Abstract: The present invention concerns methods and compositions employing a combination of Uncaria rhynchophylla (UR) herb and an antidepressant or anxiolytic drug therapy for treating or preventing anxiety, stress, depression, and/or symptoms thereof, wherein the combined administration of UR and the drug elicit a fast on-set response in the subject.

Abstract: A method of managing change in a complex system begins with identifying an unsatisfied need to be met by the system. To satisfy the need a proposed change to the system to satisfy the need is represented a high-level representation of the proposed change. The high-level representation is mapped to a low-level executable semantic model, which is used to validate the proposed change and ensure the proposed change meets the identified and does not require additional changes to the system. On a condition that the validating steps determines that additional changes are required the additional changes are represented in the high-level representation of the system; the high-level change is mapped to the low-level executable semantic model and the additional changes are re-validated.

Abstract: A method for producing an engineered tissue scaffold for neural repair is described. The method includes tethering a hydrogel matrix seeded with tension-generating cells to a frame, and allowing the tension-generating cells to generate tension within the matrix, such that the cells self-align. The matrix may then be at least partially dehydrated to form a sheet. The tension-generating cells are stem cells capable of differentiating into cells having Schwann-cell-like properties, or are derived from such stem cells. In preferred embodiments, the cells are neural stem cells, for example conditionally immortalized neural stem cells of fetal cortex origin.

Abstract: The present invention relates to artificial tissue growth guides comprising a core and an outer sleeve, which facilitates the regeneration of damaged tissues, such as nerves. The core is fixed to the sleeve at two attachment sites so that cells seeded within the core produce mechanical tension between the attachment sites. This tension aligns the cells and the fibres of the core and provides an improved substrate for tissue regeneration. Growth guides may be surgically implanted into an individual.

Abstract: Aptamers against the glycosylated form of MUC1 are described, along with their use in treatment and diagnosis of conditions associated with elevated production of MUC1.

Abstract: A novel rice cultivar, designated C3GHi, is disclosed. The invention relates to the seeds of rice cultivar C3GHi, to the plants of rice C3Ghi, which contain 2371 mg of cyanidin 3-glucoside pigment per 100 g of seeds, of which pigment content is much higher than an existing rice cultivar Heugjinju.

Abstract: The invention provides a compound having formula X1-Arg-Xaa-Arg-X2 in which X1 and X2 are up to 30 amino acid residues and Xaa is an amino acid residue. A preferred compound is the tripeptide Arg-Glu-Arg which corresponds to amino acid residues 328 to 330 of human amyloid precursor protein. The invention further provides a derivative of a polypeptide having the formula: X1-Arg-Xaa-Arg-X2 wherein X1 and X2, which may be the same or different, each represents from zero to 30 natural or synthetic amino acid residues or derivatives thereof and Xaa represents a natural or synthetic amino acid residue or derivative thereof, at least one functional group of at least one said amino acid residue or derivative thereof being protected by a protective group. The compounds of the invention are believed to be useful in the treatment of Alzheimer's disease and as cognitive enhancers.

Abstract: Aptamers against the glycosylated form of MUC1 are described, along with their use in treatment and diagnosis of conditions associated with elevated production of MUC1.

Abstract: The invention provides a compound having formula X1-Arg-Xaa-Arg-X2 in which X1 and X2 are up to 30 amino acid residues and Xaa is an amino acid residue. A preferred compound is the tripeptide Arg-Glu-Arg which corresponds to amino acid residues 328 to 330 of human amyloid precursor protein. The invention further provides a derivative of a polypeptide having the formula: X1-Arg-Xaa-Arg-X2 wherein X1 and X2, which may be the same or different, each represents from zero to 30 natural or synthetic amino acid residues or derivatives thereof and Xaa represents a natural or synthetic amino acid residue or derivative thereof, at least one functional group of at least one said amino acid residue or derivative thereof being protected by a protective group. The compounds of the invention are believed to be useful in the treatment of Alzheimer's disease and as cognitive enhancers.

Abstract: Peptides having the sequence D-Arg-L-Glu-L-Arg, or the sequence L-Arg-D-Glu-L-Arg and derivatives thereof, are disclosed. Such peptides are useful in treatment of neurodegenerative disorders, and as cognitive enhancers. Preferred peptides include a protective group.

Abstract: A method for culturing preadipocytes isolated ex vivo is described, the method including introducing preadipocytes into a three dimensional support matrix, and allowing the cells to differentiate in vitro into adipocytes within the support matrix. The matrix may be a collagen matrix. The method may be used for investigating the development of stem cells, or for investigating the response of adipocytes to stimuli. The method provides a system whereby adipocytes with biological properties resembling those in vivo can be grown in vitro.

Abstract: The invention provides compounds having formulae comprising X1-Ser-Met-Arg-Glu-Arg-X2 in which X1 and X2 are up to 30 amino acid residues and the formula represents a reverse-order sequence corresponding to amino acid residues 332 to 328 of human APP and from zero to 30 successive amino acid residues of human APP extending in each direction therefrom, The invention also provides the pentapeptide Ser-Met-Arg-Glu-Arg, corresponding to residues 332 to 328 of human amyloid precursor protein in reverse order, and the tripeptide Arg-Glu-Arg which corresponds residues 328 to 330 of human amyloid precursor protein, the tripeptide and pentapeptide being provided as pharmaceutical compositions. The invention further provides conjugates of the foregoing compounds which can cross the blood-brain barrier and pharmaceutical compositions containing such conjugates.

Abstract: There are disclosed aptamer ligands to MUC1, preferably comprising a sequence selected from: ?1 CGAATGGGCCCGTCCTCGCTGTAAG ?2 GCAACAGGGTATCCAAAGGATCAAA ?3 GTTCGACAGGAGGCTCACAACAGGC ?4 TGTTGGTCAGGCGGCGGCTCTACAT ?5 CTCTGTTCTTATTTGCGAGTTXXXX ?6 XCTCTGTTCTTATTTGCGAGTTXXX ?7 XXCTCTGTTCTTATTTGCGAGTTXX ?8 XXXCTCTGTTCTTATTTGCGAGTTX ?9 XXXXCTCTGTTCTTATTTGCGAGTT 10 CTCTGTTCTTATTTGCGAGTT 11 CCCTCTGTTCTTATTTGCGAGTTCA 12 CTCTGTTCTTATTTGCGAGTTGGTG 13 CCCTCTGTTCTTATTTGCGAGTTCA 14 TAAGAACAGGGCGTCGTGTTACGAG 15 GTGGCTTACTGCGAGGACGGGCCCA 16 GCAGTTGATCCTTTGGATACCCTGG 17 AACCCTATCCACTTTTCGGCTCGGG 18 CGATTTAGTCTCTGTCTCTAGGGGT 19 CGACAGGAGGCTCACAACAGGCAAC 20 AGAACGAAGCGTTCGACAGGAGGCT 21 AGAAACACTTGGTATATCGCAGATA 22 GGGAGACAAGAATAAACACTCAACG and compounds comprising these aptamers and sequences.

Abstract: A gravity meter comprises a casing, a vacuum tube mounted in the casing in a vibration-free manner, a sensor mechanism mounted within the vacuum tube, the sensor mechanism comprising two masses of different size acting on the respective arms of a beam balance comprising a material whose shape is arranged to change in response to changes in gravity and whose shape can be restored by the application of an electrical current thereto, and detector means arranged to provide from the restoring current an output representative of changes in gravity. The material is preferably a piezoelectric material.

Abstract: In the establishment of interference colors in weakly birefringent materials within living organisms, in fixed tissues or in preparations of liquid crystals, a compensating birefringent plate is positioned in series with the object in the direction of the light path between a crossed polarizer and analyzer in a polarizing microscope, and is aligned with the vibrational direction of its slow wave at a small angle of horizontal rotation from the vibrational direction of the polarizer or of the analyzer. The small angle of rotation is between 2.degree. and 15.degree., more especially 4.degree. and 7.5.degree.. The chromatic response (color intensity) is enhanced and increased color contrast is obtained for all live organisms, freshly fixed sections, and liquid crystal preparations.