Abstract: The present invention relates antidotes to anticoagulants targeting factor Xa. The antidotes are factor X and factor Xa protein derivatives that bind to the factor Xa inhibitors thereby substantially neutralizing them but do not assemble into the prothrombinase complex. The derivatives describe herein lack or have reduced intrinsic coagulant activity. Disclosed herein are methods of reversing anticoagulation, stopping or preventing bleeding in a patient that is currently undergoing anticoagulant therapy with a factor Xa inhibitor.

Abstract: Pathological retinal neovascularization is a common micro-vascular complication in several retinal diseases including retinopathy of prematurity (ROP), diabetic retinopathy, age-related macular degeneration and central vein occlusion. Disclosed herein are compositions and methods useful for the treatment or prevention of retinal neovascularization and related diseases in a subject in need thereof. Exemplary methods include administering a composition including PEGylated arginase 1 to a subject in need thereof to promote reparative angiogenesis and decrease retinal neovascularization in the eye.

Abstract: A strain of Rhodococcus rhodochrous in which a gene coding at least part of a nitrile hydratase enzyme or any gene coding a protein involved in the transcription, translation or formation of at least part of the nitrile hydratase enzyme has been deactivated or rendered ineffective or a strain of Rhodococcus rhodochrous cultured under condition wherein the nitrile hydratase enzyme is been inhibited.

Abstract: Described herein are methods for the production of ammonium acrylate or salts thereof from acrylonitrile using nitrilase as a catalyst.

Abstract: The application discloses multimeric assemblies including multiple oligomeric substructures, where each oligomeric substructure includes multiple proteins that self-interact around at least one axis of rotational symmetry, where each protein includes one or more polypeptide-polypeptide interface (“O interface”); and one or more polypeptide domain that is capable of effecting membrane scission and release of an enveloped multimeric assembly from a cell by recruiting the ESCRT machinery to the site of budding by binding to one or more proteins in the eukaryotic ESCRT complex (“L domain”); and where the multimeric assembly includes one or more subunits comprising one or more polypeptide domain that is capable of interacting with a lipid bilayer (“M domain”), as well as membrane-enveloped versions of the multimeric assemblies.

Abstract: The present disclosure relates to methods of stimulating cell proliferation, promoting differentiation of cells, regenerating cells, promoting nodule formation, and promoting myotube formation. The methods include applying one or more pulses of electricity to cells, each pulse of electricity having a duration of between about 10 nanoseconds and about 1,000 nanoseconds, wherein said pulses of electricity are applied under conditions effective to stimulate cell proliferation, promote differentiation of cells, regenerate cells, promote nodule formation, and promote myotube formation.

Abstract: Multi-stage acoustophoretic devices for continuously separating a second fluid or a particulate from a host fluid are disclosed. Methods of operating the multi-stage acoustophoretic devices are also disclosed. The systems may include multiple acoustophoretic devices fluidly connected to one another in series, each acoustophoretic device comprising a flow chamber, an ultrasonic transducer capable of creating a multi-dimensional acoustic standing wave, and a reflector. The systems can further include pumps and flowmeters.

Abstract: A nucleic acid collection column collects a nucleic acid from a liquid sample containing the nucleic acid. The nucleic acid collection column includes a sample injection portion having an opening into which the liquid sample containing the nucleic acid is injected, a support adsorption portion that houses a support for adsorbing the nucleic acid and in which the nucleic acid is adsorbed on the support, and a discharge portion that discharges a liquid passed through the support adsorption portion. The support includes aluminum oxide having a surface where a water-soluble neutral polymer is adsorbed. A space that houses the support in the support adsorption portion has a cylindrical shape, and has a volume of 0.13 ?L or more and 13.5 ?L or less. An aspect ratio (d1/d2) of the space satisfies 1.0?d1/d2<15.0.

Abstract: Disclosed by the present application are an antibody library construction method and an application thereof. The method comprises the following steps: inserting a first element and a second element into a same vector or different vectors, and transfecting the vectors into the cells to obtain an antibody expression cell library, i.e., the antibody library. The first element comprises CIS activators and selection marker genes; the second element comprises extracellular antibody library coding domain, Notch nuclear structure domain and intracellular transcription structure domain.

Abstract: The disclosure features chimeric antigen receptor (CAR) ligands, methods for making the same, and immunomodulatory compositions comprising the CAR ligands. The disclosure also features compositions and methods of using the immunomodulatory compositions, for example, to stimulate activation of CAR expressing cells.

Abstract: The invention relates to a bicyclic peptide complex comprising a peptide construct, said construct comprising (i) a polypeptide with free terminus (N or C); (ii) optionally, a nucleic acid encoding the polypeptide; (iii) a twofold-symmetric linker (TSL) compound attached to said polypeptide where the linker is attached to the terminus of polypeptide via a covalent bond and to at least two discrete side chains of the peptide. The invention also relates to libraries, and to methods for making complexes and to methods of screening using the same.

Abstract: The present invention relates to a cell comprising a first nucleic acid sequence encoding a first polypeptide fused to the N-terminus of a first variant of a histidine kinase comprising a DHp domain and a CA domain, wherein said first variant does not comprise a transmembrane domain, a second nucleic acid sequence encoding a second polypeptide fused to the N-terminus of a second variant of said histidine kinase comprising a DHp domain and a CA domain, wherein said second variant does not comprise a transmembrane domain, and a third nucleic acid sequence encoding a response regulatory protein specifically phosphorylatable by said DHp domain of said first or said second variant. The present invention further relates to uses of the cell of the invention.

Abstract: Embodiments disclosed herein are directed to a new genetic perturbation and screening method that combines advantages of pooled perturbation with imaging assays for complex phenotypes. Specifically, the method may be used to screen pooled genomic perturbations to identify phenotypes and to identify perturbed genes at the single-cell level using optical barcodes. A major advantage offered by this approach is the ability to screen for any cellular phenotype that can be identified by high-resolution microscopy—including live-cell phenotypes, protein localization, or highly multiplexed expression profile and mRNA localization by RNA-FISH—in conjunction with a large array of genetic perturbations applied as a pool in a single test volume.

Abstract: Provided are: a method for modifying a target nucleic acid in the genome of a cell using a novel PAM sequence; and a cell in which a target nucleic acid in the genome is modified thereby. Accordingly, genome editing can be performed by targeting a position that could not be previously targeted as a target for genome editing, and thus the range of applications of genome editing can be expanded.

Abstract: The invention relates to antisense oligonucleotides that are capable of bringing about specific editing of a target nucleotide (adenosine) in a target RNA in a eukaryotic cell, wherein said oligonucleotide does not, in itself, form an intramolecular hairpin or stem-loop structure, and wherein said oligonucleotide comprises a cytidine non-complementary, nucleotide) or a uridine in a position opposite to the target adenosine to be edited in the target RNA region.

Abstract: Compositions and methods for editing, e.g., altering a DNA sequence, within the TRBC1, TRBC2 and/or TRAC genes are provided. Compositions and methods for immunotherapy are provided, for example.

Abstract: The present invention provides compositions and methods for inhibiting intermediate filament tetramerization and formation.

Abstract: Thermostable Cas9 nucleases. The present invention relates to the field of genetic engineering and more particularly to nucleic acid editing and genome modification. The present invention provides an isolated Cas protein or polypeptide fragment thereof having an amino acid sequence of SEQ ID NO: 1 or a sequence of at least 77% identity therewith. The Cas protein or polypeptide is capable of binding, cleaving, marking or modifying a double stranded target polynucleotide at a temperature in the range 20° C. and 100° C. inclusive. The invention further provides isolated nucleic acid molecules encoding said Cas9 nucleases, expression vectors and host cells. The invention also provides PAM sequences recognized by the Cas protein or polypeptide, The Cas9 nucleases disclosed herein provide novel tools for genetic engineering in general, in particular at elevated temperatures and are of particular value in the genetic manipulation of thermophilic organisms; particularly microorganisms.

Abstract: This disclosure relates to a therapeutic combination of drugs for the treatment or management of a neurodegenerative disease, the combination comprising: a first conjugate comprising an RNA silencing agent and a first targeting agent that targets the first conjugate to the central nervous system, and a second conjugate comprising an antagonist of the RNA silencing agent and a second targeting agent that targets the second conjugate to a off-target tissue.

Abstract: In some embodiments, disclosed herein are oligomeric compounds which include one or more tricyclo-deoxyribonucleic acid (tc-DNA) nucleosides and one or more 2?-modified ribonucleic acid (2?-modified-RNA) nucleosides, and which optionally also include one or more non-nucleotides, each of which is joined by a plurality of internucleoside linkages, including pharmaceutical compositions and methods of using the pharmaceutical compositions for the treatment of diseases including Duchenne muscular dystrophy treatment of familial dysautonomia, spinal muscular atrophy, ataxia telangiectasia, congenital disorder of glycosylation, fronto-temporal dementia, Parkinsonism linked to chromosome 17, Niemann-Pick disease type C. neurofibromatosis type 1, neurofibromatosis type 2, megalencephalic leukoencephalopathy with subcortical cysts type 1. Pelizaeus-Merzbacher disease, Pompe disease, myotonic dystrophy type 2 (DM2 or proximal myotonic myopathy), and myotonic dystrophy type 1 (DM1 or Steinert disease).

Abstract: This disclosure relates to novel C9ORF72 targeting sequences. Novel sense and antisense dual-targeting oligonucleotides for the treatment of neurodegenerative diseases are also provided.

Abstract: The present invention is directed to hybrid chimera antisense oligonucleotides including deoxyribonucleotide and 2?-deoxy-2?-fluoro-?-D-arabinonucleotide which binds to a Foxp3 mRNA, and to methods of use thereof. The methods include the use for reducing expression level of Foxp3 gene, increasing anti-tumor activity, and treating cancer in a subject.

Abstract: Provided is an agent that binds to a wild type or variant pre-miRNA-1229 comprising a G-quadruplex (GQ) structure, wherein binding of the agent to the wild type or variant pre-miRNA-1229 stabilizes the GQ structure of the wild type or variant pre-miRNA-1229. In some embodiments, the variant is rs2291418. Provided is a method of treating a disease in a subject, comprising: administering a therapeutically effective amount of the agent to the subject. In some embodiments, the disease is Alzheimer's disease, cancer or coronary artery calcification.

Abstract: A composition for the treatment of bladder fibrosis in a patient in need that includes a miR-29 mimic is disclosed. The miR-29 mimic may include a working RNA strand with the nucleotide sequence UAGCACCAUCUGAAAUCGGUUUU (SEQ ID NO:4) and a passenger RNA strand comprising the nucleotide sequence: AACCGAUUUCuuuUGGUGCUAUU (SEQ ID NO:5). The passenger RNA strand includes a 2?-O-methylation modification to increase stability. Cholesterol is conjugated to the 3?-end of the passenger RNA strand to enhance cellular uptake. The composition may further include a carrier molecule including, but not limited to, branched polyethylenimine at an N/P ratio of 0.8, where N denotes the nitrogens of the polyethylenimine and P denotes the phosphate groups of the working and passenger RNA strands. In some aspects, the composition may be an injectable composition that includes a polyplex dissolved in a 0.5% glucose solution, where the polyplex is formed from the working and passenger RNA strands and the carrier molecule.

Abstract: The present disclosure relates to the field of rAAV delivery of transgenes. In some aspects, the disclosure relates to RNAi. Provided herein are recombinant adeno-associated virus (rAAV) vectors comprising modified ITRs. In some embodiments, the modified ITRs comprise a sequence encoding a shRNA, miRNA, or AmiRNA.

Abstract: A method of reducing the level of a transcription product in a cell comprising contacting with the cell a composition comprising a double-stranded nucleic acid complex comprising a first nucleic acid strand annealed to a second nucleic acid strand, wherein: (i) the first nucleic acid strand hybridizes to the transcription product and comprises (a) a region consisting of at least 4 consecutive nucleotides that are recognized by RNase H when the strand is hybridized to the transcription product, (b) one or more nucleotide analogs located on 5? terminal side of the region, (c) one or more nucleotide analogs located on 3? terminal side of the region and (d) a total number of nucleotides and nucleotide analogs ranging from 8 to 35 nucleotides and (ii) the second nucleic acid strand comprises (a) nucleotides and optionally nucleotide analogs and (b) at least 4 consecutive RNA nucleotides.

Abstract: Methods and compositions are provided for inhibiting or treating metastasis based on discoveries regarding Kif19 and Cep192. Methods and compositions are provided for enhancing wound healing, treating fibrosis, reducing scarring and treating nerve pain.

Abstract: The present invention relates to a RNA molecule comprising a first ribozyme, a first ligation sequence, an effector molecule, a second ligation sequence, and a second ribozyme. Methods of producing circular RNA molecules and treatment methods are also disclosed.

Abstract: The present invention relates to a nucleic acid molecule and its use for the modulation of the immune system. It provides a DNA construct for immunomodulation comprising at least one nucleotide in L-conformation.

Abstract: The present disclosure relates to methods for treating cancer in patients having low expression of MHC Class I genes, and in patients having increased serum levels of PD-L2 by administration of a TLR9 agonist.

Abstract: This technology relates in part to methods and compositions for treatment or prevention of infections, including but not limited to respiratory infections. The methods and compositions can include lung surfactants, detergents, antivirals, siRNA, and nicotinamide adenine dinucleotide (NAD) boosting agents.

Abstract: Provided herein are methods for decreasing LRRK2 mRNA expression. Such methods are useful to ameliorate LRRK2 associated diseases. Such LRRK2 associated diseases include Parkinson's Disease, including non-LRRK2 mediated Parkinson's Disease.

Abstract: The present invention relates to compositions, methods and kits for the treatment of fibrosis. In particular, the compositions, methods and kits are particularly useful, but not limited to, the treatment of cardiac fibrosis. The invention provides a method of treating fibrosis in an individual comprising administering an inhibitor of insulin-regulated aminopeptidase (IRAP), thereby treating fibrosis.

Abstract: The present invention provides a photoactivatable Tet-OFF/ON system that can precisely control temporal and spatial gene expression. The present invention is a PA-Tet-OFF/ON system that includes a target gene expression cassette including a TRE having a TetO sequence, a promoter which is controlled by the TRE, and a target gene whose expression is controlled by the promoter; a first fusion protein expression cassette containing a gene which encodes a first fusion protein containing TetR or rTetR and a first protein; and a second fusion protein expression cassette containing a gene which encodes a second fusion protein containing p65AD and a second protein, in which the first protein and the second protein bind to each other to form a heterodimer only in a state of being irradiated with light at a specific wavelength.

Abstract: [Problem] To provide a nucleic acid expected to be useful for treating mite allergy. [Means to be solved] Provided is a nucleic acid comprising a nucleotide sequence encoding a chimeric protein, wherein the nucleic acid comprises a nucleotide sequence encoding a signal peptide, a nucleotide sequence encoding an intra-organelle stabilizing domain of LAMP, a nucleotide sequence encoding an allergen domain comprising Der p 1, Der p 2, Der p 23, and Der p 7, a nucleotide sequence encoding a transmembrane domain and a nucleotide sequence encoding an endosomal/lysosomal targeting domain of LAMP in this order.

Abstract: A nucleic acid molecule including at least one expression control sequence having an Internal Ribosomal Entry Site (IRES) sequence, at least one coding region, and optionally multiple adenosines or thymidines upstream of the at least one expression control sequence is disclosed as an expression system. Besides, a recombinant expression vector including the nucleic acid molecule and pharmaceutical or medicinal use of the nucleic acid molecule are disclosed.

Abstract: Provided is a gene expression cassette which, for the production of a high-quality recombinant protein in bacteria, initiates translation after completion of transcription, and more specifically, to a gene expression cassette consisting of a switch capable of stopping translation initiation and a trigger system capable of activating the translation initiation from the switch by re-configuring the transcription-translation coupled system inherent in bacteria such that the translation is initiated only by a full-length mRNA chain template. The transcription and translation in the bacteria can be uncoupled by inserting a trigger sequence activating the translation initiation from the switch into the downstream (3? terminal) of a target recombinant gene by replacing a natural transcription translation-coupled 5? UTR with the switch. The productivity of a high-quality full-length recombinant protein can be increased while reducing the costs associated with a purification process.

Abstract: Compositions, devices, and systems for use in a high-throughput screening platform for identifying anti-aging compounds and/or mutations that extend replicative life span (RLS). Specifically, herein disclosed is a yeast cell daughter-arresting-program (DAP), as well as compositions used in devices and systems that allow measurement of replicative lifespan and identification of agents or mutations that modulate the lifespan.

Abstract: Polypeptides comprising maltose/maltotriose transporters are provided. Additionally, polynucleotides, DNA constructs, and vectors encoding a maltose/maltotriose transporter, or yeast cells harboring such polynucleotides are provided. The yeast cell may be a Saccharomyces eubayanus cell modified to increase the expression or transport activity of a maltose/maltotriose transporter at the plasma membrane of the cell. Further, methods are provided for making a fermentation product by culturing any one of the yeast cells described herein with a fermentable substrate. Finally, methods are provided to select for and isolate maltotriose-utilizing strains of Saccharomyces eubayanus.

Abstract: The present invention relates to a method of increasing the production efficiency of gene-edited plants, regenerated from plant protoplasts, by use of a Cas protein-guide RNA ribonucleoprotein (RNP). According to the present invention, the method of increasing the production efficiency of gene-edited plants makes it possible to efficiently produce target gene-mutated plants and to minimize the introduction of foreign DNA into plants. Thus, the present invention can be very advantageously used in a wide variety of fields, including agriculture, food and biotechnology.

Abstract: The present invention refers to a method for controlling undesired vegetation at a plant cultivation site, the method comprising the steps of providing, at said site, a plant that comprises at least one nucleic acid comprising a nucleotide sequence encoding a wild-type hydroxyphenyl pyruvate dioxygenase or a mutated hydroxyphenyl pyruvate dioxygenase (mut-HPPD) which is resistant or tolerant to a HPPD-inhibiting herbicide and/or a nucleotide sequence encoding a wild-type homogentisate solanesyl transferase or a mutated homogentisate solanesyl transferase (mut-HST) which is resistant or tolerant to a HPPD-inhibiting herbicide, applying to said site an effective amount of said herbicide. The invention further refers to plants comprising mut-HPPD, and methods of obtaining such plants.

Abstract: This disclosure relates to a transgenic plant or plant tissue. In particular, this disclosure relates to a transgenic plant or plant tissue or plant cell comprising at least one polynucleotide comprising at least one sequence encoding a variable domain of a heavy-chain antibody (VHH) specifically binding to a sphingolipid of a fungus. Advantageously, the expression of the polynucleotide in at least part of the transgenic plant or plant tissue or plant cell (i) protects at least part of the transgenic plant or plant tissue or plant cell from an infection with a plant pathogenic fungus, (ii) inhibits the growth of a plant pathogenic fungus on at least part of the transgenic plant or plant tissue or plant cell, or (iii) increases the resistance of at least part of the transgenic plant or plant tissue or plant cell against a plant pathogenic fungus.

Abstract: A method for establishing, restoring or increasing the Rz2 gene mediated resistance to the Beet necrotic yellow vein virus (BNYVV) in the target plant is enabled via the identification and provision of a gene which modulates said resistance according to the invention. In particular, the BNYVV resistance mediated by the Rz2 resistance gene depends on the presence of the gene of the present invention. The gene being involved in conferring said resistance, and embodiments of the present invention that are described in the preceding, offer additional applications, e.g., the use of the resistance modifying gene allele in cis-genetic or trans-genetic approaches, with the goal of developing new resistant cultivars.

Abstract: The present invention relates to new codon-optimized cry1Da nucleic acid molecules from a gene sequence isolated from bacterium Bacillus thuringiensis. These molecules are used in the preparation of nucleic acid constructs, vectors and host cells, allowing the production of transgenic plants, such as corn, resistant to invertebrate pests, such as insects from the order Lepidoptera, particularly Spodoptera frugiperda (Noctuidae, Lepidoptera) and Diatrea saccharalis (Crambidae, Lepidoptera). Plant cells and transgenic plants comprising the molecules or constructs of the invention are also objects of the present invention. In particular, the transgenic plants according to the present invention are able to control caterpillars of the cited species that have become resistant to plants containing the cry1F gene.

Abstract: Methods and compositions disclosed herein generally relate to genes involved in plant reproduction and methods of using the same.

Abstract: The invention provides expression vectors and host cells for high-level expression of recombinant proteins. The expression vectors comprise Chinese hamster ovary elongation factor 1-? (CHEF1) transcriptional regulatory DNA elements and a cytomegalovirus (CMV) promoter and/or a human adenovirus tripartite leader (AdTPL) sequence. The invention achieves increased protein expression and better productivity of host cells compared to previously described expression systems.

Abstract: Disclosed herein are compositions and methods that involve using compositions for directly reprogramming skin cells into insulin-producing cells both in vitro and in vivo. These compositions and methods are useful for a variety of purposes, including the treatment of insulin-dependent and insulin-resistant diabetes. Therefore, also disclosed is a method for treating diabetes in a subject that involves reprogramming an effective amount of skin cells in the subject into an insulin producing cell using the method disclosed herein.

Abstract: Engineered transposons and methods of use thereof are provided. The transposons typically include an RNA component and a protein component. The RNA component can include, for example, a DNA targeting sequence, one or more protein binding motifs, and a nucleic acid sequence of interest to be integrated into a target DNA. The protein component is typically derived from a RLE LINE element protein and can include a DNA binding domain, an RNA binding domain, a reverse transcriptase, a linker domain, and an endonuclease. Pharmaceutical compositions and methods of use for introducing nucleic acid sequences into the genomes of cells are also provided.

Abstract: The disclosed methods are generally directed to preventing, treating, suppressing, controlling or otherwise mitigating side effects of T-cell therapy, the T-cell therapy designed to accelerate immune reconstitution, induce a graft-versus-malignancy effect, and/or target tumor cells. In some embodiments, the present disclosure provides expression vectors including a first expression control sequence operably linked to a first nucleic acid sequence, the first nucleic acid sequence encoding a shRNA to knockdown hypoxanthine-guanine phosphoribosyl transferase.

Abstract: The invention provides a new expression system comprising a mammalian selectable marker that promotes desirable post-translational modifications of glycoproteins. In particular, the invention includes methods and compositions for optimal recombinant protein expression in mammalian cells by employing a selection marker system based on GPT genes of mammalian origin. The invention includes methods that facilitate selectivity and enhanced expression copies as well as protein yield of recombinant proteins in mammalian cells, and methods of using GPT expression systems.