Abstract: The present invention provides an isolated nucleic acid molecule comprising, or consisting of, the nucleic acid sequence of SEQ ID NO:1 or a nucleic acid sequence of at least 150 bp having at least 80% identity to said sequence of SEQ ID NO:1, wherein said isolated nucleic acid molecule specifically leads to the expression in rod photoreceptors of a gene when operatively linked to a nucleic acid sequence coding for said gene.

Abstract: The present invention provides an isolated nucleic acid molecule comprising, or consisting of, the nucleic acid sequence of SEQ ID NO:1 or a nucleic acid sequence of at least 400 bp having at least 80% identity to said sequence of SEQ ID NO:1, wherein said isolated nucleic acid molecule specifically leads to the expression in Muller cells of a gene when operatively linked to a nucleic acid sequence coding for said gene.

Abstract: The present invention provides an isolated nucleic acid molecule comprising, or consisting of, the nucleic acid sequence of SEQ ID NO:1 or a nucleic acid sequence of at least 400 bp having at least 80% identity to said sequence of SEQ ID NO:1, wherein said isolated nucleic acid molecule specifically leads to the expression in rod photoreceptors of a gene when operatively linked to a nucleic acid sequence coding for said gene.

Abstract: The present invention provides an isolated nucleic acid molecule comprising, or consisting of, the nucleic acid sequence of SEQ ID NO:1 or a nucleic acid sequence of at least 300 bp having at least 80% identity to said sequence of SEQ ID NO:1, wherein said isolated nucleic acid molecule specifically leads to the expression in rod photoreceptors of a gene when operatively linked to a nucleic acid sequence coding for said gene.

Abstract: The present invention provides an isolated nucleic acid molecule comprising, or consisting of, the nucleic acid sequence of SEQ ID NO:1 or a nucleic acid sequence of at least 300 bp having at least 80% identity to said sequence of SEQ ID NO:1, wherein said isolated nucleic acid molecule specifically leads to the expression in rod photoreceptors of a gene when operatively linked to a nucleic acid sequence coding for said gene.

Abstract: The present invention provides an isolated nucleic acid molecule comprising, or consisting of, the nucleic acid sequence of SEQ ID NO:1 or a nucleic acid sequence of at least 600 bp having at least 80% identity to said sequence of SEQ ID NO:1, wherein said isolated nucleic acid molecule specifically leads to the expression in retinal endothelial cells of a gene when operatively linked to a nucleic acid sequence coding for said gene.

Abstract: The present invention relates to an isolated nucleic acid molecule comprising a nucleotide sequence coding for a depolarizing light-gated ion channel functionally linked to a promoter leading to the specific expression of said depolarizing light-gated ion channel in a retinal photoreceptor, or the nucleotide sequence complementary to said nucleotide sequence, for use in treating or ameliorating blindness. The present invention also relates to methods of using such nucleic acid molecules in the treatment of blindness.

Abstract: The present inventions relates to isolated nucleic acid molecules comprising a nucleotide sequence coding for miRNA-182 (uuuggcaaugguagaacucacacu or ugguucuagacuugccaacua), miRNA-96 (uuuggcacuagcacauuuuugcu or aaucaugugcagugccaauaug) and/or miRNA-183 (uauggcacugguagaauucacu or gugaauuaccgaagggccauaa) for use in treating or ameliorating a ciliopathy and/or a photoreceptor dysfunction.

Abstract: The present invention provides an isolated nucleic acid molecule comprising, or consisting of, the nucleic acid sequence of SEQ ID NO: 1 or a nucleic acid sequence of at least 200 bp having at least 70% identity to the sequence of SEQ ID NO: 1, wherein the isolated nucleic acid molecule specifically leads to the expression in retinal amacrine bipolar cells of a gene when operatively linked to a nucleic acid sequence coding for the gene.

Abstract: The present invention relates to the use of an isolated nucleic acid molecule comprising a nucleotide sequence coding for a hyperpolarizing light-gated ion channel or pump gene from an archeon or for a light-active fragment of said gene, or the nucleotide sequence complementary to said nucleotide sequence, for treating or ameliorating blindness. The light-gated ion channel or pump gene can be a halorhodopsin gene.

Abstract: An isolated nucleic acid molecule comprising the nucleic acid sequence of SEQ ID NO:1, or a nucleic acid sequence of at least 1000 bp having at least 70% identity to the sequence of SEQ ID NO:1. The isolated nucleic acid molecule can lead to the expression of a gene in retinal ON bipolar cells when a nucleic acid sequence coding for a gene is operatively linked to the isolated nucleic acid molecule.

Abstract: The present inventions relates to the use of an isolated nucleic acid molecule comprising a nucleotide sequence coding for a hyperpolarizing light-gated ion channel or pump gene from an archeon or for a light-active fragment of said gene, or the nucleotide sequence complementary to said nucleotide sequence, for treating or ameliorating blindness. The light-gated ion channel or pump gene can be a halorhodopsin gene.

Abstract: The present invention relates to a method for treating breast cancer in a subject having a breast cancer of the estrogen receptor (ER?) negative type, which method comprises the step of administering to said subject a therapeutically effective amount of a modulator of the Large Tumor Suppressor Kinase (LATS). Also provided are a siRNA decreasing or silencing the expression of the Large Tumor Suppressor Kinase (LATS), and an antibody specifically binding to the Large Tumor Suppressor Kinase (LATS), for use to treat breast cancer of the estrogen receptor (ER?) negative type.

Abstract: The present invention provides an isolated nucleic acid molecule comprising, or consisting of, the nucleic acid sequence of SEQ ID NO:1 or a nucleic acid sequence of at least 200 bp having at least 70% identity to said sequence of SEQ ID NO:1, wherein said isolated nucleic acid molecule specifically leads to the expression in cones and/or OFF bipolar cells of a gene when operatively linked to a nucleic acid sequence coding for said gene.

Abstract: The present inventions relates to isolated nucleic acid molecules comprising a nucleotide sequence coding for mi RNA-182 (uuuggcaaugguagaacucacacu or ugguucuagacuugccaacua), miRNA-96 (uuuggcacuagcacauuuuugcu or aaucaugugcagugccaauaug) and/or mi RNA-183 (uauggcacugguagaauucacu or gugaauuaccgaagggccauaa) for use in treating or ameliorating a ciliopathy and/or a photoreceptor dysfunction.

Abstract: The present invention provides an isolated nucleic acid molecule comprising, or consisting of the nucleic acid sequence of SEQ ID NO:1 or a nucleic acid sequence of at least 1000 by having at least 70% identity to said sequence of SEQ ID NO:1, wherein said isolated nucleic acid molecule specifically leads to the expression in ON bipolar cells of a gene when operatively linked to a nucleic acid sequence coding for said gene.

Abstract: The present invention provides a method for generating polycystronic nucleic acid vectors, said method comprising the steps of a) providing a first nucleic acid vector, said first nucleic acid vector comprising: i) an origin of replication placed in front of ii) at least one first gene of interest functionally cloned within a first expression cassette, said first expression cassette comprising a promoter sequence as well as a termination sequence, said first gene of interest being located between said promoter sequence and said termination sequence, iii) a marker gene together with its termination sequence, said marker gene being situated downstream of a target sequence for a recombinase, wherein the promoter necessary for the expression of said marker gene in a host cell is absent from said first nucleic acid vector, and optionally iv) a first further marker gene which is different from the marker gene of iii), said first further marker gene being situated within said first expression cassette of ii) or with

Abstract: The present invention provides a method for preparing a sample for microscopy, said method comprising the steps of contacting said sample with a first polymerizable resin under conditions and for a time sufficient for penetration of said first polymerizable resin into the sample, removing excessive first polymerizable resin from the surface of the sample, contacting the so-prepared sample containing said first polymerizable resin with a second polymerizable resin preparation, said second polymerizable resin preparation comprising a high concentration of electrically conductive particles, and subjecting the so-prepared sample to the curing temperature of the polymerizable resins, wherein the curing temperature of said second polymerizable resin preparation is substantially the same as the curing temperature of the first polymerizable resin.

Abstract: The present invention provides a method for the targeted infection of cells. Said method is characterized in that it comprises the step of contacting the cell with a virus attached to a support. The present invention also encompasses a support to which a molecule binding specifically to a molecule present on the surface of a virus is attached, said molecule binding specifically to a molecule present on the surface of said virus being optionally attached to the support through a linking moiety.

Abstract: The present invention provides an isolated nucleic acid molecule comprising, or consisting of, the nucleic acid sequence of SEQ ID NO:1 or a nucleic acid sequence of at least 200 bp having at least 70% identity to said sequence of SEQ ID NO:1, wherein said isolated nucleic acid molecule specifically leads to the expression in cones and/or OFF bipolar cells of a gene when operatively linked to a nucleic acid sequence coding for said gene.