Abstract: A probe that is a labelled segment of RNA complementary to and capable of specifically hybridizing with denatured HCV RNA, and prepared from 5' sense, GGCGACACTCCACCATGAAT and 3' antisense, ccagagcatctggcacgtgg primers, from the 5' untranslated region of the HCV genome, is employed for detecting and identifying the presence of hepatitis C virus (HCV) in tissue.

Abstract: An assay for systemic lupus erythematosus based upon capture of the anti-dsDNA portion of IgG in a human serum specimen by the Fc part of a molecule using solid phase immobilized F(ab')2 fragment of anti-human IgG specific for Fc, the captured IgG being then incubated with a synthetic dsDNA tagged with a moiety from which a signal proportional to the quantity of said synthetic dsDNA can be elicited. Upon eliciting a signal from the moiety, the amount of antibody to dsDNA can be quantified, providing diagnostic and prognostic information regarding the disease.

Abstract: An autozero compensation system for autozeroing the output of a data conversion circuit comprising a floating point amplifier and an analog-to-digital converter. The autozero compensation system comprises a source for generating a desired offset voltage, a plurality of digital counters, one for each gain setting of the amplifier, for storing values which are functions of the offset voltages for the gain settings, and a comparator for comparing the output of the A/D converter with the desired offset. Periodically, each of the counters in the autozero circuit is updated for each gain setting by setting the analog input of the amplifier to system ground and the gain of the amplifier set to each of the gain settings, so that the output of the comparator is used to update each of the counters. The outputs of the counters are each converted to analog form by a D/A converter and used to provide the offset correction voltage to the floating point amplifier.

Abstract: A hide stretching apparatus, in particular one for the tentering of hides for drying. The apparatus comprises a stretching frame with a number of mutually spaced radial sliding guides. The stretching clamps gripping the edges of the hide have been arranged to be reciprocatingly movable along the sliding guides. The stretching frame is placed upon a special hide changing table carrying under each sliding guide a clamp displacement member. The clamps carry jaws which attach to the edge of the hide to be stretched. The jaws are opened and closed by means of a lever turnably carried on the clamp. The clamp displacement member has two gripping members, which can be made to engage the clamp on both sides according to commands given, for the displacing of the clamps reciprocatingly along the sliding guides. The clamp comprises a brake engaging with the sliding guide and which with the jaws in closed position prevents the displacement of the clamp towards the center of the stretching frame.