 1 2309 2324 332 611958 329 344 GGACAGATGCCAGAAG ekkddddddddddkke 16 2314 2329 333 611959 334 349 CAGAAGGACAGATGCC ekkddddddddddkke 0 2319 2334 334 611960 339 354 CTGGCCAGAAGGACAG ekkddddddddddkke 13 2324 2339 335 611961 344 359 ACAGGCTGGCCAGAAG ekkddddddddddkke 15 2329 2344 336 611962 349 364 AGACCACAGGCTGGCC ekkddddddddddkke 17 2334 2349 337 611963 354 369 TGGCCAGACCACAGGC ekkddddddddddkke 21 2339 2354 338 611964 359 374 TCACTTGGCCAGACCA ekkddddddddddkke 7 2344 2359 339 611965 364 379 TTACATCACTTGGCCA ekkddddddddddkke 21 2349 2364 340 611966 369 384 GAGGGTTACATCACTT ekkddddddddddkke 20 2354 2369 341 611967 374 389 GAGAGGAGGGTTACAT ekkddddddddddkke 18 2359 2374 342 611968 386 401 GTGCACAGGCTGGAGA ekkddddddddddkke 4 2371 2386 36 611969 391 406 TGCCTGTGCACAGGCT ekkddddddddddkke 10 2376 2391 343 611970 396 411 CAGGCTGCCTGTGCAC ekkddddddddddkke 26 2381 2396 344 611971 401 416 GTTCCCAGGCTGCCTG ekkddddddddddkke 30 2386 2401 345 611972 406 421 GAGCTGTTCCCAGGCT ekkddddddddddkke 15 2391 2406 346 611973 411 426 GGATGGAGCTGTTCCC ekkddddddddddkke 19 2396 2411 347 611974 431 446 TATTTATAGCTGAGGG ekkddddddddddkke 11 2416 2431 37 611975 436 451 TGCCCTATTTATAGCT ekkddddddddddkke 20 2421 2436 348 611976 441 456 CACGATGCCCTATTTA ekkddddddddddkke 11 2426 2441 38 612381 1852 1867 CTCCAAGACCTCAGGC ekkddddddddddkke 4 13321 13336 349 612382 1855 1870 CACCTCCAAGACCTCA ekkddddddddddkke 18 13324 13339 350 612383 1858 1873 GGTCACCTCCAAGACC ekkddddddddddkke 0 13327 13342 351 612384 1861 1876 CAGGGTCACCTCCAAG ekkddddddddddkke 16 13330 13345 352 612385 1864 1879 GTTCAGGGTCACCTCC ekkddddddddddkke 28 13333 13348 353 612386 1867 1882 GCGGTTCAGGGTCACC ekkddddddddddkke 18 13336 13351 354 612387 1873 1888 GAATGGGCGGTTCAGG ekkddddddddddkke 6 13342 13357 355 612388 1876 1891 CAGGAATGGGCGGTTC ekkddddddddddkke 13 13345 13360 356 612389 1879 1894 AAACAGGAATGGGCGG ekkddddddddddkke 16 13348 13363 357 612390 1883 1898 CAGCAAACAGGAATGG ekkddddddddddkke 11 13352 13367 358 612391 1887 1902 TACACAGCAAACAGGA ekkddddddddddkke 8 13356 13371 359 612392 1892 1907 GATCATACACAGCAAA ekkddddddddddkke 6 13361 13376 360 612393 1895 1910 TTTGATCATACACAGC ekkddddddddddkke 15 13364 13379 361 612394 1898 1913 CGCTTTGATCATACAC ekkddddddddddkke 16 13367 13382 362 612395 1916 1931 GGAAGTGCAGGGCAGT ekkddddddddddkke 8 13385 13400 363 612396 1923 1938 CGGCCCAGGAAGTGCA ekkddddddddddkke 0 13392 13407 123 612397 1926 1941 ACGCGGCCCAGGAAGT ekkddddddddddkke 1 13395 13410 364 612398 1929 1944 GCCACGCGGCCCAGGA ekkddddddddddkke 6 13398 13413 365 612399 1932 1947 TTGGCCACGCGGCCCA ekkddddddddddkke 7 13401 13416 366 612400 1935 1950 GGGTTGGCCACGCGGC ekkddddddddddkke 29 13404 13419 367 612401 1938 1953 AGCGGGTTGGCCACGC ekkddddddddddkke 13 13407 13422 368 612402 1941 1956 CTCAGCGGGTTGGCCA ekkddddddddddkke 0 13410 13425 369 612403 1944 1959 GTGCTCAGCGGGTTGG ekkddddddddddkke 13 13413 13428 370 612404 1947 1962 GCTGTGCTCAGCGGGT ekkddddddddddkke 39 13416 13431 371 612405 1949 1964 ATGCTGTGCTCAGCGG ekkddddddddddkke 13 13418 13433 372 612406 1950 1965 CATGCTGTGCTCAGCG ekkddddddddddkke 20 13419 13434 373 612407 1951 1966 TCATGCTGTGCTCAGC ekkddddddddddkke 23 13420 13435 374 612408 1952 1967 CTCATGCTGTGCTCAG ekkddddddddddkke 29 13421 13436 375 612409 1954 1969 GCCTCATGCTGTGCTC ekkddddddddddkke 36 13423 13438 376 612410 1956 1971 TGGCCTCATGCTGTGC ekkddddddddddkke 0 13425 13440 377 612411 1957 1972 CTGGCCTCATGCTGTG ekkddddddddddkke 2 13426 13441 378 612412 1959 1974 CCCTGGCCTCATGCTG ekkddddddddddkke 5 13428 13443 379 612413 1960 1975 GCCCTGGCCTCATGCT ekkddddddddddkke 6 13429 13444 380 612414 1961 1976 GGCCCTGGCCTCATGC ekkddddddddddkke 0 13430 13445 126 612415 1976 1991 GGCACTGTGTTCTGGG ekkddddddddddkke 45 13445 13460 381 612416 1987 2002 AGGCCTTGCCAGGCAC ekkddddddddddkke 35 13456 13471 382 612417 1992 2007 GGCAGAGGCCTTGCCA ekkddddddddddkke 14 13461 13476 383 612418 2007 2022 GCCTCAAAGGCCAGGG ekkddddddddddkke 0 13476 13491 128 612419 2008 2023 TGCCTCAAAGGCCAGG ekkddddddddddkke 10 13477 13492 384 612420 2009 2024 TTGCCTCAAAGGCCAG ekkddddddddddkke 7 13478 13493 385 612421 2010 2025 TTTGCCTCAAAGGCCA ekkddddddddddkke 13 13479 13494 386 612422 2011 2026 CTTTGCCTCAAAGGCC ekkddddddddddkke 0 13480 13495 387 612423 2012 2027 CCTTTGCCTCAAAGGC ekkddddddddddkke 14 13481 13496 388 612424 2013 2028 GCCTTTGCCTCAAAGG ekkddddddddddkke 3 13482 13497 389 612425 2014 2029 GGCCTTTGCCTCAAAG ekkddddddddddkke 15 13483 13498 390 612426 2015 2030 TGGCCTTTGCCTCAAA ekkddddddddddkke 0 13484 13499 391 612427 2016 2031 CTGGCCTTTGCCTCAA ekkddddddddddkke 0 13485 13500 392 612428 2017 2032 GCTGGCCTTTGCCTCA ekkddddddddddkke 5 13486 13501 393 612429 2100 2115 CCAGCTCAAAGTCGAC ekkddddddddddkke 46 13569 13584 394 612430 2101 2116 TCCAGCTCAAAGTCGA ekkddddddddddkke 34 13570 13585 395 612431 2102 2117 TTCCAGCTCAAAGTCG ekkddddddddddkke 16 13571 13586 396 612432 2103 2118 TTTCCAGCTCAAAGTC ekkddddddddddkke 5 13572 13587 397 612433 2105 2120 GCTTTCCAGCTCAAAG ekkddddddddddkke 9 13574 13589 398 612434 2110 2125 CGGCTGCTTTCCAGCT ekkddddddddddkke 0 13579 13594 399 612435 2111 2126 ACGGCTGCTTTCCAGC ekkddddddddddkke 24 13580 13595 133 612436 2112 2127 AACGGCTGCTTTCCAG ekkddddddddddkke 14 13581 13596 400 612437 2113 2128 AAACGGCTGCTTTCCA ekkddddddddddkke 14 13582 13597 401 612438 2114 2129 GAAACGGCTGCTTTCC ekkddddddddddkke 13 13583 13598 402 612439 2115 2130 AGAAACGGCTGCTTTC ekkddddddddddkke 15 13584 13599 403 612440 2116 2131 GAGAAACGGCTGCTTT ekkddddddddddkke 33 13585 13600 404 612441 2117 2132 GGAGAAACGGCTGCTT ekkddddddddddkke 26 13586 13601 405 612442 2118 2133 AGGAGAAACGGCTGCT ekkddddddddddkke 50 13587 13602 406 612443 2119 2134 AAGGAGAAACGGCTGC ekkddddddddddkke 21 13588 13603 407 612444 2120 2135 CAAGGAGAAACGGCTG ekkddddddddddkke 30 13589 13604 408 612445 2121 2136 CCAAGGAGAAACGGCT ekkddddddddddkke 43 13590 13605 134 612446 2122 2137 ACCAAGGAGAAACGGC ekkddddddddddkke 32 13591 13606 409 612447 2123 2138 GACCAAGGAGAAACGG ekkddddddddddkke 33 13592 13607 410 612448 2124 2139 AGACCAAGGAGAAACG ekkddddddddddkke 55 13593 13608 411 612449 2125 2140 TAGACCAAGGAGAAAC ekkddddddddddkke 15 13594 13609 412 612450 2126 2141 TTAGACCAAGGAGAAA ekkddddddddddkke 17 13595 13610 413 612451 2128 2143 ACTTAGACCAAGGAGA ekkddddddddddkke 32 13597 13612 414 612452 2129 2144 CACTTAGACCAAGGAG ekkddddddddddkke 38 13598 13613 415 612453 2130 2145 ACACTTAGACCAAGGA ekkddddddddddkke 48 13599 13614 416 612454 2133 2148 AGCACACTTAGACCAA ekkddddddddddkke 29 13602 13617 417 612455 2134 2149 CAGCACACTTAGACCA ekkddddddddddkke 31 13603 13618 418 612456 2135 2150 GCAGCACACTTAGACC ekkddddddddddkke 13 13604 13619 419 612457 2136 2151 TGCAGCACACTTAGAC ekkddddddddddkke 18 13605 13620 420 612458 2137 2152 ATGCAGCACACTTAGA ekkddddddddddkke 0 13606 13621 421 612459 2138 2153 CATGCAGCACACTTAG ekkddddddddddkke 0 13607 13622 422 612460 2139 2154 CCATGCAGCACACTTA ekkddddddddddkke 0 13608 13623 423 612461 2140 2155 TCCATGCAGCACACTT ekkddddddddddkke 24 13609 13624 424 612462 2141 2156 CTCCATGCAGCACACT ekkddddddddddkke 40 13610 13625 425 612463 2142 2157 ACTCCATGCAGCACAC ekkddddddddddkke 0 13611 13626 426 612464 2143 2158 CACTCCATGCAGCACA ekkddddddddddkke 18 13612 13627 427 612465 2144 2159 TCACTCCATGCAGCAC ekkddddddddddkke 14 13613 13628 428 612466 2162 2177 GCTGCAGGCTTCTACT ekkddddddddddkke 12 13631 13646 429 612467 2163 2178 CGCTGCAGGCTTCTAC ekkddddddddddkke 2 13632 13647 430 612468 2164 2179 CCGCTGCAGGCTTCTA ekkddddddddddkke 2 13633 13648 431 612469 2165 2180 GCCGCTGCAGGCTTCT ekkddddddddddkke 12 13634 13649 432 612470 2166 2181 TGCCGCTGCAGGCTTC ekkddddddddddkke 1 13635 13650 136 612471 2167 2182 GTGCCGCTGCAGGCTT ekkddddddddddkke 12 13636 13651 433 612472 2168 2183 TGTGCCGCTGCAGGCT ekkddddddddddkke 31 13637 13652 434 612473 2169 2184 TTGTGCCGCTGCAGGC ekkddddddddddkke 20 13638 13653 435 612474 2170 2185 TTTGTGCCGCTGCAGG ekkddddddddddkke 27 13639 13654 436 612475 2171 2186 ATTTGTGCCGCTGCAG ekkddddddddddkke 29 13640 13655 437 612476 2172 2187 CATTTGTGCCGCTGCA ekkddddddddddkke 33 13641 13656 438 612477 2173 2188 GCATTTGTGCCGCTGC ekkddddddddddkke 48 13642 13657 439 612478 2174 2189 TGCATTTGTGCCGCTG ekkddddddddddkke 13 13643 13658 440 612479 2175 2190 GTGCATTTGTGCCGCT ekkddddddddddkke 49 13644 13659 441 612480 2176 2191 GGTGCATTTGTGCCGC ekkddddddddddkke 32 13645 13660 137 612481 2177 2192 AGGTGCATTTGTGCCG ekkddddddddddkke 40 13646 13661 442 612482 2178 2193 GAGGTGCATTTGTGCC ekkddddddddddkke 48 13647 13662 443 612483 2179 2194 GGAGGTGCATTTGTGC ekkddddddddddkke 17 13648 13663 444 612484 2180 2195 GGGAGGTGCATTTGTG ekkddddddddddkke 15 13649 13664 445 612485 2181 2196 TGGGAGGTGCATTTGT ekkddddddddddkke 25 13650 13665 446 612486 2182 2197 CTGGGAGGTGCATTTG ekkddddddddddkke 25 13651 13666 447 612487 2183 2198 ACTGGGAGGTGCATTT ekkddddddddddkke 19 13652 13667 448 612488 2184 2199 AACTGGGAGGTGCATT ekkddddddddddkke 0 13653 13668 449 612489 2185 2200 AAACTGGGAGGTGCAT ekkddddddddddkke 14 13654 13669 450 612490 2186 2201 CAAACTGGGAGGTGCA ekkddddddddddkke 53 13655 13670 451 612491 2187 2202 GCAAACTGGGAGGTGC ekkddddddddddkke 63 13656 13671 452 612492 2188 2203 AGCAAACTGGGAGGTG ekkddddddddddkke 26 13657 13672 453 612493 2192 2207 ACCCAGCAAACTGGGA ekkddddddddddkke 0 13661 13676 454 612494 2193 2208 AACCCAGCAAACTGGG ekkddddddddddkke 0 13662 13677 455 612495 2195 2210 TAAACCCAGCAAACTG ekkddddddddddkke 8 13664 13679 456 612496 2196 2211 ATAAACCCAGCAAACT ekkddddddddddkke 4 13665 13680 457 612497 2210 2225 CCCCATTCTCTAAAAT ekkddddddddddkke 24 13679 13694 458 612498 2211 2226 CCCCCATTCTCTAAAA ekkddddddddddkke 0 13680 13695 459 612499 2212 2227 ACCCCCATTCTCTAAA ekkddddddddddkke 0 13681 13696 460 612500 2213 2228 CACCCCCATTCTCTAA ekkddddddddddkke 6 13682 13697 461 612501 2214 2229 CCACCCCCATTCTCTA ekkddddddddddkke 39 13683 13698 462 612502 2226 2241 GTTCTTGCCTCCCCAC ekkddddddddddkke 61 13695 13710 463 612503 2227 2242 GGTTCTTGCCTCCCCA ekkddddddddddkke 76 13696 13711 464 612504 2228 2243 TGGTTCTTGCCTCCCC ekkddddddddddkke 59 13697 13712 465 612505 2229 2244 CTGGTTCTTGCCTCCC ekkddddddddddkke 66 13698 13713 466 612506 2230 2245 ACTGGTTCTTGCCTCC ekkddddddddddkke 70 13699 13714 467 612507 2231 2246 CACTGGTTCTTGCCTC ekkddddddddddkke 57 13700 13715 468 612508 2232 2247 ACACTGGTTCTTGCCT ekkddddddddddkke 45 13701 13716 469 612509 2233 2248 AACACTGGTTCTTGCC ekkddddddddddkke 66 13702 13717 470 612510 2234 2249 AAACACTGGTTCTTGC ekkddddddddddkke 52 13703 13718 471 612511 2235 2250 TAAACACTGGTTCTTG ekkddddddddddkke 17 13704 13719 472 612512 2236 2251 CTAAACACTGGTTCTT ekkddddddddddkke 35 13705 13720 473 612513 2237 2252 GCTAAACACTGGTTCT ekkddddddddddkke 53 13706 13721 474 612514 2238 2253 CGCTAAACACTGGTTC ekkddddddddddkke 56 13707 13722 475 612515 2239 2254 GCGCTAAACACTGGTT ekkddddddddddkke 59 13708 13723 476 612516 2240 2255 CGCGCTAAACACTGGT ekkddddddddddkke 66 13709 13724 477 612517 2241 2256 CCGCGCTAAACACTGG ekkddddddddddkke 57 13710 13725 478 612518 2242 2257 CCCGCGCTAAACACTG ekkddddddddddkke 35 13711 13726 479 612519 2243 2258 TCCCGCGCTAAACACT ekkddddddddddkke 60 13712 13727 480 612520 2244 2259 GTCCCGCGCTAAACAC ekkddddddddddkke 38 13713 13728 481 612521 2245 2260 AGTCCCGCGCTAAACA ekkddddddddddkke 35 13714 13729 482 612522 2246 2261 TAGTCCCGCGCTAAAC ekkddddddddddkke 1 13715 13730 483 612524 2248 2263 AGTAGTCCCGCGCTAA ekkddddddddddkke 47 13717 13732 484 612525 2249 2264 CAGTAGTCCCGCGCTA ekkddddddddddkke 13 13718 13733 485 612526 2250 2265 ACAGTAGTCCCGCGCT ekkddddddddddkke 32 13719 13734 486 612527 2251 2266 AACAGTAGTCCCGCGC ekkddddddddddkke 46 13720 13735 487 612528 2252 2267 GAACAGTAGTCCCGCG ekkddddddddddkke 27 13721 13736 488 612529 2253 2268 GGAACAGTAGTCCCGC ekkddddddddddkke 46 13722 13737 489 612530 2254 2269 TGGAACAGTAGTCCCG ekkddddddddddkke 17 13723 13738 490 612531 2255 2270 TTGGAACAGTAGTCCC ekkddddddddddkke 42 13724 13739 491 612532 2256 2271 TTTGGAACAGTAGTCC ekkddddddddddkke 14 13725 13740 492 612533 2257 2272 TTTTGGAACAGTAGTC ekkddddddddddkke 7 13726 13741 493 612534 2258 2273 TTTTTGGAACAGTAGT ekkddddddddddkke 4 13727 13742 494 612535 2259 2274 CTTTTTGGAACAGTAG ekkddddddddddkke 31 13728 13743 495 612536 2264 2279 GAATTCTTTTTGGAAC ekkddddddddddkke 6 13733 13748 496 612537 2265 2280 GGAATTCTTTTTGGAA ekkddddddddddkke 45 13734 13749 497 612538 2266 2281 TGGAATTCTTTTTGGA ekkddddddddddkke 42 13735 13750 498 612539 2267 2282 TTGGAATTCTTTTTGG ekkddddddddddkke 26 13736 13751 499 612540 2270 2285 CGGTTGGAATTCTTTT ekkddddddddddkke 61 13739 13754 500 612541 2271 2286 TCGGTTGGAATTCTTT ekkddddddddddkke 58 13740 13755 501 612542 2272 2287 GTCGGTTGGAATTCTT ekkddddddddddkke 60 13741 13756 502 612543 2273 2288 GGTCGGTTGGAATTCT ekkddddddddddkke 58 13742 13757 503 612544 2274 2289 TGGTCGGTTGGAATTC ekkddddddddddkke 46 13743 13758 138 612545 2275 2290 CTGGTCGGTTGGAATT ekkddddddddddkke 0 13744 13759 504 612546 2276 2291 GCTGGTCGGTTGGAAT ekkddddddddddkke 27 13745 13760 505 612547 2277 2292 AGCTGGTCGGTTGGAA ekkddddddddddkke 33 13746 13761 506 612548 2278 2293 AAGCTGGTCGGTTGGA ekkddddddddddkke 51 13747 13762 507 612549 2279 2294 CAAGCTGGTCGGTTGG ekkddddddddddkke 32 13748 13763 508 612550 2280 2295 ACAAGCTGGTCGGTTG ekkddddddddddkke 19 13749 13764 509 612551 2281 2296 AACAAGCTGGTCGGTT ekkddddddddddkke 39 13750 13765 510 612552 2282 2297 AAACAAGCTGGTCGGT ekkddddddddddkke 49 13751 13766 511 612553 2283 2298 CAAACAAGCTGGTCGG ekkddddddddddkke 63 13752 13767 512 612554 2284 2299 ACAAACAAGCTGGTCG ekkddddddddddkke 48 13753 13768 139 612555 2285 2300 CACAAACAAGCTGGTC ekkddddddddddkke 37 13754 13769 513 612556 2286 2301 TCACAAACAAGCTGGT ekkddddddddddkke 28 13755 13770 514 612557 2287 2302 TTCACAAACAAGCTGG ekkddddddddddkke 52 13756 13771 515 612558 2288 2303 TTTCACAAACAAGCTG ekkddddddddddkke 14 13757 13772 516 612559 2289 2304 GTTTCACAAACAAGCT ekkddddddddddkke 65 13758 13773 517 612560 2290 2305 TGTTTCACAAACAAGC ekkddddddddddkke 58 13759 13774 518 612561 2291 2306 TTGTTTCACAAACAAG ekkddddddddddkke 8 13760 13775 519 612562 2304 2319 AGGGAACACTTTTTTG ekkddddddddddkke 26 13773 13788 520 612563 2311 2326 CTTGAAAAGGGAACAC ekkddddddddddkke 29 13780 13795 140 612564 2312 2327 ACTTGAAAAGGGAACA ekkddddddddddkke 19 13781 13796 521 612565 2313 2328 AACTTGAAAAGGGAAC ekkddddddddddkke 2 13782 13797 522 612566 2316 2331 CTCAACTTGAAAAGGG ekkddddddddddkke 49 13785 13800 523 612567 2321 2336 TTGTTCTCAACTTGAA ekkddddddddddkke 58 13790 13805 524 612568 2322 2337 TTTGTTCTCAACTTGA ekkddddddddddkke 63 13791 13806 525 612569 2329 2344 CCCAATTTTTGTTCTC ekkddddddddddkke 65 13798 13813 526 612570 2330 2345 ACCCAATTTTTGTTCT ekkddddddddddkke 37 13799 13814 527 612571 2331 2346 AACCCAATTTTTGTTC ekkddddddddddkke 30 13800 13815 141 612572 2362 2377 GGCAATGCAAAAATGT ekkddddddddddkke 53 13831 13846 142 612573 2366 2381 CGAAGGCAATGCAAAA ekkddddddddddkke 7 13835 13850 528 612574 2367 2382 CCGAAGGCAATGCAAA ekkddddddddddkke 25 13836 13851 529 612575 2368 2383 ACCGAAGGCAATGCAA ekkddddddddddkke 36 13837 13852 530 612576 2369 2384 AACCGAAGGCAATGCA ekkddddddddddkke 36 13838 13853 531 612577 2370 2385 AAACCGAAGGCAATGC ekkddddddddddkke 29 13839 13854 532 612578 2371 2386 CAAACCGAAGGCAATG ekkddddddddddkke 6 13840 13855 533 612579 2372 2387 ACAAACCGAAGGCAAT ekkddddddddddkke 0 13841 13856 534 612580 2373 2388 TACAAACCGAAGGCAA ekkddddddddddkke 27 13842 13857 535 612581 2374 2389 ATACAAACCGAAGGCA ekkddddddddddkke 13 13843 13858 536 612582 2375 2390 AATACAAACCGAAGGC ekkddddddddddkke 0 13844 13859 537 612583 2376 2391 AAATACAAACCGAAGG ekkddddddddddkke 0 13845 13860 538 612584 2377 2392 TAAATACAAACCGAAG ekkddddddddddkke 25 13846 13861 539 612585 2378 2393 CTAAATACAAACCGAA ekkddddddddddkke 0 13847 13862 540 612586 2379 2394 ACTAAATACAAACCGA ekkddddddddddkke 19 13848 13863 541 612587 2380 2395 CACTAAATACAAACCG ekkddddddddddkke 15 13849 13864 542 612588 2382 2397 GACACTAAATACAAAC ekkddddddddddkke 0 13851 13866 543 612589 2385 2400 CAAGACACTAAATACA ekkddddddddddkke 9 13854 13869 544 612590 2386 2401 TCAAGACACTAAATAC ekkddddddddddkke 19 13855 13870 545 612591 2387 2402 TTCAAGACACTAAATA ekkddddddddddkke 0 13856 13871 546 612592 2388 2403 ATTCAAGACACTAAAT ekkddddddddddkke 2 13857 13872 547 612593 2389 2404 CATTCAAGACACTAAA ekkddddddddddkke 0 13858 13873 548 612594 2390 2405 ACATTCAAGACACTAA ekkddddddddddkke 8 13859 13874 549 612595 2391 2406 TACATTCAAGACACTA ekkddddddddddkke 1 13860 13875 143 612596 2392 2407 TTACATTCAAGACACT ekkddddddddddkke 3 13861 13876 550 612597 2393 2408 CTTACATTCAAGACAC ekkddddddddddkke 0 13862 13877 551 612598 2394 2409 TCTTACATTCAAGACA ekkddddddddddkke 0 13863 13878 552 612599 2395 2410 TTCTTACATTCAAGAC ekkddddddddddkke 0 13864 13879 553 612600 2398 2413 ATGTTCTTACATTCAA ekkddddddddddkke 10 13867 13882 554 612601 2401 2416 GTCATGTTCTTACATT ekkddddddddddkke 0 13870 13885 555 612602 2402 2417 GGTCATGTTCTTACAT ekkddddddddddkke 34 13871 13886 144 612603 2403 2418 AGGTCATGTTCTTACA ekkddddddddddkke 35 13872 13887 556 612604 2404 2419 GAGGTCATGTTCTTAC ekkddddddddddkke 37 13873 13888 557 612605 2405 2420 GGAGGTCATGTTCTTA ekkddddddddddkke 25 13874  13889 558 612606 2406 2421 CGGAGGTCATGTTCTT ekkddddddddddkke 31 13875  13890 559 612607 2407 2422 ACGGAGGTCATGTTCT ekkddddddddddkke 23 13876  13891 560 612608 2408 2423 CACGGAGGTCATGTTC ekkddddddddddkke 24 13877  13892 561 612685 2565 2580 TGGAGGCTTATTGTGG ekkddddddddddkke 25 14034  14049 562 612686 2566 2581 TTGGAGGCTTATTGTG ekkddddddddddkke 30 14035  14050 563 612687 2567 2582 TTTGGAGGCTTATTGT ekkddddddddddkke 20 14036  14051 564 612688 N/A N/A CGGCTTACCTTCTGCT ekkddddddddddkke 30 2483 2498 565 612689 N/A N/A CCTCCCGGCCTTTTCC ekkddddddddddkke 23 2562 2577 566 612690 N/A N/A TAGGGTGACCACTCTG ekkddddddddddkke 26 2897 2912 567 612691 N/A N/A AGCAAATCGAGGTTCA ekkddddddddddkke 25 2970 2985 568 612692 N/A N/A TATTAGTTCTCTTCAG ekkddddddddddkke 9 3047 3062 569 612693 N/A N/A CCTTTTAGCTTATCCC ekkddddddddddkke 24 3089 3104 570 612694 N/A N/A AATCTGCCTTTTAGCT ekkddddddddddkke 20 3095 3110 571 612695 N/A N/A CAATCTACGCTGCCCT ekkddddddddddkke 27 3124 3139 572 612696 N/A N/A AGCACCAATCTACGCT ekkddddddddddkke 16 3129 3144 573 612697 N/A N/A CATCCTGGAGAAGTAG ekkddddddddddkke 9 3276 3291 574 612698 N/A N/A GCATCCTGGAGAAGTA ekkddddddddddkke 13 3277 3292 575 612699 N/A N/A ATACAGCCCACATTCC ekkddddddddddkke 17 3316 3331 576 612700 N/A N/A CTGTACCATGTAGTTA ekkddddddddddkke 32 3418 3433 577 612701 N/A N/A CCACACCGGGCACTCT ekkddddddddddkke 12 3476 3491 578 612702 N/A N/A CCCACCACACCGGGCA ekkddddddddddkke 22 3480 3495 579 612703 N/A N/A TTCCCCACCACACCGG ekkddddddddddkke 19 3483 3498 580 612704 N/A N/A TTCACCCTGCAGCTTT ekkddddddddddkke 13 3497 3512 581 612705 N/A N/A CATAGTCCTCACCTTC ekkddddddddddkke 16 3537 3552 582 612706 N/A N/A GTGAAGATGACGGCTC ekkddddddddddkke 24 3615 3630 583 612707 N/A N/A TATGTCTCCCTACTTC ekkddddddddddkke 25 3651 3666 584 612708 N/A N/A GGGAGTAATGGTGCTC ekkddddddddddkke 33 3755 3770 585 612709 N/A N/A GTCCTGGGAGTAATGG ekkddddddddddkke 24 3760 3775 586 612710 N/A N/A GGGAACCGACTGCTGG ekkddddddddddkke 24 3977 3992 587 612711 N/A N/A CCTGTGGGAACCGACT ekkddddddddddkke 14 3982 3997 588 612712 N/A N/A CCTAATCTAGACAGTC ekkddddddddddkke 5 4024 4039 589 612713 N/A N/A CATCCGCTGTTCTCAG ekkddddddddddkke 2 4133 4148 590 612714 N/A N/A CTCCATCCGCTGTTCT ekkddddddddddkke 28 4136 4151 591 612715 N/A N/A GACTCCATCCGCTGTT ekkddddddddddkke 30 4138 4153 592 612716 N/A N/A TGACTCCATCCGCTGT ekkddddddddddkke 25 4139 4154 593 612717 N/A N/A GCTGAAGTACCTGGTG ekkddddddddddkke 34 4230 4245 594 612718 N/A N/A GCCCTCAACACGGTGC ekkddddddddddkke 25 4250 4265 595 612719 N/A N/A TGCCCTCAACACGGTG ekkddddddddddkke 20 4251 4266 596 612720 N/A N/A GTCATTCTTCTTACAT ekkddddddddddkke 14 4307 4322 597 612721 N/A N/A GCTTCCTTGGAGCTGT ekkddddddddddkke 5 4390 4405 598 612722 N/A N/A GTGTACTGCAATATCG ekkddddddddddkke 39 4446 4461 599 612723 N/A N/A CACTCATTTCTTGTGG ekkddddddddddkke 8 4468 4483 600 612724 N/A N/A TTGTACCACATCTCAC ekkddddddddddkke 21 4481 4496 601 612725 N/A N/A GTTCTCTCAAAGGCCT ekkddddddddddkke 32 4651 4666 602 612726 N/A N/A GCAGGGTTTAGAACCC ekkddddddddddkke 18 4694 4709 603 612727 N/A N/A TATGTAAGCAGGGTTT ekkddddddddddkke 11 4701 4716 604 612728 N/A N/A AAACCAGCTCTCAACC ekkddddddddddkke 5 4864 4879 605 612729 N/A N/A TAAGACATGCTCCTGC ekkddddddddddkke 12 5094 5109 606 612730 N/A N/A ACTTATGGCAGCCCAA ekkddddddddddkke 20 5116 5131 607 612731 N/A N/A TACTTATGGCAGCCCA ekkddddddddddkke 12 5117 5132 608 612732 N/A N/A CCATTATTTGGAGACA ekkddddddddddkke 9 5426 5441 609 612733 N/A N/A TGCCATCTAACCAGAT ekkddddddddddkke 15 5655 5670 610 612745 N/A N/A GTTTTCAGTAATGCCC ekkddddddddddkke 21 7085 7100 611

Table 4 shows inhibition of AGT mRNA in HepG2 cells cultured at a density of 20,000 cells per well which were transfected using electroporation with 1000 nM antisense oligonucleotide. After a treatment period of approximately 24 hours, RNA was isolated from the cells and AGT mRNA levels were measured by quantitative real-time PCR. Human primer probe set RTS3721 was used to measure mRNA levels. AGT mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN®. Results are presented as percent inhibition of AGT, relative to untreated control cells.

TABLE 4 Inhibition of AGT mRNA by MOE and/or cEt containing gapmers targeting SEQ ID NO: 1 and/or 2 SEQ SEQ SEQ SEQ ID: ID: % ID: ID 1 1 Inhi- 2 2: SEQ ISIS Start Stop Se- Chem- bi- Start Stop ID NO Site Site quence istry tion Site Site NO 568637 2046 2061 CGC eek 43 13515 13530 129 TGA ddd TTT ddd GTC ddd CGG dkk G e 568637 2046 2061 CGC eek 36 13515 13530 129 TGA ddd TTT ddd GTC ddd CGG dkk G e 568637 2046 2061 CGC eek 20 13515 13530 129 TGA ddd TTT ddd GTC ddd CGG dkk G e 568637 2046 2061 CGC eek 51 13515 13530 129 TGA ddd TTT ddd GTC ddd CGG dkk G e 594622 2027 2042 GTT kkk 92 13496 13511 163 ATC ddd TGC ddd TGC ddd TGG dkk C k 594622 2027 2042 GTT kkk 91 13496 13511 163 ATC ddd TGC ddd TGC ddd TGG dkk C k 594622 2027 2042 GTT kkk 92 13496 13511 163 ATC ddd TGC ddd TGC ddd TGG dkk C k 594622 2027 2042 GTT kkk 90 13496 13511 163 ATC ddd TGC ddd TGC ddd TGG dkk C k 594625 2047 2062 TCG kkk 79 13516 13531 165 CTG ddd ATT ddd TGT ddd CCG dkk G k 594625 2047 2062 TCG kkk 88 13516 13531 165 CTG ddd ATT ddd TGT ddd CCG dkk G k 594625 2047 2062 TCG kkk 80 13516 13531 165 CTG ddd ATT ddd TGT ddd CCG dkk G k 594625 2047 2062 TCG kkk 73 13516 13531 165 CTG ddd ATT ddd TGT ddd CCG dkk G k 611977 446 461 CGG ekk 13 2431 2446 612 GTC ddd ACG ddd ATG ddd CCC dkk T e 611978 451 466 CCG ekk 20 2436 2451 613 GCC ddd GGG ddd TCA ddd CGA dkk T e 611979 454 469 CCC ekk 26 2439 2454 614 CCG ddd GCC ddd GGG ddd TCA dkk C e 611980 457 472 CTT ekk 20 2442 2457 615 CCC ddd CCG ddd GCC ddd GGG dkk T e 611981 460 475 CTT ekk 24 2445 2460 616 CTT ddd CCC ddd CCG ddd GCC dkk G e 611982 463 478 CAG ekk 41 2448 2463 617 CTT ddd CTT ddd CCC ddd CCG dkk G e 611983 466 481 CGG ekk 15 2451 2466 618 CAG ddd CTT ddd CTT ddd CCC dkk C e 611984 469 484 CAA ekk 20 2454 2469 619 CGG ddd CAG ddd CTT ddd CTT dkk C e 611985 472 487 GAA ekk 27 2457 2472 620 CAA ddd CGG ddd CAG ddd CTT dkk C e 611986 475 490 CCA ekk 23 2460 2475 621 GAA ddd CAA ddd CGG ddd CAG dkk C e 611987 478 493 TAC ekk 40 2463 2478 39 CCA ddd GAA ddd CAA ddd CGG dkk C e 611988 481 496 TAG ekk 10 2466 2481 622 TAC ddd CCA ddd GAA ddd CAA dkk C e 611989 484 499 CTG ekk 21 2469 2484 623 TAG ddd TAC ddd CCA ddd GAA dkk C e 611990 487 502 CTG ekk 28 2472 2487 624 CTG ddd TAG ddd TAC ddd CCA dkk G e 611991 490 505 CTT ekk 33 2475 2490 625 CTG ddd CTG ddd TAG ddd TAC dkk C e 611992 493 508 ACC ekk 39 N/A N/A 626 CTT ddd CTG ddd CTG ddd TAG dkk T e 611993 496 511 CAT ekk 19 N/A N/A 627 ACC ddd CTT ddd CTG ddd CTG dkk T e 611994 499 514 CCG ekk 11 N/A N/A 628 CAT ddd ACC ddd CTT ddd CTG dkk C e 611995 502 517 CTT ekk 21 N/A N/A 629 CCG ddd CAT ddd ACC ddd CTT dkk C e 611996 505 520 TCG ekk 53 5722 5737 630 CTT ddd CCG ddd CAT ddd ACC dkk C e 611997 508 523 TGC ekk 6 5725 5740 631 TCG ddd CTT ddd CCG ddd CAT dkk A e 611998 511 526 GGG ekk 38 5728 5743 632 TGC ddd TCG ddd CTT ddd CCG dkk C e 611999 525 540 GCC ekk 31 5742 5757 40 ATC ddd TCA ddd GAC ddd TGG dkk G e 612000 533 548 CGG ekk 31 5750 5765 633 CAG ddd GAG ddd CCA ddd TCT dkk C e 612001 536 551 CAC ekk 19 5753 5768 634 CGG ddd CAG ddd GAG ddd CCA dkk T e 612002 539 554 TCA ekk 19 5756 5771 635 CAC ddd CGG ddd CAG ddd GAG dkk C e 612003 542 557 GGC ekk 41 5759 5774 636 TCA ddd CAC ddd CGG ddd CAG dkk G e 612004 545 560 TCA ekk 46 5762 5777 42 GGC ddd TCA ddd CAC ddd CGG dkk C e 612005 549 564 GCC ekk 18 5766 5781 637 CTC ddd AGG ddd CTC ddd ACA dkk C e 612006 552 567 GTG ekk 29 5769 5784 638 GCC ddd CTC ddd AGG ddd CTC dkk A e 612007 555 570 ATG ekk 32 5772 5787 43 GTG ddd GCC ddd CTC ddd AGG dkk C e 612008 561 576 CAG ekk 33 5778 5793 639 AGG ddd ATG ddd GTG ddd GCC dkk C e 612009 596 611 GGT ekk 38 5813 5828 44 CAC ddd CTG ddd CAG ddd CCA dkk G e 612010 599 614 CCC ekk 47 5816 5831 640 GGT ddd CAC ddd CTG ddd CAG dkk C e 612011 602 617 ACA ekk 29 5819 5834 641 CCC ddd GGT ddd CAC ddd CTG dkk C e 612012 605 620 TGT ekk 22 5822 5837 642 ACA ddd CCC ddd GGT ddd CAC dkk C e 612013 608 623 GTA ekk 5 5825 5840 643 TGT ddd ACA ddd CCC ddd GGT dkk C e 612014 611 626 GGT ekk 0 5828 5843 644 GTA ddd TGT ddd ACA ddd CCC dkk G e 612015 626 641 TGA ekk 21 5843 5858 645 CGA ddd GGT ddd GGA ddd AGG dkk G e 612016 629 644 GGA ekk 32 5846 5861 646 TGA ddd CGA ddd GGT ddd GGA dkk A e 612017 632 647 TGT ekk 48 5849 5864 647 GGA ddd TGA ddd CGA ddd GGT dkk G e 612018 635 650 CAT ekk 28 5852 5867 648 TGT ddd GGA ddd TGA ddd CGA dkk G e 612019 638 653 TCT ekk 34 5855 5870 649 CAT ddd TGT ddd GGA ddd TGA dkk C e 612020 639 654 CTC ekk 38 5856 5871 650 TCA ddd TTG ddd TGG ddd ATG dkk A e 612021 640 655 ACT ekk 45 5857 5872 651 CTC ddd ATT ddd GTG ddd GAT dkk G e 612022 641 656 TAC ekk 29 5858 5873 652 TCT ddd CAT ddd TGT ddd GGA dkk T e 612023 642 657 GTA ekk 46 5859 5874 653 CTC ddd TCA ddd TTG ddd TGG dkk A e 612024 643 658 GGT ekk 58 5860 5875 46 ACT ddd CTC ddd ATT ddd GTG dkk G e 612025 645 660 CAG ekk 59 5862 5877 654 GTA ddd CTC ddd TCA ddd TTG dkk T e 612026 646 661 ACA ekk 50 5863 5878 655 GGT ddd ACT ddd CTC ddd ATT dkk G e 612027 647 662 CAC ekk 37 5864 5879 656 AGG ddd TAC ddd TCT ddd CAT dkk T e 612028 648 663 TCA ekk 31 5865 5880 657 CAG ddd GTA ddd CTC ddd TCA dkk T e 612029 649 664 CTC ekk 22 5866 5881 658 ACA ddd GGT ddd ACT ddd CTC dkk A e 612030 652 667 CTG ekk 4 5869 5884 659 CTC ddd ACA ddd GGT ddd ACT dkk C e 612031 659 674 TTG ekk 39 5876 5891 660 CCA ddd GCT ddd GCT ddd CAC dkk A e 612032 662 677 CCT ekk 45 5879 5894 661 TTG ddd CCA ddd GCT ddd GCT dkk C e 612033 665 680 TGG ekk 30 5882 5897 662 CCT ddd TTG ddd CCA ddd GCT dkk G e 612034 668 683 CAT ekk 18 5885 5900 663 TGG ddd CCT ddd TTG ddd CCA dkk G e 612035 671 686 CGG ekk 18 5888 5903 664 CAT ddd TGG ddd CCT ddd TTG dkk C e 612036 674 689 TCC ekk 27 5891 5906 665 CGG ddd CAT ddd TGG ddd CCT dkk T e 612037 677 692 GCT ekk 15 5894 5909 666 TCC ddd CGG ddd CAT ddd TGG dkk C e 612038 680 695 TGG ekk 2 5897 5912 667 GCT ddd TCC ddd CGG ddd CAT dkk T e 612039 683 698 CTT ekk 44 5900 5915 668 TGG ddd GCT ddd TCC ddd CGG dkk C e 612040 686 701 GGT ekk 36 5903 5918 669 CTT ddd TGG ddd GCT ddd TCC dkk C e 612041 701 716 CAG ekk 42 5918 5933 670 GTA ddd TGA ddd AGG ddd TGG dkk G e 612042 704 719 GAG ekk 39 5921 5936 671 CAG ddd GTA ddd TGA ddd AGG dkk T e 612043 707 722 TTG ekk 28 5924 5939 672 GAG ddd CAG ddd GTA ddd TGA dkk A e 612044 710 725 GAA ekk 20 5927 5942 673 TTG ddd GAG ddd CAG ddd GTA dkk T e 612045 713 728 CCT ekk 7 5930 5945 50 GAA ddd TTG ddd GAG ddd CAG dkk G e 612046 716 731 TGG ekk 23 5933 5948 674 CCT ddd GAA ddd TTG ddd GAG dkk C e 612047 719 734 TCT ekk 29 5936 5951 675 TGG ddd CCT ddd GAA ddd TTG dkk G e 612048 722 737 ATG ekk 22 5939 5954 676 TCT ddd TGG ddd CCT ddd GAA dkk T e 612049 725 740 GGG ekk 35 5942 5957 677 ATG ddd TCT ddd TGG ddd CCT dkk G e 612050 739 754 CTT ekk 21 5956 5971 52 TTC ddd ATC ddd CAC ddd AGG dkk G e 612051 742 757 GGC ekk 3 5959 5974 678 CTT ddd TTC ddd ATC ddd CAC dkk A e 612052 745 760 TAG ekk 10 5962 5977 679 GGC ddd CTT ddd TTC ddd ATC dkk C e 612053 748 763 CTG ekk 5 5965 5980 680 TAG ddd GGC ddd CTT ddd TTC dkk A e 612054 751 766 GTC ekk 6 5968 5983 681 CTG ddd TAG ddd GGC ddd CTT dkk T e 612055 754 769 CTG ekk 19 5971 5986 682 GTC ddd CTG ddd TAG ddd GGC dkk C e 612056 758 773 CCA ekk 34 5975 5990 683 GCT ddd GGT ddd CCT ddd GTA dkk G e 612057 759 774 ACC ekk 31 5976 5991 684 AGC ddd TGG ddd TCC ddd TGT dkk A e 612058 762 777 AGC ekk 56 5979 5994 53 ACC ddd AGC ddd TGG ddd TCC dkk T e 612059 763 778 TAG ekk 35 5980 5995 685 CAC ddd CAG ddd CTG ddd GTC dkk C e 612060 764 779 CTA ekk 18 5981 5996 686 GCA ddd CCA ddd GCT ddd GGT dkk C e 612061 765 780 ACT ekk 10 5982 5997 687 AGC ddd ACC ddd AGC ddd TGG dkk T e 612062 766 781 GAC ekk 32 5983 5998 688 TAG ddd CAC ddd CAG ddd CTG dkk G e 612063 767 782 CGA ekk 49 5984 5999 689 CTA ddd GCA ddd CCA ddd GCT dkk G e 612064 768 783 GCG ekk 39 5985 6000 690 ACT ddd AGC ddd ACC ddd AGC dkk T e 612065 769 784 AGC ekk 29 5986 6001 691 GAC ddd TAG ddd CAC ddd CAG dkk C e 612066 770 785 CAG ekk 38 5987 6002 692 CGA ddd CTA ddd GCA ddd CCA dkk G e 612067 771 786 GCA ekk 39 5988 6003 693 GCG ddd ACT ddd AGC ddd ACC dkk A e 612068 772 787 TGC ekk 31 5989 6004 54 AGC ddd GAC ddd TAG ddd CAC dkk C e 612069 773 788 TTG ekk 28 5990 6005 694 CAG ddd CGA ddd CTA ddd GCA dkk C e 612070 774 789 TTT ekk 31 5991 6006 695 GCA ddd GCG ddd ACT ddd AGC dkk A e 612071 775 790 TTT ekk 28 5992 6007 696 TGC ddd AGC ddd GAC ddd TAG dkk C e 612072 776 791 GTT ekk 11 5993 6008 697 TTG ddd CAG ddd CGA ddd CTA dkk G e 612073 777 792 AGT ekk 7 5994 6009 698 TTT ddd GCA ddd GCG ddd ACT dkk A e 612074 778 793 AAG ekk 10 5995 6010 699 TTT ddd TGC ddd AGC ddd GAC dkk T e 612075 781 796 GTC ekk 49 5998 6013 700 AAG ddd TTT ddd TGC ddd AGC dkk G e 612076 784 799 GGT ekk 39 6001 6016 701 GTC ddd AAG ddd TTT ddd TGC dkk A e 612077 787 802 TTC ekk 53 6004 6019 702 GGT ddd GTC ddd AAG ddd TTT dkk T e 612078 790 805 GTC ekk 39 6007 6022 703 TTC ddd GGT ddd GTC ddd AAG dkk T e 612079 793 808 CTT ekk 35 6010 6025 704 GTC ddd TTC ddd GGT ddd GTC dkk A e 612080 796 811 CAA ekk 42 6013 6028 705 CTT ddd GTC ddd TTC ddd GGT dkk G e 612081 799 814 CCT ekk 1 6016 6031 706 CAA ddd CTT ddd GTC ddd TTC dkk G e 612082 802 817 GGC ekk 0 6019 6034 707 CCT ddd CAA ddd CTT ddd GTC dkk T e 612083 805 820 TGC ekk 13 6022 6037 708 GGC ddd CCT ddd CAA ddd CTT dkk G e 612084 808 823 CAT ekk 0 6025 6040 709 TGC ddd GGC ddd CCT ddd CAA dkk C e 612085 811 826 GAC ekk 30 6028 6043 710 CAT ddd TGC ddd GGC ddd CCT dkk C e 612086 814 829 CCC ekk 32 6031 6046 711 GAC ddd CAT ddd TGC ddd GGC dkk C e 612087 817 832 CAT ekk 49 6034 6049 712 CCC ddd GAC ddd CAT ddd TGC dkk G e 612088 820 835 CAG ekk 17 6037 6052 713 CAT ddd CCC ddd GAC ddd CAT dkk T e 612089 823 838 GGC ekk 46 6040 6055 714 CAG ddd CAT ddd CCC ddd GAC dkk C e 612090 826 841 GTT ekk 10 6043 6058 715 GGC ddd CAG ddd CAT ddd CCC dkk G e 612091 829 844 GAA ekk 0 6046 6061 716 GTT ddd GGC ddd CAG ddd CAT dkk C e 612092 832 847 CAA ekk 0 6049 6064 717 GAA ddd GTT ddd GGC ddd CAG dkk C e 612093 835 850 GCC ekk 0 6052 6067 59 CAA ddd GAA ddd GTT ddd GGC dkk C e 612094 838 853 GAA ekk 28 6055 6070 718 GCC ddd CAA ddd GAA ddd GTT dkk G e 612095 841 856 ACG ekk 13 6058 6073 719 GAA ddd GCC ddd CAA ddd GAA dkk G e 612096 844 859 TAT ekk 18 6061 6076 720 ACG ddd GAA ddd GCC ddd CAA dkk G e 612097 847 862 ATA ekk 0 6064 6079 721 TAT ddd ACG ddd GAA ddd GCC dkk C e 612098 850 865 GCC ekk 42 6067 6082 722 ATA ddd TAT ddd ACG ddd GAA dkk G e 612099 853 868 CAT ekk 20 6070 6085 723 GCC ddd ATA ddd TAT ddd ACG dkk G e 612100 856 871 GTG ekk 47 6073 6088 724 CAT ddd GCC ddd ATA ddd TAT dkk A e 612101 859 874 ACT ekk 52 6076 6091 725 GTG ddd CAT ddd GCC ddd ATA dkk T e 612102 862 877 CTC ekk 62 6079 6094 726 ACT ddd GTG ddd CAT ddd GCC dkk A e 612103 865 880 TAG ekk 45 6082 6097 727 CTC ddd ACT ddd GTG ddd CAT dkk G e 612104 868 883 CCA ekk 66 6085 6100 728 TAG ddd CTC ddd ACT ddd GTG dkk C e 612105 871 886 GCC ekk 16 6088 6103 62 CCA ddd TAG ddd CTC ddd ACT dkk G e 612107 877 892 GAC ekk 0 6094 6109 729 CAC ddd GCC ddd CCA ddd TAG dkk C e 612108 880 895 ATG ekk 0 6097 6112 730 GAC ddd CAC ddd GCC ddd CCA dkk T e 612109 884 899 CCC ekk 0 6101 6116 731 CAT ddd GGA ddd CCA ddd CGC dkk C e 612110 887 902 TGG ekk 24 6104 6119 732 CCC ddd CAT ddd GGA ddd CCA dkk C e 612111 890 905 CGG ekk 1 6107 6122 733 TGG ddd CCC ddd CAT ddd GGA dkk C e 612112 893 908 GGA ekk 4 6110 6125 734 CGG ddd TGG ddd CCC ddd CAT dkk G e 612113 896 911 AGA ekk 7 6113 6128 735 GGA ddd CGG ddd TGG ddd CCC dkk C e 612114 899 914 GGG ekk 28 6116 6131 736 AGA ddd GGA ddd CGG ddd TGG dkk C e 612115 913 928 AAA ekk 30 6130 6145 64 GAC ddd AGC ddd CGT ddd TGG dkk G e 612116 916 931 GCC ekk 45 6133 6148 737 AAA ddd GAC ddd AGC ddd CGT dkk T e 612117 919 934 GGT ekk 52 6136 6151 738 GCC ddd AAA ddd GAC ddd AGC dkk C e 612118 922 937 CAG ekk 20 6139 6154 739 GGT ddd GCC ddd AAA ddd GAC dkk A e 612119 926 941 AGG ekk 20 6143 6158 740 CCA ddd GGG ddd TGC ddd CAA dkk A e 612120 937 952 CAG ekk 0 6154 6169 66 ATA ddd GAG ddd AGA ddd GGC dkk C e 612121 940 955 TCC ekk 0 6157 6172 741 CAG ddd ATA ddd GAG ddd AGA dkk G e 612122 943 958 GGC ekk 11 6160 6175 742 TCC ddd CAG ddd ATA ddd GAG dkk A e 612123 946 961 CAA ekk 5 6163 6178 743 GGC ddd TCC ddd CAG ddd ATA dkk G e 612124 949 964 GTC ekk 14 6166 6181 744 CAA ddd GGC ddd TCC ddd CAG dkk A e 612125 952 967 GTG ekk 19 6169 6184 745 GTC ddd CAA ddd GGC ddd TCC dkk C e 612126 955 970 TGT ekk 25 6172 6187 746 GTG ddd GTC ddd CAA ddd GGC dkk T e 612127 958 973 AGC ekk 40 6175 6190 747 TGT ddd GTG ddd GTC ddd CAA dkk G e 612128 961 976 GTC ekk 22 6178 6193 748 AGC ddd TGT ddd GTG ddd GTC dkk C e 612281 1547 1562 CAG ekk 25 10558 10573 749 AGG ddd CAT ddd AGT ddd GAG dkk G e 612282 1550 1565 GGT ekk 20 10561 10576 103 CAG ddd AGG ddd CAT ddd AGT dkk G e 612283 1553 1568 CCA ekk 36 10564 10579 750 GGT ddd CAG ddd AGG ddd CAT dkk A e 612284 1557 1572 TTG ekk 24 10568 10583 751 TCC ddd AGG ddd TCA ddd GAG dkk G e 612285 1560 1575 ACC ekk 37 10571 10586 752 TTG ddd TCC ddd AGG ddd TCA dkk G e 612286 1566 1581 CCC ekk 9 10577 10592 753 TCC ddd ACC ddd TTG ddd TCC dkk A e 612287 1570 1585 GAG ekk 31 10581 10596 754 ACC ddd CTC ddd CAC ddd CTT dkk G e 612288 1574 1589 AAG ekk 5 10585 10600 755 TGA ddd GAC ddd CCT ddd CCA dkk C e 612289 1578 1593 TGG ekk 13 10589 10604 104 AAA ddd GTG ddd AGA ddd CCC dkk T e 612290 1581 1596 TGC ekk 27 10592 10607 756 TGG ddd AAA ddd GTG ddd AGA dkk C e 612291 1584 1599 TTT ekk 0 10595 10610 757 TGC ddd TGG ddd AAA ddd GTG dkk A e 612292 1587 1602 GAG ekk 15 10598 10613 758 TTT ddd TGC ddd TGG ddd AAA dkk G e 612293 1590 1605 AGG ekk 27 10601 10616 759 GAG ddd TTT ddd TGC ddd TGG dkk A e 612294 1594 1609 GTT ekk 0 10605 10620 760 GAG ddd GGA ddd GTT ddd TTG dkk C e 612295 1597 1612 CCA ekk 6 10608 10623 761 GTT ddd GAG ddd GGA ddd GTT dkk T e 612296 1600 1615 CAT ekk 8 10611 10626 762 CCA ddd GTT ddd GAG ddd GGA dkk G e 612297 1603 1618 CTT ekk 11 10614 10629 763 CAT ddd CCA ddd GTT ddd GAG dkk G e 612298 1612 1627 AGA ekk 0 10623 10638 764 TAG ddd TTT ddd CTT ddd CAT dkk C e 612299 1629 1644 AGG ekk 36 N/A N/A 765 TGG ddd ATG ddd GTC ddd CGG dkk G e 612300 1632 1647 GTC ekk 25 12238 12253 766 AGG ddd TGG ddd ATG ddd GTC dkk C e 612301 1636 1651 CAT ekk 26 12242 12257 767 GGT ddd CAG ddd GTG ddd GAT dkk G e 612302 1639 1654 GGG ekk 40 12245 12260 768 CAT ddd GGT ddd CAG ddd GTG dkk G e 612303 1653 1668 TGC ekk 33 12259 12274 109 AGC ddd ACC ddd AGT ddd TGG dkk G e 612304 1656 1671 CCT ekk 3 12262 12277 769 TGC ddd AGC ddd ACC ddd AGT dkk T e 612305 1659 1674 GAT ekk 12 12265 12280 770 CCT ddd TGC ddd AGC ddd ACC dkk A e 612306 1662 1677 TAA ekk 8 12268 12283 771 GAT ddd CCT ddd TGC ddd AGC dkk A e 612307 1665 1680 TCA ekk 8 12271 12286 772 TAA ddd GAT ddd CCT ddd TGC dkk A e 612308 1669 1684 CAG ekk 8 12275 12290 773 GTC ddd ATA ddd AGA ddd TCC dkk T e 612309 1672 1687 CTG ekk 0 12278 12293 774 CAG ddd GTC ddd ATA ddd AGA dkk T e 612310 1675 1690 GTC ekk 10 12281 12296 775 CTG ddd CAG ddd GTC ddd ATA dkk A e 612311 1682 1697 CGA ekk 32 12288 12303 776 GCA ddd GGT ddd CCT ddd GCA dkk G e 612312 1685 1700 GGG ekk 11 12291 12306 777 CGA ddd GCA ddd GGT ddd CCT dkk G e 612313 1688 1703 CCT ekk 22 12294 12309 778 GGG ddd CGA ddd GCA ddd GGT dkk C e 612314 1700 1715 CGG ekk 0 12306 12321 112 GCA ddd GCT ddd CAG ddd CCT dkk G e 612315 1703 1718 TGG ekk 55 12309 12324 779 CGG ddd GCA ddd GCT ddd CAG dkk C e 612316 1706 1721 GAA ekk 16 12312 12327 780 TGG ddd CGG ddd GCA ddd GCT dkk C e 612317 1709 1724 GCA ekk 16 12315 12330 781 GAA ddd TGG ddd CGG ddd GCA dkk G e 612318 1712 1727 TGT ekk 24 12318 12333 782 GCA ddd GAA ddd TGG ddd CGG dkk G e 612319 1715 1730 CGG ekk 35 12321 12336 783 TGT ddd GCA ddd GAA ddd TGG dkk C e 612320 1718 1733 GCT ekk 13 12324 12339 784 CGG ddd TGT ddd GCA ddd GAA dkk T e 612321 1721 1736 TCA ekk 28 12327 12342 785 GCT ddd CGG ddd TGT ddd GCA dkk G e 612322 1724 1739 GGT ekk 49 12330 12345 786 TCA ddd GCT ddd CGG ddd TGT dkk G e 612323 1727 1742 GCA ekk 53 12333 12348 787 GGT ddd TCA ddd GCT ddd CGG dkk T e 612324 1732 1747 TTT ekk 8 12338 12353 788 TTG ddd CAG ddd GTT ddd CAG dkk C e 612325 1735 1750 CAA ekk 14 12341 12356 789 TTT ddd TTG ddd CAG ddd GTT dkk C e 612326 1738 1753 GCT ekk 38 12344 12359 790 CAA ddd TTT ddd TTG ddd CAG dkk G e 612327 1741 1756 ATT ekk 2 12347 12362 791 GCT ddd CAA ddd TTT ddd TTG dkk C e 612328 1744 1759 GTC ekk 38 12350 12365 792 ATT ddd GCT ddd CAA ddd TTT dkk T e 612329 1747 1762 GCG ekk 32 12353 12368 793 GTC ddd ATT ddd GCT ddd CAA dkk T e 612330 1750 1765 GAT ekk 27 12356 12371 794 GCG ddd GTC ddd ATT ddd GCT dkk C e 612331 1753 1768 CCT ekk 15 12359 12374 795 GAT ddd GCG ddd GTC ddd ATT dkk G e 612332 1756 1771 CAC ekk 1 12362 12377 796 CCT ddd GAT ddd GCG ddd GTC dkk A e 612333 1759 1774 CCC ekk 11 12365 12380 797 CAC ddd CCT ddd GAT ddd GCG dkk G e 612334 1762 1777 CTC ekk 0 12368 12383 798 CCC ddd CAC ddd CCT ddd GAT dkk G e 612335 1771 1786 GTT ekk 12 N/A N/A 799 CAG ddd CAC ddd CTC ddd CCC dkk C e 612336 1774 1789 GCT ekk 57 N/A N/A 800 GTT ddd CAG ddd CAC ddd CTC dkk C e 612337 1777 1792 AAT ekk 29 13246 13261 801 GCT ddd GTT ddd CAG ddd CAC dkk C e 612338 1780 1795 AAA ekk 38 13249 13264 802 AAT ddd GCT ddd GTT ddd CAG dkk C e 612339 1793 1808 CTT ekk 0 13262 13277 803 CAA ddd GCT ddd CAA ddd AAA dkk A e 612340 1796 1811 CCG ekk 41 13265 13280 804 CTT ddd CAA ddd GCT ddd CAA dkk A e 612341 1799 1814 CAT ekk 27 13268 13283 805 CCG ddd CTT ddd CAA ddd GCT dkk C e 612342 1802 1817 TCT ekk 32 13271 13286 806 CAT ddd CCG ddd CTT ddd CAA dkk G e 612343 1805 1820 CTC ekk 26 13274 13289 807 TCT ddd CAT ddd CCG ddd CTT dkk C e 612344 1808 1823 GCT ekk 44 13277 13292 808 CTC ddd TCT ddd CAT ddd CCG dkk C e 612345 1812 1827 GTG ekk 15 13281 13296 809 GGC ddd TCT ddd CTC ddd TCA dkk T e 612346 1817 1832 ACT ekk 42 13286 13301 810 CTG ddd TGG ddd GCT ddd CTC dkk T e 612347 1820 1835 TAG ekk 55 13289 13304 811 ACT ddd CTG ddd TGG ddd GCT dkk C e 612348 1824 1839 TGG ekk 23 13293 13308 812 GTA ddd GAC ddd TCT ddd GTG dkk G e 612349 1827 1842 TGT ekk 30 13296 13311 119 TGG ddd GTA ddd GAC ddd TCT dkk G e 612350 1830 1845 AGC ekk 34 13299 13314 813 TGT ddd TGG ddd GTA ddd GAC dkk T e 612351 1833 1848 TTA ekk 13 13302 13317 814 AGC ddd TGT ddd TGG ddd GTA dkk G e 612352 1836 1851 TTG ekk 33 13305 13320 815 TTA ddd AGC ddd TGT ddd TGG dkk G e 612353 1839 1854 GGC ekk 30 13308 13323 816 TTG ddd TTA ddd AGC ddd TGT dkk T e 612354 1842 1857 TCA ekk 10 13311 13326 817 GGC ddd TTG ddd TTA ddd AGC dkk T e 612355 1845 1860 ACC ekk 17 13314 13329 818 TCA ddd GGC ddd TTG ddd TTA dkk A e 612356 1848 1863 AAG ekk 33 13317 13332 819 ACC ddd TCA ddd GGC ddd TTG dkk T e 612609 2409 2424 ACA ekk 20 13878 13893 820 CGG ddd AGG ddd TCA ddd TGT dkk T e 612610 2410 2425 TAC ekk 25 13879 13894 821 ACG ddd GAG ddd GTC ddd ATG dkk T e 612611 2411 2426 CTA ekk 24 13880 13895 822 CAC ddd GGA ddd GGT ddd CAT dkk G e 612612 2412 2427 ACT ekk 26 13881 13896 145 ACA ddd CGG ddd AGG ddd TCA dkk T e 612613 2413 2428 CAC ekk 30 13882 13897 823 TAC ddd ACG ddd GAG ddd GTC dkk A e 612614 2414 2429 ACA ekk 49 13883 13898 824 CTA ddd CAC ddd GGA ddd GGT dkk C e 612615 2415 2430 GAC ekk 56 13884 13899 825 ACT ddd ACA ddd CGG ddd AGG dkk T e 612616 2416 2431 AGA ekk 40 13885 13900 826 CAC ddd TAC ddd ACG ddd GAG dkk G e 612617 2417 2432 CAG ekk 48 13886 13901 827 ACA ddd CTA ddd CAC ddd GGA dkk G e 612618 2418 2433 ACA ekk 44 13887 13902 828 GAC ddd ACT ddd ACA ddd CGG dkk A e 612619 2419 2434 TAC ekk 39 13888 13903 829 AGA ddd CAC ddd TAC ddd ACG dkk G e 612620 2420 2435 TTA ekk 28 13889 13904 830 CAG ddd ACA ddd CTA ddd CAC dkk G e 612621 2421 2436 ATT ekk 21 13890 13905 831 ACA ddd GAC ddd ACT ddd ACA dkk C e 612622 2422 2437 TAT ekk 0 13891 13906 146 TAC ddd AGA ddd CAC ddd TAC dkk A e 612623 2423 2438 GTA ekk 35 13892 13907 832 TTA ddd CAG ddd ACA ddd CTA dkk C e 612624 2428 2443 CTA ekk 8 13897 13912 833 AGG ddd TAT ddd TAC ddd AGA dkk C e 612625 2429 2444 ACT ekk 14 13898 13913 834 AAG ddd GTA ddd TTA ddd CAG dkk A e 612626 2430 2445 AAC ekk 14 13899 13914 835 TAA ddd GGT ddd ATT ddd ACA dkk G e 612627 2431 2446 AAA ekk 12 13900 13915 836 CTA ddd AGG ddd TAT ddd TAC dkk A e 612628 2432 2447 AAA ekk 3 13901 13916 837 ACT ddd AAG ddd GTA ddd TTA dkk C e 612629 2438 2453 GTG ekk 0 13907 13922 838 GAA ddd AAA ddd ACT ddd AAG dkk G e 612630 2447 2462 CAA ekk 0 13916 13931 839 GCA ddd TCT ddd GTG ddd GAA dkk A e 612631 2449 2464 CAC ekk 20 13918 13933 840 AAG ddd CAT ddd CTG ddd TGG dkk A e 612632 2450 2465 TCA ekk 1 13919 13934 841 CAA ddd GCA ddd TCT ddd GTG dkk G e 612633 2451 2466 ATC ekk 20 13920 13935 842 ACA ddd AGC ddd ATC ddd TGT dkk G e 612634 2452 2467 AAT ekk 2 13921 13936 843 CAC ddd AAG ddd CAT ddd CTG dkk T e 612635 2464 2479 GTA ekk 16 13933 13948 844 TTG ddd TTC ddd AAA ddd AAT dkk C e 612636 2465 2480 CGT ekk 0 13934 13949 845 ATT ddd GTT ddd CAA ddd AAA dkk T e 612637 2482 2497 GGT ekk 21 13951 13966 147 GCT ddd TGC ddd ATC ddd TTT dkk C e 612638 2483 2498 AGG ekk 13 13952 13967 846 TGC ddd TTG ddd CAT ddd CTT dkk T e 612639 2484 2499 CAG ekk 19 13953 13968 847 GTG ddd CTT ddd GCA ddd TCT dkk T e 612640 2485 2500 TCA ekk 38 13954 13969 848 GGT ddd GCT ddd TGC ddd ATC dkk T e 612641 2486 2501 TTC ekk 29 13955 13970 849 AGG ddd TGC ddd TTG ddd CAT dkk C e 612642 2487 2502 ATT ekk 19 13956 13971 850 CAG ddd GTG ddd CTT ddd GCA dkk T e 612643 2488 2503 AAT ekk 34 13957 13972 851 TCA ddd GGT ddd GCT ddd TGC dkk A e 612644 2489 2504 AAA ekk 24 13958 13973 852 TTC ddd AGG ddd TGC ddd TTG dkk C e 612645 2490 2505 GAA ekk 2 13959 13974 853 ATT ddd CAG ddd GTG ddd CTT dkk G e 612646 2491 2506 AGA ekk 5 13960 13975 854 AAT ddd TCA ddd GGT ddd GCT dkk T e 612647 2493 2508 ACA ekk 0 13962 13977 855 GAA ddd ATT ddd CAG ddd GTG dkk C e 612648 2502 2517 CGC ekk 22 13971 13986 856 ATT ddd CAA ddd ACA ddd GAA dkk A e 612649 2503 2518 CCG ekk 50 13972 13987 149 CAT ddd TCA ddd AAC ddd AGA dkk A e 612650 2504 2519 TCC ekk 35 13973 13988 857 GCA ddd TTC ddd AAA ddd CAG dkk A e 612651 2505 2520 TTC ekk 29 13974 13989 858 CGC ddd ATT ddd CAA ddd ACA dkk G e 612652 2506 2521 GTT ekk 25 13975 13990 859 CCG ddd CAT ddd TCA ddd AAC dkk A e 612653 2507 2522 GGT ekk 28 13976 13991 860 TCC ddd GCA ddd TTC ddd AAA dkk C e 612654 2508 2523 TGG ekk 38 13977 13992 861 TTC ddd CGC ddd ATT ddd CAA dkk A e 612655 2509 2524 ATG ekk 45 13978 13993 862 GTT ddd CCG ddd CAT ddd TCA dkk A e 612656 2510 2525 TAT ekk 42 13979 13994 863 GGT ddd TCC ddd GCA ddd TTC dkk A e 612657 2511 2526 CTA ekk 41 13980 13995 864 TGG ddd TTC ddd CGC ddd ATT dkk C e 612658 2512 2527 GCT ekk 58 13981 13996 865 ATG ddd GTT ddd CCG ddd CAT dkk T e 612659 2513 2528 AGC ekk 32 13982 13997 150 TAT ddd GGT ddd TCC ddd GCA dkk T e 612660 2514 2529 CAG ekk 46 13983 13998 866 CTA ddd TGG ddd TTC ddd CGC dkk A e 612661 2515 2530 CCA ekk 47 13984 13999 867 GCT ddd ATG ddd GTT ddd CCG dkk C e 612662 2516 2531 ACC ekk 60 13985 14000 868 AGC ddd TAT ddd GGT ddd TCC dkk G e 612663 2517 2532 AAC ekk 36 13986 14001 869 CAG ddd CTA ddd TGG ddd TTC dkk C e 612664 2518 2533 TAA ekk 0 13987 14002 870 CCA ddd GCT ddd ATG ddd GTT dkk C e 612665 2519 2534 ATA ekk 17 13988 14003 871 ACC ddd AGC ddd TAT ddd GGT dkk T e 612666 2521 2536 AAA ekk 3 13990 14005 872 TAA ddd CCA ddd GCT ddd ATG dkk G e 612667 2522 2537 GAA ekk 2 13991 14006 873 ATA ddd ACC ddd AGC ddd TAT dkk G e 612668 2523 2538 AGA ekk 4 13992 14007 874 AAT ddd AAC ddd CAG ddd CTA dkk T e 612669 2535 2550 CTA ekk 23 14004 14019 875 ACA ddd CAA ddd GGG ddd AGA dkk A e 612670 2536 2551 ACT ekk 13 14005 14020 876 AAC ddd ACA ddd AGG ddd GAG dkk A e 612671 2537 2552 TAC ekk 9 14006 14021 151 TAA ddd CAC ddd AAG ddd GGA dkk G e 612672 2538 2553 TTA ekk 51 14007 14022 877 CTA ddd ACA ddd CAA ddd GGG dkk A e 612673 2539 2554 ATT ekk 47 14008 14023 878 ACT ddd AAC ddd ACA ddd AGG dkk G e 612674 2540 2555 TAT ekk 16 14009 14024 879 TAC ddd TAA ddd CAC ddd AAG dkk G e 612675 2541 2556 TTA ekk 0 14010 14025 880 TTA ddd CTA ddd ACA ddd CAA dkk G e 612676 2543 2558 GTT ekk 0 14012 14027 881 TAT ddd TAC ddd TAA ddd CAC dkk A e 612677 2544 2559 CGT ekk 35 14013 14028 882 TTA ddd TTA ddd CTA ddd ACA dkk C e 612678 2558 2573 TTA ekk 28 14027 14042 152 TTG ddd TGG ddd CAA ddd GAC dkk G e 612679 2559 2574 CTT ekk 21 14028 14043 883 ATT ddd GTG ddd GCA ddd AGA dkk C e 612680 2560 2575 GCT ekk 16 14029 14044 884 TAT ddd TGT ddd GGC ddd AAG dkk A e 612681 2561 2576 GGC ekk 35 14030 14045 885 TTA ddd TTG ddd TGG ddd CAA dkk G e 612682 2562 2577 AGG ekk 34 14031 14046 886 CTT ddd ATT ddd GTG ddd GCA dkk A e 612683 2563 2578 GAG ekk 23 14032 14047 887 GCT ddd TAT ddd TGT ddd GGC dkk A e 612684 2564 2579 GGA ekk 0 14033 14048 888 GGC ddd TTA ddd TTG ddd TGG dkk C e

Table 5 shows inhibition of AGT mRNA in HepG2 cells cultured at a density of 20,000 cells per well which were transfected using electroporation with 1000 nM antisense oligonucleotide. After a treatment period of approximately 24 hours, RNA was isolated from the cells and AGT mRNA levels were measured by quantitative real-time PCR. Human primer probe set RTS3721 was used to measure mRNA levels. AGT mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN®. Results are presented as percent inhibition of AGT, relative to untreated control cells.

TABLE 5 Inhibition of AGT mRNA by MOE and/or cEt containing gapmers targeting SEQ ID NO: 1 and/or 2 SEQ SEQ SEQ SEQ ID: ID: % ID: ID 1 1 Inhi- 2 2: SEQ ISIS Start Stop Se- Chem- bi- Start Stop ID NO Site Site quence istry tion Site Site NO 568637 2046 2061 CGC eek 87 13515 13530 129 TGA ddd TTT ddd GTC ddd CGG dkk G e 568637 2046 2061 CGC eek 90 13515 13530 129 TGA ddd TTT ddd GTC ddd CGG dkk G e 568637 2046 2061 CGC eek 95 13515 13530 129 TGA ddd TTT ddd GTC ddd CGG dkk G e 568637 2046 2061 CGC eek 94 13515 13530 129 TGA ddd TTT ddd GTC ddd CGG dkk G e 594622 2027 2042 GTT kkk 6 13496 13511 163 ATC ddd TGC ddd TGC ddd TGG dkk C k 594622 2027 2042 GTT kkk 83 13496 13511 163 ATC ddd TGC ddd TGC ddd TGG dkk C k 594622 2027 2042 GTT kkk 86 13496 13511 163 ATC ddd TGC ddd TGC ddd TGG dkk C k 594622 2027 2042 GTT kkk 85 13496 13511 163 ATC ddd TGC ddd TGC ddd TGG dkk C k 594625 2047 2062 TCG kkk 0 13516 13531 165 CTG ddd ATT ddd TGT ddd CCG dkk G k 594625 2047 2062 TCG kkk 64 13516 13531 165 CTG ddd ATT ddd TGT ddd CCG dkk G k 594625 2047 2062 TCG kkk 74 13516 13531 165 CTG ddd ATT ddd TGT ddd CCG dkk G k 594625 2047 2062 TCG kkk 70 13516 13531 165 CTG ddd ATT ddd TGT ddd CCG dkk G k 612129 965 980 GCC ekk 29 6182 6197 889 TGT ddd CAG ddd CTG ddd TGT dkk G e 612130 968 983 GTA ekk 44 6185 6200 890 GCC ddd TGT ddd CAG ddd CTG dkk T e 612131 971 986 CCT ekk 21 6188 6203 891 GTA ddd GCC ddd TGT ddd CAG dkk C e 612132 974 989 TTG ekk 38 6191 6206 892 CCT ddd GTA ddd GCC ddd TGT dkk C e 612133 977 992 GGA ekk 14 6194 6209 893 TTG ddd CCT ddd GTA ddd GCC dkk T e 612134 980 995 CCA ekk 46 6197 6212 894 GGA ddd TTG ddd CCT ddd GTA dkk G e 612135 983 998 CAC ekk 23 6200 6215 68 CCA ddd GGA ddd TTG ddd CCT dkk G e 612136 986 1001 GAA ekk 16 6203 6218 895 CAC ddd CCA ddd GGA ddd TTG dkk C e 612137 993 1008 TTC ekk 26 6210 6225 69 CAA ddd GGA ddd ACA ddd CCC dkk A e 612138 997 1012 GTC ekk 27 6214 6229 896 CTT ddd CCA ddd AGG ddd AAC dkk A e 612139 1000 1015 CTT ekk 57 6217 6232 897 GTC ddd CTT ddd CCA ddd AGG dkk A e 612140 1003 1018 GTT ekk 22 6220 6235 898 CTT ddd GTC ddd CTT ddd CCA dkk A e 612141 1006 1021 GCA ekk 42 6223 6238 899 GTT ddd CTT ddd GTC ddd CTT dkk C e 612142 1009 1024 GGT ekk 0 6226 6241 900 GCA ddd GTT ddd CTT ddd GTC dkk C e 612143 1012 1027 GGA ekk 0 6229 6244 901 GGT ddd GCA ddd GTT ddd CTT dkk G e 612144 1015 1030 CCG ekk 34 6232 6247 902 GGA ddd GGT ddd GCA ddd GTT dkk C e 612145 1018 1033 CAG ekk 30 6235 6250 903 CCG ddd GGA ddd GGT ddd GCA dkk G e 612146 1021 1036 ATC ekk 43 6238 6253 904 CAG ddd CCG ddd GGA ddd GGT dkk G e 612147 1024 1039 CGC ekk 63 6241 6256 905 ATC ddd CAG ddd CCG ddd GGA dkk G e 612148 1027 1042 GTG ekk 64 6244 6259 906 CGC ddd ATC ddd CAG ddd CCG dkk G e 612149 1030 1045 CTT ekk 4 6247 6262 907 GTG ddd CGC ddd ATC ddd CAG dkk C e 612150 1033 1048 GAC ekk 0 6250 6265 908 CTT ddd GTG ddd CGC ddd ATC dkk C e 612151 1036 1051 CAG ekk 46 6253 6268 909 GAC ddd CTT ddd GTG ddd CGC dkk A e 612152 1039 1054 AGA ekk 12 6256 6271 910 CAG ddd GAC ddd CTT ddd GTG dkk C e 612153 1042 1057 GGC ekk 24 6259 6274 911 AGA ddd CAG ddd GAC ddd CTT dkk G e 612154 1060 1075 GCC ekk 36 6277 6292 912 CTG ddd TAC ddd AGC ddd CTG dkk C e 612155 1064 1079 GCA ekk 19 6281 6296 913 GGC ddd CCT ddd GTA ddd CAG dkk C e 612156 1067 1082 CTA ekk 1 6284 6299 914 GCA ddd GGC ddd CCT ddd GTA dkk C e 612157 1071 1086 GCC ekk 0 6288 6303 915 ACT ddd AGC ddd AGG ddd CCC dkk T e 612158 1074 1089 TGG ekk 0 6291 6306 916 GCC ddd ACT ddd AGC ddd AGG dkk C e 612159 1077 1092 CCC ekk 27 6294 6309 917 TGG ddd GCC ddd ACT ddd AGC dkk A e 612160 1080 1095 CTG ekk 42 6297 6312 918 CCC ddd TGG ddd GCC ddd ACT dkk A e 612161 1088 1103 TAT ekk 28 6305 6320 74 CAG ddd CCC ddd TGC ddd CCT dkk G e 612162 1091 1106 GGC ekk 38 6308 6323 919 TAT ddd CAG ddd CCC ddd TGC dkk C e 612163 1094 1109 CCT ekk 38 6311 6326 920 GGC ddd TAT ddd CAG ddd CCC dkk T e 612164 1097 1112 GGG ekk 24 6314 6329 921 CCT ddd GGC ddd TAT ddd CAG dkk C e 612165 1100 1115 GCT ekk 0 6317 6332 922 GGG ddd CCT ddd GGC ddd TAT dkk C e 612166 1115 1130 CCG ekk 0 6332 6347 923 TGG ddd ACA ddd GCA ddd GCA dkk G e 612167 1118 1133 CCA ekk 28 6335 6350 924 CCG ddd TGG ddd ACA ddd GCA dkk G e 612168 1121 1136 CCA ekk 27 6338 6353 925 CCA ddd CCG ddd TGG ddd ACA dkk G e 612169 1124 1139 CGC ekk 11 6341 6356 926 CCA ddd CCA ddd CCG ddd TGG dkk A e 612170 1127 1142 ACA ekk 18 6344 6359 927 CGC ddd CCA ddd CCA ddd CCG dkk T e 612171 1130 1145 TGA ekk 34 6347 6362 928 ACA ddd CGC ddd CCA ddd CCA dkk C e 612172 1133 1148 CTG ekk 37 6350 6365 929 TGA ddd ACA ddd CGC ddd CCA dkk C e 612173 1136 1151 GGG ekk 0 6353 6368 930 CTG ddd TGA ddd ACA ddd CGC dkk C e 612174 1151 1166 TCA ekk 5 6368 6383 78 GGT ddd GCA ddd GGC ddd CTG dkk G e 612175 1154 1169 GCT ekk 45 6371 6386 931 TCA ddd GGT ddd GCA ddd GGC dkk C e 612176 1157 1172 GCT ekk 30 6374 6389 932 GCT ddd TCA ddd GGT ddd GCA dkk G e 612177 1160 1175 ACG ekk 45 6377 6392 933 GCT ddd GCT ddd TCA ddd GGT dkk G e 612178 1163 1178 CAA ekk 17 6380 6395 934 ACG ddd GCT ddd GCT ddd TCA dkk G e 612179 1166 1181 GCA ekk 34 6383 6398 935 CAA ddd ACG ddd GCT ddd GCT dkk T e 612180 1169 1184 CCT ekk 0 6386 6401 936 GCA ddd CAA ddd ACG ddd GCT dkk G e 612181 1172 1187 GGC ekk 0 6389 6404 937 CCT ddd GCA ddd CAA ddd ACG dkk G e 612182 1182 1197 TAG ekk 38 6399 6414 80 AGA ddd GCC ddd AGG ddd CCC dkk T e 612183 1185 1200 GTA ekk 19 6402 6417 938 TAG ddd AGA ddd GCC ddd AGG dkk C e 612184 1203 1218 CGT ekk 26 6420 6435 81 GGG ddd AGG ddd ACC ddd ACA dkk G e 612185 1217 1232 TGA ekk 5 6434 6449 82 AGT ddd CCA ddd GAG ddd AGC dkk G e 612186 1220 1235 CTG ekk 45 6437 6452 939 TGA ddd AGT ddd CCA ddd GAG dkk A e 612187 1223 1238 GTT ekk 49 6440 6455 940 CTG ddd TGA ddd AGT ddd CCA dkk G e 612188 1226 1241 CCA ekk 23 6443 6458 941 GTT ddd CTG ddd TGA ddd AGT dkk C e 612189 1229 1244 CAT ekk 31 6446 6461 942 CCA ddd GTT ddd CTG ddd TGA dkk A e 612190 1232 1247 CAA ekk 30 6449 6464 943 CAT ddd CCA ddd GTT ddd CTG dkk T e 612191 1235 1250 CAG ekk 35 6452 6467 944 CAA ddd CAT ddd CCA ddd GTT dkk C e 612192 1244 1259 TCT ekk 61 6461 6476 84 TCT ddd CAG ddd CAG ddd CAA dkk C e 612193 1247 1262 CAA ekk 34 6464 6479 945 TCT ddd TCT ddd CAG ddd CAG dkk C e 612194 1250 1265 TGT ekk 44 6467 6482 946 CAA ddd TCT ddd TCT ddd CAG dkk C e 612195 1253 1268 ACC ekk 47 6470 6485 947 TGT ddd CAA ddd TCT ddd TCT dkk C e 612196 1256 1271 TGA ekk 18 6473 6488 948 ACC ddd TGT ddd CAA ddd TCT dkk T e 612197 1259 1274 GCA ekk 39 6476 6491 949 TGA ddd ACC ddd TGT ddd CAA dkk T e 612198 1262 1277 CCT ekk 35 6479 6494 950 GCA ddd TGA ddd ACC ddd TGT dkk C e 612199 1265 1280 CAG ekk 47 6482 6497 951 CCT ddd GCA ddd TGA ddd ACC dkk T e 612200 1267 1282 CAC ekk 26 6484 6499 952 AGC ddd CTG ddd CAT ddd GAA dkk C e 612201 1268 1283 TCA ekk 36 6485 6500 953 CAG ddd CCT ddd GCA ddd TGA dkk A e 612202 1274 1289 ATC ekk 68 6491 6506 954 CTG ddd TCA ddd CAG ddd CCT dkk G e 612203 1276 1291 CCA ekk 50 6493 6508 955 TCC ddd TGT ddd CAC ddd AGC dkk C e 612204 1277 1292 TCC ekk 7 6494 6509 956 ATC ddd CTG ddd TCA ddd CAG dkk C e 612205 1279 1294 CTT ekk 33 6496 6511 957 CCA ddd TCC ddd TGT ddd CAC dkk A e 612206 1282 1297 AGT ekk 54 6499 6514 958 CTT ddd CCA ddd TCC ddd TGT dkk C e 612207 1286 1301 AGC ekk 58 6503 6518 959 CAG ddd TCT ddd TCC ddd ATC dkk C e 612233 1399 1414 CAC ekk 7 10410 10425 960 CCA ddd GAA ddd CTC ddd CTG dkk G e 612234 1402 1417 GTC ekk 66 10413 10428 961 CAC ddd CCA ddd GAA ddd CTC dkk C e 612235 1405 1420 GTT ekk 73 10416 10431 962 GTC ddd CAC ddd CCA ddd GAA dkk C e 612236 1408 1423 GCT ekk 76 10419 10434 963 GTT ddd GTC ddd CAC ddd CCA dkk G e 612237 1411 1426 GGT ekk 25 10422 10437 964 GCT ddd GTT ddd GTC ddd CAC dkk C e 612238 1414 1429 TGA ekk 77 10425 10440 965 GGT ddd GCT ddd GTT ddd GTC dkk C e 612239 1417 1432 CAC ekk 92 10428 10443 966 TGA ddd GGT ddd GCT ddd GTT dkk G e 612240 1421 1436 CAG ekk 50 10432 10447 93 ACA ddd CTG ddd AGG ddd TGC dkk T e 612241 1429 1444 CAT ekk 0 10440 10455 967 GGG ddd AAC ddd AGA ddd CAC dkk T e 612242 1432 1447 GAG ekk 0 10443 10458 968 CAT ddd GGG ddd AAC ddd AGA dkk C e 612243 1435 1450 AGA ekk 6 10446 10461 969 GAG ddd CAT ddd GGG ddd AAC dkk A e 612244 1438 1453 GCC ekk 52 10449 10464 970 AGA ddd GAG ddd CAT ddd GGG dkk A e 612245 1441 1456 CAT ekk 63 10452 10467 971 GCC ddd AGA ddd GAG ddd CAT dkk G e 612246 1444 1459 GCC ekk 59 10455 10470 972 CAT ddd GCC ddd AGA ddd GAG dkk C e 612247 1447 1462 GGT ekk 76 10458 10473 973 GCC ddd CAT ddd GCC ddd AGA dkk G e 612248 1450 1465 GAA ekk 0 10461 10476 974 GGT ddd GCC ddd CAT ddd GCC dkk A e 612249 1453 1468 CTG ekk 47 10464 10479 975 GAA ddd GGT ddd GCC ddd CAT dkk G e 612250 1457 1472 AGT ekk 0 10468 10483 976 GCT ddd GGA ddd AGG ddd TGC dkk C e 612251 1460 1475 TCC ekk 11 10471 10486 977 AGT ddd GCT ddd GGA ddd AGG dkk T e 612252 1462 1477 ACT ekk 85 10473 10488 96 CCA ddd GTG ddd CTG ddd GAA dkk G e 612253 1463 1478 CAC ekk 31 10474 10489 978 TCC ddd AGT ddd GCT ddd GGA dkk A e 612254 1465 1480 GTC ekk 77 10476 10491 97 ACT ddd CCA ddd GTG ddd CTG dkk G e 612255 1466 1481 TGT ekk 58 10477 10492 979 CAC ddd TCC ddd AGT ddd GCT dkk G e 612256 1467 1482 ATG ekk 8 10478 10493 980 TCA ddd CTC ddd CAG ddd TGC dkk T e 612257 1468 1483 GAT ekk 35 10479 10494 981 GTC ddd ACT ddd CCA ddd GTG dkk C e 612258 1469 1484 GGA ekk 2 10480 10495 982 TGT ddd CAC ddd TCC ddd AGT dkk G e 612259 1470 1485 TGG ekk 15 10481 10496 983 ATG ddd TCA ddd CTC ddd CAG dkk T e 612260 1472 1487 CCT ekk 40 10483 10498 984 GGA ddd TGT ddd CAC ddd TCC dkk A e 612261 1475 1490 TGT ekk 46 10486 10501 985 CCT ddd GGA ddd TGT ddd CAC dkk T e 612262 1478 1493 AGT ekk 63 10489 10504 986 TGT ddd CCT ddd GGA ddd TGT dkk C e 612263 1481 1496 AGA ekk 65 10492 10507 987 AGT ddd TGT ddd CCT ddd GGA dkk T e 612264 1484 1499 CCG ekk 59 10495 10510 99 AGA ddd AGT ddd TGT ddd CCT dkk G e 612265 1487 1502 TCA ekk 0 10498 10513 988 CCG ddd AGA ddd AGT ddd TGT dkk C e 612266 1490 1505 GAG ekk 68 10501 10516 989 TCA ddd CCG ddd AGA ddd AGT dkk T e 612267 1493 1508 CTT ekk 76 10504 10519 990 GAG ddd TCA ddd CCG ddd AGA dkk A e 612268 1496 1511 GCA ekk 77 10507 10522 991 CTT ddd GAG ddd TCA ddd CCG dkk A e 612269 1499 1514 AGG ekk 43 10510 10525 992 GCA ddd CTT ddd GAG ddd TCA dkk C e 612270 1502 1517 TGA ekk 42 10513 10528 993 AGG ddd GCA ddd CTT ddd GAG dkk T e 612271 1505 1520 CAG ekk 65 10516 10531 994 TGA ddd AGG ddd GCA ddd CTT dkk G e 612272 1508 1523 TCT ekk 0 10519 10534 995 CAG ddd TGA ddd AGG ddd GCA dkk C e 612273 1511 1526 CGC ekk 35 10522 10537 996 TCT ddd CAG ddd TGA ddd AGG dkk G e 612274 1524 1539 AGC ekk 77 10535 10550 997 AGC ddd AGG ddd CAG ddd GCG dkk C e 612275 1528 1543 GAT ekk 64 10539 10554 998 CAG ddd CAG ddd CAG ddd GCA dkk G e 612276 1532 1547 GCT ekk 33 10543 10558 999 GGA ddd TCA ddd GCA ddd GCA dkk G e 612277 1535 1550 GAG ekk 81 10546 10561 1000 GCT ddd GGA ddd TCA ddd GCA dkk G e 612278 1538 1553 AGT ekk 79 10549 10564 1001 GAG ddd GCT ddd GGA ddd TCA dkk G e 612279 1541 1556 CAT ekk 58 10552 10567 1002 AGT ddd GAG ddd GCT ddd GGA dkk T e 612280 1544 1559 AGG ekk 20 10555 10570 1003 CAT ddd AGT ddd GAG ddd GCT dkk G e 612688 N/A N/A CGG ekk 0 2483 2498 565 CTT ddd ACC ddd TTC ddd TGC dkk T e 612799 N/A N/A AGA ekk 0 10783 10798 1004 CAC ddd ACA ddd GGC ddd CGC dkk C e 612800 N/A N/A ACA ekk 29 10830 10845 1005 CTA ddd ACT ddd GGA ddd GAG dkk C e 612801 N/A N/A AGA ekk 39 10939 10954 1006 GGG ddd CGG ddd ATT ddd GCA dkk A e 612802 N/A N/A CAG ekk 37 10940 10955 1007 AGG ddd GCG ddd GAT ddd TGC dkk A e 612803 N/A N/A TCT ekk 36 10943 10958 1008 CAG ddd AGG ddd GCG ddd GAT dkk T e 612804 N/A N/A CTC ekk 55 10944 10959 1009 TCA ddd GAG ddd GGC ddd GGA dkk T e 612805 N/A N/A TCT ekk 34 10945 10960 1010 CTC ddd AGA ddd GGG ddd CGG dkk A e 612806 N/A N/A GCT ekk 71 10977 10992 1011 GTG ddd TGT ddd CAG ddd GTG dkk T e 612807 N/A N/A AAG ekk 0 11003 11018 1012 AAG ddd CTC ddd TTG ddd GAT dkk G e 612808 N/A N/A TCC ekk 52 11006 11021 1013 AAG ddd AAG ddd CTC ddd TTG dkk G e 612809 N/A N/A CCA ekk 28 11109 11124 1014 GCC ddd GCC ddd AGC ddd CGC dkk C e 612810 N/A N/A TTA ekk 69 11451 11466 1015 GTG ddd TTT ddd CAG ddd CAG dkk G e 612811 N/A N/A AGT ekk 35 11453 11468 1016 TAG ddd TGT ddd TTC ddd AGC dkk A e 612812 N/A N/A AAC ekk 37 11506 11521 1017 CTC ddd GAG ddd GAC ddd ATC dkk G e 612813 N/A N/A ACT ekk 7 11696 11711 1018 TAT ddd AAG ddd AGC ddd TGA dkk C e 612814 N/A N/A AGC ekk 21 11699 11714 1019 ACT ddd TAT ddd AAG ddd AGC dkk T e 612815 N/A N/A GCA ekk 27 11866 11881 1020 GTG ddd TTC ddd TTG ddd ATG dkk A e 612816 N/A N/A ACA ekk 67 11869 11884 1021 GCA ddd GTG ddd TTC ddd TTG dkk A e 612817 N/A N/A ATA ekk 57 11895 11910 1022 ATG ddd CAC ddd TGT ddd GTC dkk T e 612818 N/A N/A GAT ekk 48 11996 12011 1023 GAG ddd GAC ddd CTA ddd GGA dkk A e 612819 N/A N/A CCG ekk 67 11998 12013 1024 ATG ddd AGG ddd ACC ddd TAG dkk G e 612820 N/A N/A ACG ekk 21 12128 12143 1025 ACA ddd GGG ddd ATG ddd TTT dkk G e 612821 N/A N/A GGT ekk 0 12398 12413 1026 CAG ddd GCA ddd CAG ddd ACA dkk C e 612822 N/A N/A ATC ekk 45 12671 12686 1027 CCG ddd GTT ddd TCA ddd ACT dkk C e 612823 N/A N/A TCC ekk 21 12866 12881 1028 CGC ddd TGG ddd CCC ddd CCG dkk T e 612824 N/A N/A CTA ekk 13 12888 12903 1029 ACT ddd TAG ddd CAC ddd AGA dkk G e 612825 N/A N/A CCA ekk 44 12915 12930 1030 TGG ddd CCC ddd ACC ddd AGT dkk G e 612826 N/A N/A TTG ekk 30 12919 12934 1031 GCC ddd ATG ddd GCC ddd CAC dkk C e 612827 N/A N/A GGC ekk 0 12938 12953 1032 AGA ddd ATT ddd CCT ddd GGC dkk T e 612828 N/A N/A GCA ekk 13 13059 13074 1033 AGG ddd GTG ddd TGT ddd CTG dkk T e 612829 N/A N/A GGC ekk 23 13060 13075 1034 AAG ddd GGT ddd GTG ddd TCT dkk G e 612830 N/A N/A CTC ekk 60 13069 13084 1035 AGT ddd GTA ddd GGC ddd AAG dkk G e 612831 N/A N/A GAG ekk 12 13094 13109 1036 GAT ddd GCA ddd CAG ddd TGT dkk A e 612832 N/A N/A GCT ekk 22 13151 13166 1037 CAG ddd GAC ddd CTC ddd TGT dkk G e 612833 N/A N/A GGC ekk 34 13152 13167 1038 TCA ddd GGA ddd CCT ddd CTG dkk T e 612834 N/A N/A GGC ekk 38 13198 13213 1039 GCA ddd CTG ddd GGT ddd GAC dkk C e 612835 N/A N/A TCT ekk 9 13204 13219 1040 GAG ddd GGC ddd GCA ddd CTG dkk G e 612836 N/A N/A TCA ekk 1 13208 13223 1041 TTC ddd TGA ddd GGG ddd CGC dkk A e 612838 N/A N/A GCT ekk 33 10636 10651 1042 CCT ddd ACC ddd GGG ddd GAG dkk A e 612839 N/A N/A ACA ekk 0 12376 12391 1043 CAT ddd ACC ddd TCC ddd CCC dkk A e 612840 N/A N/A CGC ekk 0 5715 5730 1044 ATA ddd CCC ddd TGA ddd AAT dkk A e 612842 N/A N/A GGA ekk 13 12231 12246 1045 TGG ddd TCC ddd TGG ddd GGA dkk G e 612843 N/A N/A TTC ekk 0 13239 13254 1046 AGC ddd ACC ddd TGC ddd AAA dkk G e 612844 N/A N/A CCG ekk 9 2484 2499 1047 GCT ddd TAC ddd CTT ddd CTG dkk C e 612845 N/A N/A CCC ekk 0 2487 2502 1048 CCG ddd GCT ddd TAC ddd CTT dkk C e 612846 N/A N/A GGG ekk 0 2490 2505 1049 CCC ddd CCG ddd GCT ddd TAC dkk C e 612847 N/A N/A GTG ekk 14 3361 3376 1050 AAT ddd GTG ddd AGC ddd CCC dkk G e 612848 N/A N/A TCC ekk 0 3435 3450 1051 CTC ddd CTT ddd ATA ddd ACC dkk C e 612849 N/A N/A CCG ekk 4 3471 3486 1052 GGC ddd ACT ddd CTC ddd AAC dkk T e 612850 N/A N/A AGT ekk 4 3752 3767 1053 AAT ddd GGT ddd GCT ddd CTG dkk G e 612851 N/A N/A TCC ekk 30 3759 3774 1054 TGG ddd GAG ddd TAA ddd TGG dkk T e 612852 N/A N/A TCT ekk 31 3817 3832 1055 CAG ddd TTG ddd TGA ddd TCT dkk G e 612853 N/A N/A TCC ekk 0 3868 3883 1056 AGA ddd GAC ddd GCA ddd ATT dkk C e 612854 N/A N/A TCT ekk 11 3870 3885 1057 CCA ddd GAG ddd ACG ddd CAA dkk T e 612855 N/A N/A ACC ekk 4 3983 3998 1058 TGT ddd GGG ddd AAC ddd CGA dkk C e 612856 N/A N/A AAA ekk 0 3985 4000 1059 CCT ddd GTG ddd GGA ddd ACC dkk G e 612857 N/A N/A CCT ekk 27 4340 4355 1060 AGA ddd TTT ddd TTC ddd TGC dkk T e 612858 N/A N/A GCC ekk 57 4420 4435 1061 TTT ddd TCT ddd GTC ddd CCC dkk C e 612859 N/A N/A CAT ekk 12 4464 4479 1062 TTC ddd TTG ddd TGG ddd AGG dkk G e 612860 N/A N/A TGG ekk 2 4569 4584 1063 GCT ddd GGC ddd CCT ddd GCT dkk A e 612861 N/A N/A GAG ekk 33 4822 4837 1064 CCC ddd CAA ddd AGG ddd CAT dkk G e 612862 N/A N/A TCT ekk 43 5357 5372 1065 AAT ddd ATG ddd ACC ddd TGT dkk G e 612863 N/A N/A TGA ekk 13 5360 5375 1066 TCT ddd AAT ddd ATG ddd ACC dkk T e 612864 N/A N/A GTC ekk 0 5455 5470 1067 CTC ddd AAC ddd CCC ddd AGG dkk A e 612865 N/A N/A GCT ekk 4 5553 5568 1068 CCA ddd TGG ddd AAA ddd ATA dkk T e 612866 N/A N/A TCC ekk 19 5593 5608 1069 ATT ddd CAT ddd GTC ddd TAC dkk A e 612867 N/A N/A TTA ekk 17 5660 5675 1070 AGT ddd GCC ddd ATC ddd TAA dkk C e 612868 N/A N/A GCA ekk 0 5714 5729 1071 TAC ddd CCT ddd GAA ddd ATA dkk T e 612893 N/A N/A TGT ekk 42 10707 10722 1072 CTA ddd CTC ddd CCC ddd ACC dkk C e 612894 N/A N/A ACA ekk 28 10834 10849 1073 GAC ddd ACT ddd AAC ddd TGG dkk A e 612895 N/A N/A GTG ekk 37 10974 10989 1074 TGT ddd CAG ddd GTG ddd TGG dkk G e 612896 N/A N/A GCA ekk 35 11016 11031 1075 AGT ddd CAG ddd TTC ddd CAA dkk G e 612897 N/A N/A CTC ekk 55 11336 11351 1076 GAA ddd AAT ddd GGT ddd TAC dkk G e 612898 N/A N/A GGT ekk 53 11583 11598 1077 GGT ddd AAC ddd CAC ddd ATG dkk C e 612899 N/A N/A ATG ekk 31 11892 11907 1078 CAC ddd TGT ddd GTC ddd TTA dkk C e 612900 N/A N/A AAT ekk 39 11896 11911 1079 AAT ddd GCA ddd CTG ddd TGT dkk C e 612901 N/A N/A GTT ekk 68 11930 11945 1080 ACT ddd TGG ddd GTA ddd ATT dkk T e 612902 N/A N/A TCC ekk 19 11974 11989 1081 TTT ddd GGT ddd GCA ddd TTC dkk T e 612903 N/A N/A CTA ekk 0 11987 12002 1082 GGA ddd ATG ddd GTT ddd GTC dkk C e 612904 N/A N/A GAC ekk 20 12129 12144 1083 GAC ddd AGG ddd GAT ddd GTT dkk T e 612905 N/A N/A CTG ekk 25 12131 12146 1084 ACG ddd ACA ddd GGG ddd ATG dkk T e 612906 N/A N/A GCA ekk 60 12210 12225 1085 CAG ddd TTA ddd GGA ddd AGG dkk C e 612907 N/A N/A TTA ekk 8 12892 12907 1086 GCT ddd AAC ddd TTA ddd GCA dkk C e 612908 N/A N/A CAT ekk 41 12914 12929 1087 GGC ddd CCA ddd CCA ddd GTG dkk C e 612909 N/A N/A CAC ekk 52 13087 13102 1088 AGT ddd GTA ddd TGC ddd CTG dkk C e 612910 N/A N/A GCA ekk 0 13195 13210 1089 CTG ddd GGT ddd GAC ddd CCA dkk G e 612911 N/A N/A TCA ekk 0 13238 13253 1090 GCA ddd CCT ddd GCA ddd AAG dkk C e

Table 6 shows inhibition of AGT mRNA in HepG2 cells cultured at a density of 20,000 cells per well which were transfected using electroporation with 1000 nM antisense oligonucleotide. After a treatment period of approximately 24 hours, RNA was isolated from the cells and AGT mRNA levels were measured by quantitative real-time PCR. Human primer probe set RTS4039 (forward sequence GGACAAGGTGGAGGGTCTCA, designated herein as SEQ ID NO: 11; reverse sequence AGATCCTTGCAGCACCAGTTG, designated herein as SEQ ID NO: 12; and probe sequence ATGAAGAAACTATCTCCCCGGACCATCCAX, where X is a fluorescent label, designated herein as SEQ ID NO: 13) was used to measure mRNA levels. AGT mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN®. Results are presented as percent inhibition of AGT, relative to untreated control cells.

TABLE 6 Inhibition of AGT mRNA by MOE and/or cEt containing gapmers targeting SEQ ID NO: 1 and/or 2 SEQ SEQ ID: SEQ SEQ ID: 1 1 ID: 2 ID 2: SEQ ISIS Start Stop % Start Stop ID NO Site Site Sequence Chemistry Inhibition Site Site NO 568637 2046 2061 CGCTGATTTGTCCGGG eekddddddddddkke 74 13515 13530 129 594622 2027 2042 GTTATCTGCTGCTGGC kkkddddddddddkkk 64 13496 13511 163 594625 2047 2062 TCGCTGATTTGTCCGG kkkddddddddddkkk 57 13516 13531 165 612205 1279 1294 CTTCCATCCTGTCACA ekkddddddddddkke 0 6496 6511 957 612206 1282 1297 AGTCTTCCATCCTGTC ekkddddddddddkke 9 6499 6514 958 612207 1286 1301 AGCCAGTCTTCCATCC ekkddddddddddkke 0 6503 6518 959 612208 1290 1305 GAGCAGCCAGTCTTCC ekkddddddddddkke 0 6507 6522 1091 612209 1293 1308 AGGGAGCAGCCAGTCT ekkddddddddddkke 0 6510 6525 1092 612210 1296 1311 ATCAGGGAGCAGCCAG ekkddddddddddkke 0 6513 6528 1093 612211 1300 1315 TCCCATCAGGGAGCAG ekkddddddddddkke 0 6517 6532 1094 612212 1303 1318 GGCTCCCATCAGGGAG ekkddddddddddkke 0 6520 6535 1095 612213 1306 1321 ACTGGCTCCCATCAGG ekkddddddddddkke 16 6523 6538 1096 612214 1310 1325 CCACACTGGCTCCCAT ekkddddddddddkke 0 6527 6542 1097 612215 1315 1330 GCTGTCCACACTGGCT ekkddddddddddkke 13 6532 6547 1098 612216 1318 1333 GGTGCTGTCCACACTG ekkddddddddddkke 20 6535 6550 1099 612217 1321 1336 CAGGGTGCTGTCCACA ekkddddddddddkke 0 6538 6553 1100 612218 1324 1339 AGCCAGGGTGCTGTCC ekkddddddddddkke 14 6541 6556 1101 612219 1327 1342 GAAAGCCAGGGTGCTG ekkddddddddddkke 0 6544 6559 1102 612220 1330 1345 GTTGAAAGCCAGGGTG ekkddddddddddkke 6 6547 6562 1103 612221 1333 1348 GGTGTTGAAAGCCAGG ekkddddddddddkke 34 6550 6565 1104 612222 1336 1351 GTAGGTGTTGAAAGCC ekkddddddddddkke 9 6553 6568 1105 612223 1351 1366 CCCTTGGAAGTGGACG ekkddddddddddkke 0 N/A N/A 1106 612224 1354 1369 CTTCCCTTGGAAGTGG ekkddddddddddkke 17 N/A N/A 1107 612225 1357 1372 CATCTTCCCTTGGAAG ekkddddddddddkke 11 N/A N/A 1108 612226 1360 1375 CTTCATCTTCCCTTGG ekkddddddddddkke 0 N/A N/A 1109 612227 1364 1379 AGCCCTTCATCTTCCC ekkddddddddddkke 5 10375 10390 1110 612228 1367 1382 AGAAGCCCTTCATCTT ekkddddddddddkke 0 10378 10393 1111 612229 1370 1385 GGGAGAAGCCCTTCAT ekkddddddddddkke 0 10381 10396 1112 612230 1373 1388 GCAGGGAGAAGCCCTT ekkddddddddddkke 25 10384 10399 1113 612231 1380 1395 TCGGCCAGCAGGGAGA ekkddddddddddkke 32 10391 10406 1114 612232 1383 1398 GGCTCGGCCAGCAGGG ekkddddddddddkke 24 10394 10409 1115 612233 1399 1414 CACCCAGAACTCCTGG ekkddddddddddkke 5 10410 10425 960 612234 1402 1417 GTCCACCCAGAACTCC ekkddddddddddkke 0 10413 10428 961 612235 1405 1420 GTTGTCCACCCAGAAC ekkddddddddddkke 0 10416 10431 962 612236 1408 1423 GCTGTTGTCCACCCAG ekkddddddddddkke 14 10419 10434 963 612237 1411 1426 GGTGCTGTTGTCCACC ekkddddddddddkke 20 10422 10437 964 612238 1414 1429 TGAGGTGCTGTTGTCC ekkddddddddddkke 32 10425 10440 965 612239 1417 1432 CACTGAGGTGCTGTTG ekkddddddddddkke 36 10428 10443 966 612240 1421 1436 CAGACACTGAGGTGCT ekkddddddddddkke 1 10432 10447 93 612241 1429 1444 CATGGGAACAGACACT ekkddddddddddkke 9 10440 10455 967 612242 1432 1447 GAGCATGGGAACAGAC ekkddddddddddkke 0 10443 10458 968 612243 1435 1450 AGAGAGCATGGGAACA ekkddddddddddkke 0 10446 10461 969 612244 1438 1453 GCCAGAGAGCATGGGA ekkddddddddddkke 5 10449 10464 970 612245 1441 1456 CATGCCAGAGAGCATG ekkddddddddddkke 27 10452 10467 971 612246 1444 1459 GCCCATGCCAGAGAGC ekkddddddddddkke 0 10455 10470 972 612247 1447 1462 GGTGCCCATGCCAGAG ekkddddddddddkke 36 10458 10473 973 612248 1450 1465 GAAGGTGCCCATGCCA ekkddddddddddkke 0 10461 10476 974 612249 1453 1468 CTGGAAGGTGCCCATG ekkddddddddddkke 24 10464 10479 975 612250 1457 1472 AGTGCTGGAAGGTGCC ekkddddddddddkke 0 10468 10483 976 612251 1460 1475 TCCAGTGCTGGAAGGT ekkddddddddddkke 3 10471 10486 977 612252 1462 1477 ACTCCAGTGCTGGAAG ekkddddddddddkke 72 10473 10488 96 612253 1463 1478 CACTCCAGTGCTGGAA ekkddddddddddkke 19 10474 10489 978 612254 1465 1480 GTCACTCCAGTGCTGG ekkddddddddddkke 45 10476 10491 97 612255 1466 1481 TGTCACTCCAGTGCTG ekkddddddddddkke 15 10477 10492 979 612256 1467 1482 ATGTCACTCCAGTGCT ekkddddddddddkke 0 10478 10493 980 612257 1468 1483 GATGTCACTCCAGTGC ekkddddddddddkke 16 10479 10494 981 612258 1469 1484 GGATGTCACTCCAGTG ekkddddddddddkke 0 10480 10495 982 612259 1470 1485 TGGATGTCACTCCAGT ekkddddddddddkke 3 10481 10496 983 612260 1472 1487 CCTGGATGTCACTCCA ekkddddddddddkke 10 10483 10498 984 612261 1475 1490 TGTCCTGGATGTCACT ekkddddddddddkke 8 10486 10501 985 612262 1478 1493 AGTTGTCCTGGATGTC ekkddddddddddkke 0 10489 10504 986 612263 1481 1496 AGAAGTTGTCCTGGAT ekkddddddddddkke 14 10492 10507 987 612264 1484 1499 CCGAGAAGTTGTCCTG ekkddddddddddkke 10 10495 10510 99 612265 1487 1502 TCACCGAGAAGTTGTC ekkddddddddddkke 0 10498 10513 988 612266 1490 1505 GAGTCACCGAGAAGTT ekkddddddddddkke 33 10501 10516 989 612267 1493 1508 CTTGAGTCACCGAGAA ekkddddddddddkke 35 10504 10519 990 612268 1496 1511 GCACTTGAGTCACCGA ekkddddddddddkke 37 10507 10522 991 612269 1499 1514 AGGGCACTTGAGTCAC ekkddddddddddkke 0 10510 10525 992 612270 1502 1517 TGAAGGGCACTTGAGT ekkddddddddddkke 8 10513 10528 993 612271 1505 1520 CAGTGAAGGGCACTTG ekkddddddddddkke 8 10516 10531 994 612272 1508 1523 TCTCAGTGAAGGGCAC ekkddddddddddkke 0 10519 10534 995 612273 1511 1526 CGCTCTCAGTGAAGGG ekkddddddddddkke 18 10522 10537 996 612274 1524 1539 AGCAGCAGGCAGGCGC ekkddddddddddkke 27 10535 10550 997 612275 1528 1543 GATCAGCAGCAGGCAG ekkddddddddddkke 39 10539 10554 998 612276 1532 1547 GCTGGATCAGCAGCAG ekkddddddddddkke 21 10543 10558 999 612277 1535 1550 GAGGCTGGATCAGCAG ekkddddddddddkke 34 10546 10561 1000 612278 1538 1553 AGTGAGGCTGGATCAG ekkddddddddddkke 28 10549 10564 1001 612279 1541 1556 CATAGTGAGGCTGGAT ekkddddddddddkke 13 10552 10567 1002 612280 1544 1559 AGGCATAGTGAGGCTG ekkddddddddddkke 0 10555 10570 1003

Table 7 shows inhibition of AGT mRNA in HepG2 cells cultured at a density of 20,000 cells per well which were transfected using electroporation with 1000 nM antisense oligonucleotide. After a treatment period of approximately 24 hours, RNA was isolated from the cells and AGT mRNA levels were measured by quantitative real-time PCR. Human primer probe set RTS4039 was used to measure mRNA levels. AGT mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN®. Results are presented as percent inhibition of AGT, relative to untreated control cells.

TABLE 7 Inhibition of AGT mRNA by MOE and/or cEt containing gapmers targeting SEQ ID NO: 1 and/or 2 SEQ SEQ ID: SEQ SEQ ID: 1 1 ID: 2 ID 2: SEQ ISIS Start Stop % Start Stop ID NO Site Site Sequence Chemistry Inhibition Site Site NO 568637 2046 2061 CGCTGATTTGTCCGGG eekddddddddddkke 93 13515 13530 129 568637 2046 2061 CGCTGATTTGTCCGGG eekddddddddddkke 90 13515 13530 129 568637 2046 2061 CGCTGATTTGTCCGGG eekddddddddddkke 84 13515 13530 129 594622 2027 2042 GTTATCTGCTGCTGGC kkkddddddddddkkk 86 13496 13511 163 594622 2027 2042 GTTATCTGCTGCTGGC kkkddddddddddkkk 85 13496 13511 163 594622 2027 2042 GTTATCTGCTGCTGGC kkkddddddddddkkk 5 13496 13511 163 594625 2047 2062 TCGCTGATTTGTCCGG kkkddddddddddkkk 75 13516 13531 165 594625 2047 2062 TCGCTGATTTGTCCGG kkkddddddddddkkk 70 13516 13531 165 594625 2047 2062 TCGCTGATTTGTCCGG kkkddddddddddkkk 0 13516 13531 165 612129 965 980 GCCTGTCAGCTGTGTG ekkddddddddddkke 35 6182 6197 889 612130 968 983 GTAGCCTGTCAGCTGT ekkddddddddddkke 35 6185 6200 890 612131 971 986 CCTGTAGCCTGTCAGC ekkddddddddddkke 30 6188 6203 891 612132 974 989 TTGCCTGTAGCCTGTC ekkddddddddddkke 37 6191 6206 892 612133 977 992 GGATTGCCTGTAGCCT ekkddddddddddkke 30 6194 6209 893 612134 980 995 CCAGGATTGCCTGTAG ekkddddddddddkke 56 6197 6212 894 612135 983 998 CACCCAGGATTGCCTG ekkddddddddddkke 0 6200 6215 68 612136 986 1001 GAACACCCAGGATTGC ekkddddddddddkke 8 6203 6218 895 612137 993 1008 TTCCAAGGAACACCCA ekkddddddddddkke 27 6210 6225 69 612138 997 1012 GTCCTTCCAAGGAACA ekkddddddddddkke 26 6214 6229 896 612139 1000 1015 CTTGTCCTTCCAAGGA ekkddddddddddkke 47 6217 6232 897 612140 1003 1018 GTTCTTGTCCTTCCAA ekkddddddddddkke 36 6220 6235 898 612141 1006 1021 GCAGTTCTTGTCCTTC ekkddddddddddkke 28 6223 6238 899 612142 1009 1024 GGTGCAGTTCTTGTCC ekkddddddddddkke 13 6226 6241 900 612143 1012 1027 GGAGGTGCAGTTCTTG ekkddddddddddkke 0 6229 6244 901 612144 1015 1030 CCGGGAGGTGCAGTTC ekkddddddddddkke 27 6232 6247 902 612145 1018 1033 CAGCCGGGAGGTGCAG ekkddddddddddkke 39 6235 6250 903 612146 1021 1036 ATCCAGCCGGGAGGTG ekkddddddddddkke 24 6238 6253 904 612147 1024 1039 CGCATCCAGCCGGGAG ekkddddddddddkke 55 6241 6256 905 612148 1027 1042 GTGCGCATCCAGCCGG ekkddddddddddkke 37 6244 6259 906 612149 1030 1045 CTTGTGCGCATCCAGC ekkddddddddddkke 11 6247 6262 907 612150 1033 1048 GACCTTGTGCGCATCC ekkddddddddddkke 12 6250 6265 908 612151 1036 1051 CAGGACCTTGTGCGCA ekkddddddddddkke 41 6253 6268 909 612152 1039 1054 AGACAGGACCTTGTGC ekkddddddddddkke 9 6256 6271 910 612153 1042 1057 GGCAGACAGGACCTTG ekkddddddddddkke 30 6259 6274 911 612154 1060 1075 GCCCTGTACAGCCTGC ekkddddddddddkke 19 6277 6292 912 612155 1064 1079 GCAGGCCCTGTACAGC ekkddddddddddkke 0 6281 6296 913 612156 1067 1082 CTAGCAGGCCCTGTAC ekkddddddddddkke 21 6284 6299 914 612157 1071 1086 GCCACTAGCAGGCCCT ekkddddddddddkke 0 6288 6303 915 612158 1074 1089 TGGGCCACTAGCAGGC ekkddddddddddkke 13 6291 6306 916 612159 1077 1092 CCCTGGGCCACTAGCA ekkddddddddddkke 23 6294 6309 917 612160 1080 1095 CTGCCCTGGGCCACTA ekkddddddddddkke 28 6297 6312 918 612161 1088 1103 TATCAGCCCTGCCCTG ekkddddddddddkke 0 6305 6320 74 612162 1091 1106 GGCTATCAGCCCTGCC ekkddddddddddkke 27 6308 6323 919 612163 1094 1109 CCTGGCTATCAGCCCT ekkddddddddddkke 13 6311 6326 920 612164 1097 1112 GGGCCTGGCTATCAGC ekkddddddddddkke 3 6314 6329 921 612165 1100 1115 GCTGGGCCTGGCTATC ekkddddddddddkke 10 6317 6332 922 612166 1115 1130 CCGTGGACAGCAGCAG ekkddddddddddkke 12 6332 6347 923 612167 1118 1133 CCACCGTGGACAGCAG ekkddddddddddkke 42 6335 6350 924 612168 1121 1136 CCACCACCGTGGACAG ekkddddddddddkke 27 6338 6353 925 612169 1124 1139 CGCCCACCACCGTGGA ekkddddddddddkke 29 6341 6356 926 612170 1127 1142 ACACGCCCACCACCGT ekkddddddddddkke 9 6344 6359 927 612171 1130 1145 TGAACACGCCCACCAC ekkddddddddddkke 25 6347 6362 928 612172 1133 1148 CTGTGAACACGCCCAC ekkddddddddddkke 32 6350 6365 929 612173 1136 1151 GGGCTGTGAACACGCC ekkddddddddddkke 0 6353 6368 930 612174 1151 1166 TCAGGTGCAGGCCTGG ekkddddddddddkke 8 6368 6383 78 612175 1154 1169 GCTTCAGGTGCAGGCC ekkddddddddddkke 30 6371 6386 931 612176 1157 1172 GCTGCTTCAGGTGCAG ekkddddddddddkke 21 6374 6389 932 612177 1160 1175 ACGGCTGCTTCAGGTG ekkddddddddddkke 46 6377 6392 933 612178 1163 1178 CAAACGGCTGCTTCAG ekkddddddddddkke 7 6380 6395 934 612179 1166 1181 GCACAAACGGCTGCTT ekkddddddddddkke 31 6383 6398 935 612180 1169 1184 CCTGCACAAACGGCTG ekkddddddddddkke 10 6386 6401 936 612181 1172 1187 GGCCCTGCACAAACGG ekkddddddddddkke 5 6389 6404 937 612182 1182 1197 TAGAGAGCCAGGCCCT ekkddddddddddkke 29 6399 6414 80 612183 1185 1200 GTATAGAGAGCCAGGC ekkddddddddddkke 0 6402 6417 938 612184 1203 1218 CGTGGGAGGACCACAG ekkddddddddddkke 16 6420 6435 81 612185 1217 1232 TGAAGTCCAGAGAGCG ekkddddddddddkke 27 6434 6449 82 612186 1220 1235 CTGTGAAGTCCAGAGA ekkddddddddddkke 26 6437 6452 939 612187 1223 1238 GTTCTGTGAAGTCCAG ekkddddddddddkke 44 6440 6455 940 612188 1226 1241 CCAGTTCTGTGAAGTC ekkddddddddddkke 29 6443 6458 941 612189 1229 1244 CATCCAGTTCTGTGAA ekkddddddddddkke 14 6446 6461 942 612190 1232 1247 CAACATCCAGTTCTGT ekkddddddddddkke 0 6449 6464 943 612191 1235 1250 CAGCAACATCCAGTTC ekkddddddddddkke 24 6452 6467 944 612192 1244 1259 TCTTCTCAGCAGCAAC ekkddddddddddkke 62 6461 6476 84 612193 1247 1262 CAATCTTCTCAGCAGC ekkddddddddddkke 27 6464 6479 945 612194 1250 1265 TGTCAATCTTCTCAGC ekkddddddddddkke 18 6467 6482 946 612195 1253 1268 ACCTGTCAATCTTCTC ekkddddddddddkke 33 6470 6485 947 612196 1256 1271 TGAACCTGTCAATCTT ekkddddddddddkke 25 6473 6488 948 612197 1259 1274 GCATGAACCTGTCAAT ekkddddddddddkke 27 6476 6491 949 612198 1262 1277 CCTGCATGAACCTGTC ekkddddddddddkke 15 6479 6494 950 612199 1265 1280 CAGCCTGCATGAACCT ekkddddddddddkke 42 6482 6497 951 612200 1267 1282 CACAGCCTGCATGAAC ekkddddddddddkke 39 6484 6499 952 612201 1268 1283 TCACAGCCTGCATGAA ekkddddddddddkke 27 6485 6500 953 612202 1274 1289 ATCCTGTCACAGCCTG ekkddddddddddkke 44 6491 6506 954 612203 1276 1291 CCATCCTGTCACAGCC ekkddddddddddkke 39 6493 6508 955 612204 1277 1292 TCCATCCTGTCACAGC ekkddddddddddkke 27 6494 6509 956 612688 N/A N/A CGGCTTACCTTCTGCT ekkddddddddddkke 7 2483 2498 565 612761 N/A N/A CGAAGGGAGACCCATT ekkddddddddddkke 24 8270 8285 1116 612762 N/A N/A TTCGAAGGGAGACCCA ekkddddddddddkke 9 8272 8287 1117 612763 N/A N/A CTTTCGAAGGGAGACC ekkddddddddddkke 12 8274 8289 1118 612764 N/A N/A CCGATCTCCTCACTGG ekkddddddddddkke 9 8497 8512 1119 612765 N/A N/A CCCCGATCTCCTCACT ekkddddddddddkke 6 8499 8514 1120 612766 N/A N/A ACAGCCCCCGATCTCC ekkddddddddddkke 35 8504 8519 1121 612767 N/A N/A GAGACAGCCCCCGATC ekkddddddddddkke 3 8507 8522 1122 612768 N/A N/A CCGAGACAGCCCCCGA ekkddddddddddkke 7 8509 8524 1123 612769 N/A N/A CTAGCTGCCTGCTGAG ekkddddddddddkke 27 8569 8584 1124 612770 N/A N/A TCTAGCTGCCTGCTGA ekkddddddddddkke 22 8570 8585 1125 612771 N/A N/A GTGGGACACATCTAGC ekkddddddddddkke 16 8580 8595 1126 612772 N/A N/A TCTAGTGGGACACATC ekkddddddddddkke 27 8584 8599 1127 612773 N/A N/A TCTCTAGTGGGACACA ekkddddddddddkke 17 8586 8601 1128 612774 N/A N/A CATGAGAGTGGCTGCC ekkddddddddddkke 29 8789 8804 1129 612775 N/A N/A CTTTTAGTTTAGAGGG ekkddddddddddkke 25 8883 8898 1130 612776 N/A N/A ATGTGAGCGGGAAACT ekkddddddddddkke 16 8961 8976 1131 612777 N/A N/A CATGTGAGCGGGAAAC ekkddddddddddkke 38 8962 8977 1132 612778 N/A N/A CGGAGCACTCAGTCTC ekkddddddddddkke 38 8985 9000 1133 612779 N/A N/A GTCCTCAGTCCTCGGA ekkddddddddddkke 8 8997 9012 1134 612780 N/A N/A CGTCCTCAGTCCTCGG ekkddddddddddkke 53 8998 9013 1135 612781 N/A N/A GCAGTGGCAGACCTGG ekkddddddddddkke 23 9023 9038 1136 612782 N/A N/A TAGAGATGGTTCAGAA ekkddddddddddkke 13 9166 9181 1137 612783 N/A N/A TGAGTAGAGATGGTTC ekkddddddddddkke 25 9170 9185 1138 612784 N/A N/A GGAGTCTGAGTAGAGA ekkddddddddddkke 21 9176 9191 1139 612785 N/A N/A GCCCTCGGCTGTCCTC ekkddddddddddkke 24 9294 9309 1140 612786 N/A N/A CTCGACCTTACACTAG ekkddddddddddkke 29 9319 9334 1141 612787 N/A N/A CCTCTGCCTCGACCTT ekkddddddddddkke 49 9326 9341 1142 612788 N/A N/A AACTCGGGAGAGCCCG ekkddddddddddkke 41 9410 9425 1143 612789 N/A N/A AACGAGGGCTCCATTC ekkddddddddddkke 22 9557 9572 1144 612790 N/A N/A GACACACTCACTTTTT ekkddddddddddkke 25 9999 10014 1145 612791 N/A N/A CTGCCAGGTCAACTCA ekkddddddddddkke 39 10050