Abstract: The method for forming an image with a wide dynamic range makes use of an image sensor containing subsets of pixels that can be individually reset. After an initial reset (21), a pixel or row of pixels is exposed (22) for a first time interval and the gray value(s) (Plong(255)) are read out (23) and stored (24). The pixel or row of pixels is then reset (25) and exposed (26) for a second, shorter time interval. The second gray value(s) (Pshort(255)) is/are read out (27) and either stored or immediately combined (28) with the first gray value(s) (Plong(255)) by means of a merging function (ƒ). The merging function (ƒ) ensures a monotonic, smooth change in output from the lowest to the highest gray values. The procedure is repeated for all pixels or rows of pixels in the image sensor, thus obviating the need for the storage of complete images. The method reduces temporal aliasing to a minimum and eliminates spatial aliasing.
Type:
Grant
Filed:
November 12, 1999
Date of Patent:
August 9, 2005
Assignee:
CSEM Centre Suisse d'Electronique et de Microtechnique SA
Inventors:
Peter Seitz, Graham K. Lang, Nicolas Blanc
Abstract: A system has first and second metadata streams with respect to a video stream, the first metadata stream time-coded with respect to the video stream and the second metadata stream not time-coded with respect to the video stream. The the second metadata stream is aligned with the first metadata stream. Time ccodes are added to the second metadata stream, based on the alignment. Proper names are searched for within the second metadata stream. Faces are found within the video stream, faces are matched with proper names, and the matched faces and proper names are placed into a reference library.
Abstract: The invention concerns a method for causing a plugin to be executed, in particular for test purposes, on one or on several computers. The plugin is transmitted to at least one computer (11.1, 11.2, 11.3) through a network (2). Subsequently the plugin causes the at least one computer (11.1, 11.2, 11.3) to execute it.
Abstract: A compound consisting of an oligonucleotide of sequence CAGCAGCAGAGTCTTCATCAT, where the oligonucleotide has a phosphorothioate backbone throughout, the sugar moieties of nucleotides 1-4 and 18-21 bear 2?-O-methoxyethyl modifications, and the remaining nucleotides (nucleotides 5-17) are 2?-deoxynucleotides, and where the cytosines of nucleotides 1, 4 and 19 are 5-methylcytosines. The compound has increased stability in vivo and improved in vitro and in vivo antitumor activity.
Type:
Grant
Filed:
February 22, 2002
Date of Patent:
May 31, 2005
Assignee:
The University of British Columbia
Inventors:
Martin Gleave, Paul S. Rennie, Hideaki Miyake, Colleen Nelson, Brett P. Monia
Abstract: Lenses and bezels for lamps provide an appealing aesthetic look in the form of a colored glow at the edges of the lens or bezel by incorportation of an photoluminescent material in a molded polycarbonate body. The lenses are particularly suitable for use as an automotive outer lens, and can also improve the quality of the light emitted through this outer lens by interacting with the light bulb. The emitted beam is of a legal color and intensity as defined per the SAE J578 standard. The lighting performance may also be improved in such manner as reducing glare, increasing brightness or producing a beam that enhances road visibility at night to the human eye.
Type:
Grant
Filed:
May 13, 2002
Date of Patent:
May 17, 2005
Assignee:
General Electric Company
Inventors:
Philippe Schottland, David S. Bryce, Thomas Bouchard
Abstract: The software incorporates a glossary management tool that makes it easy for each client to customize terminology to the needs of a particular business. With this tool, termed a glossary manager, a company can customize a number of feature names in the system to provide a more familiar context for their users. A system administrator can also customize the manner in which “thumbnail” or “preview” images are presented. The system performs clustering on search queries, and searches media records multi-modally, using two or more approaches such as image searching and text searching. An administrator can tune search parameters. Two or more streams of metadata may be aligned and correlated with a media file, facilitating later searching. The system evaluates itself. It folds popularity information into rankings of search results.
Abstract: New mutant forms of human dihydrofolate reductase (DHFR) which have properties superior to the previously disclosed mutants have mutations at both amino acid 22 and amino acid 31. Specific mutant forms are Ser31Tyr22, Ser31Phe22, Gly31Tyr22, Gly31Phe22, Ala31Tyr22 and Ala31Phe22. The mutant DHFR of the invention may be used as a selectable marker, and to modify the genome of human cells, particularly bone marrow cells or peripheral blood stem cells, to render them resistant to chemotherapy using antifolate agents.
Type:
Grant
Filed:
August 27, 2003
Date of Patent:
May 3, 2005
Assignee:
Sloan-Kettering Institute for Cancer Research
Inventors:
Joseph R. Bertino, Emine A. Ercikan-Abali, Debabrata Banerjee, Shin Mineishi, Michel Sadelain
Abstract: Usually, polycarbonate polymerization is limited by the rate at which inhibitory byproducts, such as phenol and salicylate, can be removed from the reaction. To facilitate the removal of volatile reaction byproducts from the reaction as polymerization occurs, the present invention provides a spray mist reactor. The formation of a spray mist polymerization reaction allows for the creation of an enormous surface area for exchange of volatile byproducts. The present invention is applicable to polymerization of polycarbonate and its copolymers starting with monomers or oligomers. The invention may be used to increase throughput and minimize initial investment for a give melt process, especially the fast reacting bis(methylsalicylate) carbonate process.
Type:
Grant
Filed:
October 4, 2002
Date of Patent:
May 3, 2005
Assignee:
General Electric Company
Inventors:
James Day, Patrick J. McCloskey, Paul M. Smigeiski, Jr.
Abstract: A method for use by buyers and sellers in the execution of trades. The price of each executed trade within the system is logged. Next, a trend line is derived from the logged trades. The trading fee for a particular trade is determined based on the difference between the trade's price and the trend line as well as the size of the trade. This fee is imposed upon the buyer if the price of the trade is below the trend line, or imposed upon the seller if the price of the trade is above the trend line. The market markers in each item are evaluated according to how narrow their spreads were at the time of each transaction, and receive periodic bonuses based on these evaluations. A “crisis fee” is imposed on trades in the system when particularly measured qualities exceed normal bounds.
Type:
Grant
Filed:
April 7, 2000
Date of Patent:
April 19, 2005
Inventors:
Alan F. Kay, Hazel Henderson, Charles Pyne
Abstract: A power supply unit controller for a rack enclosure in which a plurality of devices communicate via a backplane is disclosed. The controller reads at least one signal indicative of an output supply level being provided to the backplane by a power supply unit associated with the power supply unit controller and stores at least one value associated with a respective one of the at least one signal. The controller communicates the at least one value to one of the devices; and receives power for the power supply unit controller from the backplane.
Type:
Grant
Filed:
July 6, 2001
Date of Patent:
April 19, 2005
Assignee:
Richmount Computers Limited
Inventors:
Barrie Jeremiah Mullins, Michael Lardner, Aedan Diarmuid Cailean Coffey
Abstract: Physical samples are characterized to determine the content of the samples. A physical sample, or pair of physical samples, and the sample(s) are processed to generate a multidimensional response, calculating the 1-dimensional response of the components, to provide an indication of the content of the sample or samples. The multidimensional response may be measured by fluorescence or nuclear magnetic resonance.
Abstract: The present invention concerns a method for producing an image in the edge of a volume of paper sheets. The invention can be used for numerous stationary products, note pads, exercise books, and the like. In the present invention, the images are printed not on the edges but on the paper surface. The method comprises a series of steps: printing-realigning-guillotining. The invention also concerns the insertion of a segmented image, systematically in edges and added in the make-up of a volume, for use in a complex technological process.
Abstract: A messaging system is disclosed for the purpose of delivering data in the form of a portable message format from a producer of any kind, over any transport protocol, using any delivery guarantee, to one or more recipients of any kind. The method for running said message system includes a message broker with at least one pluggable protocol adapter. It may also comprises at least one pluggable message format adapter and at least one pluggable message content adapter, thus enabling to use a simple unified topic or queue abstraction between the involved communication parties. Specifically, the method includes protocol adapters, message format adapters and message content adapters to wireless networks and devices, as well as message adapters to convert the portable messages between the different formats used in different computer programming languages.
Abstract: A pH electrode having a pH-sensitive region on an electrically conductive support, said pH-sensitive region comprising a mixture of between 50% and 85% of the total mixture by weight of particles of a Group VA or Group VIII metal incorporated in, or applied to, a polymer substrate of a non-shrinking plastic selected from polyimides, the polymer substrate having a resistivity of 10 to 100 Kohms/square the metal particles including antimony particles and, when said particles are incorporated into said resistive polymer substrate, having said pH-sensitive region abraded to expose said particles.
Type:
Grant
Filed:
November 2, 2001
Date of Patent:
March 1, 2005
Assignee:
Gastro Holdings PTY LTD
Inventors:
John Thornton Bannigan, Malcolm Rosswyn Haskard, Dennis Estcourt Mulcahy
Abstract: Particle aggregation of lipid:nucleic acid complex particles is prevented by incorporating a non-cationic lipid into lipid:nucleic acid complex particles containing a cationic lipid and a nucleic acid polymer. The non-cationic lipid is a polyethylene glycol-based polymer.
Type:
Grant
Filed:
June 5, 2001
Date of Patent:
February 22, 2005
Assignee:
Inex Pharmaceuticals Corporation
Inventors:
Jeffrey Wheeler, Marcel B. Bally, Yuan-Peng Zhang, Dorothy L. Reimer, Michael Hope
Abstract: A thermoplastic molding composition comprises a resin composition having 50 to about 90 weight percent of a polyester, about 8 to about 48 weight percent of a polyetherimide, about 2 to about 25 weight percent of a high rubber graft impact modifier, each based on the total resin composition, and up to about 15 weight percent of a particulate filler. A making the composition comprises pre-melt compounding a polyester, a polyetherimide, and a high rubber graft impact modifier to form a pre-compounded blend, wherein the pre-compounded blend has a Tg of greater than or equal to about 110° C.; and dry-blending a crystallized polyester with the pre-compounded blend to form the molding composition. Such molding compositions are particularly useful in blow-molding container for liquids such as beer.
Type:
Grant
Filed:
May 8, 2002
Date of Patent:
February 22, 2005
Assignee:
General Electric Company
Inventors:
Sebastiaan Bernardus Damman, Gerrit de Wit
Abstract: The present invention provides cationic-polymer-lipid conjugates (CPLs) such as distal cationic-poly(ethylene glycol)-lipid conjugates which can be incorporated into conventional and stealth liposomes or other lipid-based formulation for enhancing cellular uptake. The CPLs of the present invention comprise a lipid moiety; a hydrophilic polymer; and a polycationic moiety. Method of increasing intracellular delivery of nucleic acids are also provided.
Type:
Grant
Filed:
April 20, 2000
Date of Patent:
February 8, 2005
Assignee:
The University of British Columbia
Inventors:
Pieter R. Cullis, Tao Chen, David B. Fenske, Lorne R. Palmer, Kim Wong
Abstract: The present invention relates to a percutaneous bone anchored transferring device and a connecting device for obtaining a transfer of an electrical signal and/or energy and/or distribution of a drug and/or airing of a body cavity and a system and a method for using the same.
Abstract: The present invention includes a device and a method of applying a coating to a web. The preferred device comprises a feed nozzle coupled to a stiffener coupled to a spring coupled to a position/force adjuster. The feed nozzle comprises a fluid reservoir, a feed pipe, a metering surface, end seals and a back seal. The stiffener spring, as the frame deflects and polymer covered rolls deform, permits the rotation of the feed nozzle so a proper geometry is maintained, permitting increased control and a wider film thickness control range for a specific nozzle shape. This device permits greater film thickness control, ability to process at much higher speeds than currently achievable, and a wider range of film thickness. This device permits coatings to be applied at much wider ranges of rheological characteristics. Coatings can be applied at higher percent solids with improved characteristics. Multiple feed nozzles provide rapid product changeover for greater equipment utilization and higher productivity.
Abstract: Lipidic compositions with superior characteristics for in vivo delivery of oligodeoxynucleotides (ODN) can easily and efficiently be made in the form of small multilamellar vesicles. The compositions contain a population of nucleic acid-containing lipid vesicles in a liquid carrier, and at least a portion of the lipid vesicles are small multilamellar vesicles. The small multilamellar vesicles are made from a lipid component including 20-30 mol % of an ionizable amino lipid such as DODAP, and a steric barrier lipid such as PEG-CerC14; and an oligodeoxynucleotide contained in the lumen or interlamellar spaces of the small multilamellar vesicles. The ODN and lipid components are preferably present in the small multilamellar vesicles in a mole ratio of from 0.15 to 0.25.
Type:
Grant
Filed:
September 1, 2000
Date of Patent:
December 28, 2004
Assignee:
The University of British Columbia
Inventors:
Sean C. Semple, Sandra K. Klimuk, Troy O. Harasym, Nancy Dos Santos, Steven M. Ansell, Pieter R Cullis, Michael J. Hope, Peter Scherrer, Deirdre McIntosh, Kim F. Wong, Norbert Maurer