Abstract: A method for evaluating or monitoring metabolic effects of exercise or injury by detecting and/or quantifying microR-NAs in saliva. Compositions and methods of treatment based on detection of microRNAs.

Abstract: The present invention relates to methods and compositions for determination of and uses of specific methylation patterns indicative of adenoma and carcinoma. In particular, the invention relates to analysis of defined CpG loci that are coordinately methylated in DNAs from cancer and adenoma samples, methods for identifying coordinately methylated loci, and methods of using analysis of coordinately methylated loci in one or more marker regions in the design of assays for adenoma and cancer.

Abstract: A primer for isothermal amplification of nucleic acid and its application are described. The primer includes a forward primer and a reverse primer used for amplifying a target gene. The forward primer is a sequence with an exogenous self-paired hairpin structure at the 5? end, or a sequence with a hairpin structure matched with any source sequence in the target gene close to the forward primer end at the 5? end. Nucleic acid amplification technology using the primer of the invention can produce repeated tandem structure of the target gene, and the repetition times can be controlled precisely. The technology can also be applied to the third generation sequencing technology. The amplification steps are not only simple and fast, but also improve sequencing accuracy.

Abstract: This invention relates to a method of identifying mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene, a kit for performing the method, and furthermore to isolated nucleotide sequences being complementary to one or more mutations of the CFTR gene. According to a first aspect of the invention there is provided a method of identifying mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene, including the steps of providing one or more nucleic acid sequences, fully complementary to one or more segments of the CFTR gene, wherein the one or more nucleic acid sequences correspond to the mutation to be identified; providing a biological sample of an individual to be tested for CF; isolating nucleic acids from the biological sample; and testing the biological sample for the presence of one or more of the nucleic acid sequences using a suitable detection method.

Abstract: The present invention relates to methods of determining the presence or absence of certain cancers in a human individual, as well as to related methods to determine the response to therapy against certain cancers in a human individual, in particular ovarian cancer in a woman. Such methods are based on the detection-from (eg cell-free) DNA of said human individual—of one or more methylated (or un-methylated) CpGs being associated with differentially methylated regions (DMRs) of the present invention; such as methylation (or un-methylation) at one or more or all of certain CpGs being associated with such DMRs. Accordingly, such methods have diagnostic, prognostic and/or predictive utility for detecting or managing certain cancers in women or men, in particular ovarian cancer in women.

Abstract: A method comprising obtaining a substantially cell-free sample of blood plasma or blood serum from a subject with osteoarthritis; and detecting a presence of or measuring a level of novel_miRNA_1 (gucuggcucaggguuggg) (SEQ ID NO: 1), novel_miRNA_2 (ucccuguucgggcgccacu) (SEQ ID NO: 2), novel_miRNA_3 (uguuuagcauccuguagccugc) (SEQ ID NO: 3), and novel_miRNA_4 (uaguggguuaucagaacu) (SEQ ID NO: 4). Also provided are methods where additional miRNAs are detected including novel miRNA 5 (SEQ ID NO: 5), novel miRNA 6 (SEQ ID NO: 6), novel miRNA 7 (SEQ ID NO: 7), novel miRNA 8 (SEQ ID NO: 8), novel miRNA 9 (SEQ ID NO: 9), novel miRNA 10 (SEQ ID NO: 10), novel miRNA 11 (SEQ ID NO: 11), novel miRNA 12 (SEQ ID NO: 12), novel miRNA 13 (SEQ ID NO: 13), hsa-miR-335-3p, hsa-miR-199a-5p, hsa-miR-671-3p, hsa-miR-1260b, hsa-miR-191-3p, hsa-miR-335-5p and/or hsa-miR-543.

Abstract: The gene responsible for encoding SERT has a functional polymorphism at the 5?-regulatory promoter region, which results in two forms, long (L) and short (S). The LL-genotype is hypothesized to play a key role in the early onset of alcohol use. The present invention discloses the differences in treatment and diagnosis based on the L or short genotypes as well as on a single nucleotide polymorphism of the SERT gene, the 3? UTR SNP rs1042173. The present invention demonstrates the efficacy of using the drug ondansetron and similar drugs for treatment based on variations in the polymorphisms of the SERT gene as well as methods for diagnosing susceptibility to abuse of alcohol and other addiction-related diseases and disorders.

Abstract: The present invention includes methods for selecting a therapy for improved cognition as well as prevention of cognitive loss/dysfunction using one or more endophenotypes comprising: obtaining a sample from a subject; measuring biomarkers that differentiate between an inflammatory, a metabolic, a neurotrophic, and a depressive endophenotype; and selecting a course of treatment for the subject based on whether the subject is scored as having a high or a low endophenotype for one or more of the inflammatory, a metabolic, a neurotrophic, and a depressive endophenotypes.

Abstract: The present invention relates generally to a therapeutic protocol for treating a subject having cancer. Taught herein is a method of treating cancer or reducing the risk of recurrence of cancer in a subject following an anti-cancer therapy.

Abstract: The present disclosure provides a body fluid extract comprising micro RNA.

Abstract: The present invention relates to a method of determining the presence or absence of active tuberculosis in a sample, in particular, comprising determining the levels of one or more biomarkers selected from basic leucine zipper transcription factor ATF-like 2 (BATF2), cluster of differentiation 177 (CD177), haptoglobin (HP), immunoglobulin J chain (IGJ) and galectin 10 (CLC), in said sample. Uses of biomarkers of the invention and kits for performing the method of the invention are also described.

Abstract: The present technology relates to methods for excluding Lynch syndrome as a possible diagnosis in patients suffering from colorectal cancers or endometrial cancers. These methods are based on detecting the methylation status of the MLH1 promoter ‘C’ region in colorectal and endometrial cancer patients using an improved and highly sensitive methylation-specific multiplex ligation-dependent probe amplification (MS-MLPA) assay.

Abstract: Provided herein are methods of detecting target nucleic acids and uses of the same.

Abstract: The present application relates to the field of cancer, particular to hypoxic tumors. It was found that hypoxia is an important driver for hypermethylation of (promoters of) tumor suppressor genes. As this hypermethylation is a stable signature that is also present in circulating tumor DNA in peripheral blood, detecting this methylation pattern is a surrogate marker for tumor hypoxia. This can be used to adapt therapy as well.

Abstract: Provided is a group of peripheral blood gene markers for screening benign and malignant pulmonary micro-nodules, comprising: gene sequences characterized by micronodular lung carcinoma as shown in SEQ ID NOs. 1-6, wherein the gene sequences exhibit differential expression in the peripheral blood of micronodular lung carcinoma patients and non-micronodular lung carcinoma patients. In addition, also provided is the use of the above-mentioned gene markers in preparing a product for early screening micronodular lung carcinoma. The gene markers of the invention used for early screening micronodular lung carcinoma, have high sensitivity and strong specificity; besides, they take peripheral blood, which is the easiest to collect in clinic, as the test sample.

Abstract: The invention relates to method for identifying and selecting a subject with increased risk of developing a cardiometabolic disease and optionally, providing a personalized medicine method, which may involve sequencing at least part of a genome of one or more cells in a blood sample of the subject and identifying from the sequencing one or more mutations in one or more somatic mutations.

Abstract: The present disclosure belongs to the technical field of pathogen detection, in particular to loop-mediated isothermal amplification (LAMP) primer sets for detecting porcine susceptibility-related pathogenic bacteria, and a kit, a LAMP chip and use based on the same. The LAMP primer sets for detecting porcine susceptibility-related pathogenic bacteria include an Actinobacillus pleuropneumoniae primer set, a Haemophilus parasuis primer set, a Salmonella choleraesuis primer set, a Bordetella bronchiseptica primer set, a Pasteurella multocida primer set, a Streptococcus suis primer set, and an Erysipelothrix rhusiopathiae primer set.

Abstract: The present invention relates to a method of diagnosing and treating endometrial cavity-distorting leiomyoma using microRNA, and particularly, a composition and a kit for diagnosing uterine leiomyoma, the composition and the kit including an agent capable of detecting a microRNA expression level in a biological sample; a method of diagnosing uterine leiomyoma of a subject, the method including measuring a microRNA expression level in a biological sample from the subject, and diagnosing that the subject has uterine leiomyoma having endometrial cavity distortion or uterine leiomyoma having a likelihood of developing endometrial cavity distortion, when the microRNA expression level is downregulated; and a method of treating uterine leiomyoma, the method including measuring a microRNA expression level in a biological sample from a subject, and performing uterine leiomyoma treatment when the microRNA expression level is downregulated.

Abstract: Methods for detecting a chromosomal aneuploidy in a foetus carried by a pregnant female are provided. Such methods are based on one or more of particular configurations and/or detections and/or analyses of two or more regions of DNA, including those that show differential methylation between DNA that originates from cells of a foetus (and/or the placenta of a foetus) and DNA of maternal origin. Such methods utilise a sample taken from a pregnant female, which sample comprises DNA that originates from cells of a foetus and/or the placenta of a foetus in admixture with differently methylated DNA of maternal origin. Such methods have diagnostic, prognostic and/or predictive utility; in particular for the detection/diagnosis of chromosomal aneuploidy, such as a trisomy, in a foetus, and/or for detecting an increased risk of a pregnant female suffering from or developing a pregnancy-associated medical condition.

Abstract: The present invention relates to a method, in particular an in vitro method, for identifying basophil granulocytes, comprising analyzing a modification such as for example the methylation status of at least one CpG position in the mammalian gene region for the gene “mutated in colorectal cancer” (MCC), wherein a demethylation or lack of modification or methylation of said gene region is indicative for a basophil granulocyte, when compared to a non-basophil granulocyte, or any other cell type in the peripheral blood or in other tissues. The analyses according to the invention can identify basophil granulocytes on an epigenetic level and distinguish them from all other cells in complex samples, such as, for example, other blood or immune cells. The present invention furthermore provides an improved method for quantifying basophil granulocytes, in particular in complex samples.