Abstract: Antimicrobial diferulates, compositions containing same, and uses of same for inhibiting growth of microorganisms. The antimicrobial diferulates can be used alone or in combination with other antimicrobial agents to inhibit growth of microorganisms such as fungi, oomycetes, and other microorganisms having a glucan-containing cell wall. The antimicrobial diferulates can be included in pharmaceutical compositions for treatment of animals or included in agricultural compositions for treatment of plants, crops, and soils.

Abstract: An energy harvesting system for use with the human body may use an eccentrically mounted weight winding a mainspring that drives a mechanical clock mechanism. The mechanical clock mechanism in turn may produce pulses of electricity, for example, through periodic flexing of a piezoelectric or triboelectric material during the regular motion of the mechanical timing mechanism. By remaining in a mechanical rather than electrical domain, improved simplicity and efficiency may be obtained in the generation of regularly spaced uniform pulses.

Abstract: An electrical rotating machine provides an integrated capacitive encoder for control of the stator field and enabling any of reduced size, reduced rotational inertia, and lower cost. The same structure may also support capacitive plates for capacitive power transfer to the rotor.

Abstract: A composition for the treatment of bladder fibrosis in a patient in need that includes a miR-29 mimic is disclosed. The miR-29 mimic may include a working RNA strand with the nucleotide sequence UAGCACCAUCUGAAAUCGGUUUU (SEQ ID NO 4) and a passenger RNA strand comprising the nucleotide sequence: AACCGAUUUCuuuUGGUGCUAUU (SEQ ID NO 5). The passenger RNA strand includes a 2?-O-methylation modification to increase stability. Cholesterol is conjugated to the 3?-end of the passenger RNA strand to enhance cellular uptake. The composition may further include a carrier molecule including, but not limited to, branched polyethylenimine at an N/P ratio of 0.8, where N denotes the nitrogens of the polyethylenimine and P denotes the phosphate groups of the working and passenger RNA strands. In some aspects, the composition may be an injectable composition that includes a polyplex dissolved in a 0.5% glucose solution, where the polyplex is formed from the working and passenger RNA strands and the carrier molecule.

Abstract: A method to make primary alcohols, carboxylic acids, amines, and other value-added chemicals from plastic waste. The method includes the steps of pyrolyzing plastic waste to yield pyrolysis oil; hydroformylating the pyrolysis oil in the absence of any added co-reactants to yield a mixture comprising aldehydes; and hydrogenating, oxidizing, aminating, or aldolizing the mixture to yield a product comprising primary alcohols, carboxylic acids, amines, or larger (>C10) chemicals with carbonyl function groups.

Abstract: Aspects of the disclosure are directed to methods and/or apparatuses involving modifying flow and/or concentration of an agent being injected for characterizing a vascular system. As may be implemented in accordance with one or more embodiments, a liquid including an agent is injected into a vascular system, by dynamically modulating a flow rate of the agent being injected over a range of flow rates. The vascular system is characterized based on a response of the vascular system to the dynamic modulation. In some implementations, such an approach involves using an injector that operates to separately control the rate at which an agent and other liquid such as saline are injected. These approaches can be implemented with modulation schemes using one or more of a variety of functions.

Abstract: A method to inhibit neutrophil recruitment to damaged tissue, thereby inhibiting inflammation in a subject. The method includes administering to an anti-inflammatory amount of a myeloid-derived growth factor (“MYDGF”). Also disclosed are corresponding pharmaceutical compositions of matter containing the MYDGF.

Abstract: Recombinant microorganisms configured for enhanced production of compounds such as 2-pyrone-4,6-dicarboxylic acid (PDC) and methods of using the recombinant microorganisms for the production of these compounds. The recombinant microorganisms include one or more modifications that reduce 2-pyrone-4,6-dicarboxylic acid (PDC) hydrolase activity, 4-carboxy-2-hydroxy-6-methoxy-6-oxohexa-2,4-dienoate (CHMOD) cis-trans isomerase activity, 4-carboxy-2-hydroxy-6-methoxy-6-oxohexa-2,4-dienoate (CHMOD) methyl esterase activity, and/or vanillate/3-O-methylgallate O-demethylase activity. The recombinant microorganisms can be used to generate PDC from media comprising plant-derived phenolics, such as syringyl phenolics, guaiacyl phenolics, and p-hydroxyphenyl phenolics. The plant-derived phenolics can be derived from pretreated lignin, including depolymerized lignin or other chemically altered lignin.

Abstract: A method of testing compounds for activity to inhibit germination of spores. The method includes the steps of providing bacterial, fungal, or plant spores transformed to contain and express a detectable marker, wherein the marker when expressed, is operationally linked to a spore-specific or yeast-specific protein, in a medium and under environmental conditions in which the spores will germinate, and measuring a first signal output generated by the marker prior to the spores initiating germination; contacting the spores of step (a) with a compound whose activity to inhibit germination of spores is to be measured; incubating the spores of step (b) under environmental conditions and for a time wherein spores not treated with the compound will germinate; and determining extent of germination of the spores by measuring a second signal output generated by the marker, wherein a difference between the first signal output and the second signal output is proportional to the extent of germination of the spores.

Abstract: The invention is directed to BAHD acyltransferase enzymes, nucleic acids encoding BAHD acyltransferase enzymes, and inhibitory nucleic acids adapted to inhibit the expression and/or translation of BAHD acyltransferase RNA; expression cassettes, plant cells, and plants that have or encode such nucleic acids and enzymes; and methods of making and using such nucleic acids, enzymes, expression cassettes, cells, and plants.

Abstract: A DNA expression construct comprising a polynucleotide encoding an unnatural UstD enzyme, the unnatural enzyme itself, and a method of making gamma-hydroxy amino acids by contacting an aldehyde-containing substrate, an amino acid, and the unnatural, purified UstD enzyme under conditions and for a time sufficient to react at least a portion of the aldehyde-containing substrate with at least a portion of the amino acid, to yield a gamma-hydroxy amino acid product.

Abstract: Methods of detecting cancer or a particular type or subtype thereof in a subject and treating the cancer or particular type or subtype thereof. The detection can comprise determining fragmentation patterns of classifier cell-free deoxyribonucleic acid (cfDNA) from the subject and classifying the fragmentation patterns to identify the subject as being negative or positive for the cancer or the particular type or subtype thereof. The classifier cfDNA can comprise cfDNA corresponding to at least a portion of at least one exon of one or more classifier genes. The exon can comprise the first exons of the classifier genes. The treating can comprise the specific type of subtype of cancer that is detected.

Abstract: Aspects of the disclosure are directed to additively manufacturing a three-dimensional structure. As may be implemented in accordance with one or more embodiments, a plurality of stacked layers are deposited, and for one or more respective layers of the plurality of stacked layers, pores are formed within the layer by applying pulsed energy to the layer. The pulsed energy is used to create a space sealed within the layer and having an inner surface defined by material of the layer.

Abstract: Described herein is cancer biomarker, e.g., a vesicle, capture surface that includes a substrate, a first plurality of nanoparticles attached to the substrate; a plurality of bifunctional tethers, wherein a first functionality of the bifunctional tethers is attached to at least a portion of the first plurality of nanoparticles; a second plurality of nanoparticles attached to a second functionality of at least a portion of the plurality of bifunctional tethers; a capture agent attached to at least a portion of the second plurality of nanoparticles; and a plurality of polymer brush molecules attached to the surface, wherein the polymer brush molecules have a lower molecular weight than the bifunctional tethers, and wherein the polymer brush molecules reduce nonspecific binding to the surface. Also described are method of capturing cancer biomarkers such as vesicles from a liquid biopsy sample.

Abstract: Genetically modified CCNT1 and XPO1 genes encoding proteins that inhibit virus infection in cells. The genetically modified CCNT1 gene encodes a protein with a C261Y substitution with respect to the human CCNT1 protein. The genetically modified XPO1 gene encodes a protein with P411T, M412V, and/or F414S substitutions with respect to the human XPO1 protein. The genetically modified CCNT1 and XPO1 genes can be introduced in cells. The cells comprising the genetically modified CCNT1 and XPO1 genes can be introduced in a subject with a virus infection to treat the infection.

Abstract: Tandem electrodialysis (ED) cell systems and methods for using the tandem ED cell systems to extract and recover ions from ion-containing solutions are provided. The tandem ED cell systems are composed of ion-extraction and ion-recovery ED cells. A redox couple contained in the anolyte of the ion-extraction ED cell is different from a redox couple contained in the catholyte of the ion-extraction ED cell. The electrode reactions in the ion-extraction ED cell are reversed in the ion-recovery ED cell, with the anolyte and catholyte of the two ED cells swapped and continuously circulated. As a result, the redox species in the anolyte and catholyte of the two cells are never depleted, which allows for achieving ion extraction and ion recovery with the use of a minimal amount of the redox couples.

Abstract: An expression cassette for gene silencing and replacement, including, in operable communication, a promoter, an expression attenuator, a nucleotide sequence encoding a gene for a replacement target protein, and an shRNA sequence for knockdown of an endogenous variant of the target protein, wherein the promoter, the expression attenuator, the nucleotide sequence encoding the gene for the replacement target protein, and the shRNA are expressed as a single transcript. Also included are expression vectors and cells. Also included are methods of silencing and replacement of a target gene in a cell in culture by transforming the cells with the expression vectors described herein. Also included are minimal expression cassettes suitable for therapeutic methods.

Abstract: Systems, methods, compositions of matter, and kits for undermedia repellency are disclosed. In some cases, these involve a first volume of a first liquid presented in a second volume of a second liquid above a first location of a first surface. The first liquid, second liquid, and first location can have properties sufficient to give rise to undermedia perfect liquid repellency.

Abstract: Mycobacterial-specific biomarkers and methods of using such biomarkers for diagnosis of mycobacterial infection in a mammal are disclosed.

Abstract: The present technology relates to compositions and methods for modulating expression of genes which include a target oligonucleotide sequence, such as repeats of a particular oligonucleotide sequence containing 3 to 10 nucleotides. In particular aspects, the present technology relates to agents having a formula A-L-B, wherein -L- is a linker; A- is a Brd4 binding moiety; and -B is a nucleic acid binding moiety, such as a polyamide or complementary oligonucleotide, that specifically binds to the target oligonucleotide sequence.