Abstract: Selective AFLP primers which decrease the complexity of marker genotyping having a variable region of four or more selective nucleotides and a constant region of nucleotides which match base pairs of a restriction fragment of a selected frequent cutter enzyme are provided. AFLP primers and specific DNA markers for volume growth of loblolly pine are also provided. In addition, methods for identifying and selecting loblolly pine trees for greater volume growth are described.
Abstract: The invention relates to the use of primers or primer pairs for DNA fingerprint analysis, wherein with the primers or primer pairs fingerprints are obtainable from humans as well as from animals as well as from plants as well as from microorganisms. The invention further relates to primers or primer pairs for the above-mentioned use.
Type:
Grant
Filed:
November 2, 1998
Date of Patent:
September 25, 2001
Assignee:
Max-Planck-Gesellschaft zur Forderung der Wissenschaften
e.v.
Abstract: This invention relates to diagnostic tests that will specifically identify E. coli O157:H7. Tests are provided to detect E. coli O157:H7 by PCR and by Southern blotting. Methods and primer compositions are provided to identify two distinct and independent regions of the E. coli O157:H7 genome by polymerase chain reaction. Methods and probe compositions are also provided to detect E. coli O157:H7 by Southern blotting. Kits to identify E. coli O157:H7, comprising said primer and probe compositions and reagents to conduct the appropriate control tests, are also provided.
Abstract: Disclosed is a genetic testing method for diagnosing systemic lupus erythematosus (SLE) in a human subject. The method is related to amplifying nucleic acids from human tissue samples and analyzing for a variant allele of a gene encoding poly(ADP-ribosyl)transferase expression (PARP), which is diagnostic of SLE or indicates a genetic predisposition for developing SLE. Also disclosed are useful oligonucleotide primers, primer sets and genetic testing kits for detecting a genetic predisposition for developing SLE.
Type:
Grant
Filed:
March 29, 1999
Date of Patent:
August 28, 2001
Assignees:
Cedars-Sinai Medical Center, The Regents of the University of California
Inventors:
Betty P. Tsao, Rita M. Cantor, Jerome I. Rotter
Abstract: Methods for screening a patient for pancreatic disease are disclosed and are based upon detection of a mutation in the gene encoding insulin promoter factor-1 (IPF-1) which is linked to diabetes mellitus and pancreatic agenesis.
Abstract: The invention provides methods and reagents for detecting a chromosomal aberration in an animal chromosome or karyotype. One or more detectably-labeled chromosome-specific probes from a first animal species are hybridized to chromosomes of a second animal species. This results in a banding pattern that can be compared to the pattern found in a normal chromosome or karyotype.
Type:
Grant
Filed:
June 30, 1999
Date of Patent:
August 7, 2001
Assignee:
Applied Imaging Corporation
Inventors:
Malcolm A Ferguson-Smith, Johannes F Wienberg, Stefan Müller
Abstract: A method for detecting gene expression in cells by reverse transcribing mRNA molecules into cDNA, cutting the cDNA with at least one restriction endonuclease, adding adaptor sequences to the cDNA fragments and selectively amplifying a subset of the cDNA by a polymerase chain reaction (PCR) to present a two-dimensional display of the DNA fragments or for cloning the DNA fragments into a vector is disclosed. In one embodiment, cDNA corresponding to the 3′ end of the mRNA is amplified and displayed or cloned, whereas in another embodiment, cDNA corresponding to the entire mRNA molecule is amplified and displayed or cloned.
Type:
Grant
Filed:
August 7, 1998
Date of Patent:
August 7, 2001
Assignee:
The United States of America as represented by the Department
of Health and Human Services
Abstract: The present invention provides an isolated bacterial strain capable of oxidizing nitrite to nitrate and a method of use thereof for preventing or alleviating the accumulation of nitrite in an aqueous medium.
Abstract: The present invention provides an isolated bacterial strain capable of oxidizing nitrite to nitrate and a method of use thereof for preventing or alleviating the accumulation of nitrite in an aqueous medium.
Abstract: Methods for determining the susceptibility of intracellular pathogens, particularly Chlamydia, to single or combination of test agents are described. The methods can be used for in vitro or in vivo evaluation of agents that can be used as therapeutic agents in the treatment/eradication of pathogen infection in general or to target a specific infected organ. Assays which utilize nucleic amplification techniques (e.g., PCR) to determine effectiveness of the agent(s) evaluated are also described.
Type:
Grant
Filed:
February 18, 1998
Date of Patent:
July 10, 2001
Assignee:
Vanderbilt University
Inventors:
Charles W. Stratton, William M. Mitchell
Abstract: The invention provides methods and reagents for detecting a chromosomal aberration in an animal chromosome or karyotype. One or more detectably-labeled chromosome-specific probes from a first animal species are hybridized to chromosomes of a second animal species. This results in a banding pattern that can be compared to the pattern found in a normal chromosome or karyotype.
Type:
Grant
Filed:
February 27, 1998
Date of Patent:
July 3, 2001
Assignee:
Cambridge University Technical Services Ltd.
Inventors:
Malcolm A Ferguson-Smith, Johannes F Wienberg, Stefan Muller
Abstract: The invention provides a set of two PCR primers designed based on a DNA sequence of a gene encoding malic acid dehydrogenase and a specific DNA of Salmonella typhimurium. The invention provides also a DNA probe specific for the above-mentioned PCR primers. Finally, a PCR method using above-mentioned primers is provided for the rapid and specific detection of Salmonella typhimurium in food and clinical specimens such as human fecal specimens. Said PCR method comprises further a Southern hybridization assay for detecting PCR products. The whole process could be shortened from 5-7 days for BAM method to 1-2 days.
Type:
Grant
Filed:
December 9, 1999
Date of Patent:
June 26, 2001
Assignee:
National Science Council of Republic of China
Abstract: A nucleic acid molecule which codes for a tumor rejection antigen precursor which is in turn processed to antigens presented by an HLA molecule is described. The HLA molecule may be HLA-A2, HLA-A28, HLA-B13, HLA-B44, or HLA-Cw6. The antigens are also described. These materials are useful in diagnostic and therapeutic methodologies. The tumor rejection antigen precursor is not tyrosinase, which has previously been identified as a tumor rejection antigen precursor processed to an antigen presented by HLA-B44.
Abstract: The invention relates to the nitrification of wastewater and identification of microorganisms capable of participating in this process. Specifically, the invention provides a consortium of microorganisms capable of nitrite oxidation in wastewater, which consortium is enriched in members of the Nitrospira phylum. The invention also provides oligonucleotide primers and probes for the amplification or detection of Nitrospira DNA, kits comprising the primers and probes, and methods of detection and quantitating Nitrospira species in a sample.
Type:
Grant
Filed:
November 17, 1998
Date of Patent:
April 24, 2001
Assignee:
CRC for Waste Management and Pollution Control Limited
Inventors:
Paul Christopher Burrell, Linda Louise Blackall, Jurg Keller
Abstract: A new down-regulated gene called DRA, for down regulated in adenoma, maps to chromosome 7 and is believed to encode a tumor suppressor. The DRA gene encodes a highly hydrophobic protein with charged clusters located primarily in the carboxyl terminus. Additionally, the expression of the mRNA product appears to be strictly limited to the mucosa of normal colon and it is down-regulated early in colon tumorigenesis. Absence of the DRA polypeptide in tissue that usually expresses it can be used as an indicator of tissue abnormality. The DRA gene and cDNA may also have therapeutic capabilities as well.
Type:
Grant
Filed:
November 2, 1998
Date of Patent:
April 3, 2001
Assignee:
The United States of America as represented by the Department
of Health and Human Services
Inventors:
Clifford W. Schweinfest, Takis S. Papas
Abstract: The present invention provides an isolated bacterial strain capable of oxidizing nitrite to nitrate and a method of use thereof for preventing or alleviating the accumulation of nitrite in an aqueous medium.
Abstract: A novel, highly polymorphic DNA marker based on the pentanucleotide repeat (CCTTT/GGAAA)n has been identified in the human inducible nitric oxide synthase (iNOS) gene. Twelve different alleles, having between 7 and 18 repeats, have been identified. The repeat is highly polymorphic in the human population and so lends itself to use as a microsatellite marker with uses in, for example, forensic medicine, population studies, family linkage studies and disease diagnosis.
Abstract: A method for diagnosing or screening for bovine &agr;-mannosidosis comprises detecting in nucleic acid samples from cattle the presence or absence of &agr;-mannosidosis-causing mutations in the gene encoding bovine lysosomal &agr;-mannosidase (LAMAN). A method of detecting &agr;-mannosidosis-causing mutations in cattle comprises detecting the presence or absence of base transitions in the gene encoding bovine LAMAN which are associated with the disease.
Type:
Grant
Filed:
January 29, 1999
Date of Patent:
March 6, 2001
Inventors:
Thomas Berg, Ole Kristien Tollersrud, Oivind Nilssen
Abstract: The present invention concerns a method for evaluating the metastatic tendency of tumor cells by determining the level of expression (mRNA level) of the gene coding for the thrombin receptor (ThR) or by determining the level of the thrombin receptor present on the membranes or within the tumor cells. A high level of either of the above indicates a high metastatic tendency, a low level indicates a low metastatic tendency and an intermediate level indicates a moderate metastatic tendency. The present invention further concerns a kit for use in the above method.
Type:
Grant
Filed:
March 10, 1998
Date of Patent:
February 6, 2001
Assignee:
Hadasit Medical Research Services and Development Company
Ltd.
Abstract: An improved process for simultaneous preparation of sex specific and gender-neutral semisynthetic amplicons obtained by amplifying sequences of synthetic oligonucleotide primers identified as SEQ ID NOS:4 to 7 (5′GGATCCCTATlAGTG 3′; 5′GGATCCCITTTGCACTC 3′; 5CGAAATCGGTAGACGATACG3′ and 5′GGGGATAGAGGGACTTGAAC 3′) useful for sex determination, said process comprising isolating nucleic acids from any part of a papaya plant by conventional methods, amplifying the said nucleic acids in a conventional Random Amplification of polymorphic DNA Polymerase Chain Reaction (RAPD-PCR), resolving the amplified products by conventional electrophoresis method, eluting the sex specific, double stranded amplified product from the gel piece by known methods, cloning the said product in a known vector by conventional methods, sequencing the said cloned product by known methods, synthesizing the single stranded chains of synthetic oligonucleotides by known method based on the said sequence d
Type:
Grant
Filed:
February 26, 1999
Date of Patent:
January 30, 2001
Assignee:
Counsel of Scientific & Industrial Research
Inventors:
Prabhakar K. Ranjekar, Anjali S. Parasnis, Vidya S. Gupta