Abstract: The present invention discloses a marker and a diagnosis method for the noninvasive diagnosis of myocardial infarction. According to the method disclosed by the present invention, second-generation sequencing and QPCR methods are used to find that there are significant differences in the expression of ING1, RAE1, DOCK10, KDSR, IVD, and MAEA in the blood of patients with myocardial infarction and normal subjects, that is, the expression of ING1, RAE1, DOCK10, KDSR, IVD and MAEA can be detected to determine whether the subjects suffer from myocardial infarction. According to the correlation between the two, the present invention develops a kit for the diagnosis of the myocardial infarction, and the kit is used for the diagnosis of the myocardial infarction by detecting the expression of ING1, RAE1, DOCK10, KDSR, IVD and MAEA. The diagnostic kit can be used for the early diagnosis of diseases, and has wide application prospect clinically.

Abstract: The present invention is based on the discovery of genetic polymorphisms that are associated with cardiovascular disorders, particularly acute coronary events such as myocardial infarction and stroke, and genetic polymorphisms that are associated with responsiveness of an individual to treatment of cardiovascular disorders with statin. In particular, the present invention relates to nucleic acid molecules containing the polymorphisms, variant proteins encoded by such nucleic acid molecules, reagents for detecting the polymorphic nucleic acid molecules and proteins, and methods of using the nucleic acid and proteins as well as methods of using reagents for their detection.

Abstract: The present disclosure relates to methods of determining a treatment course of action. In particular, the present disclosure relates to mutations in the gene encoding estrogen receptor and their association with responsiveness to estrogen therapies for cancer.

Abstract: A method of providing information for predicting a risk of a recurrence after treatment of a patient with paroxysmal atrial fibrillation (AF) is provided. The method includes measuring a concentration of tissue inhibitor of metalloproteinase (TIMP)-1 from a sample isolated from a patient, and detecting a presence of a genetic variant at rs10033464 GG on chromosome 4q25 from nucleic acid separated from the sample.

Abstract: A method for identifying a renal allograft recipient at risk for chronic allograft damage or interstitial fibrosis and tubular atrophy (IF/TA) by comparing the transcription level of a preselected gene signature set with the transcription level of a comparison standard, and diagnosing the recipient as being at risk for chronic allograft damage if the transcription level of the preselected gene signature set is significantly higher than the transcription level of the comparison standard.

Abstract: A method to predict an increased risk of a greater susceptibility to a metal implant sensitivity in a test person. The method includes providing an isolated sample with a genetic material of the test person, and examining a single nucleotide polymorphism rs1143627 SEQ?ID?NO:?1 AGCCTCCTACTTCTGCTTTTGAAAGC[C/T]ATAAAA ACAGCGAGGGAGAACTGG,? in a gene coding for interleukin 1 beta and ascertaining whether a C is present at a position of the single nucleotide polymorphism, and/or examining a VNTR polymorphism rs2234663 with the repeat SEQ?ID?NO:?2 ATCCTGGGGAAAGTGAGGGAAATATGGACATCACATGGAACAACAT CCAGGAGACTCAGGCCTCTAGGAGTAACTGGGTAGTGTGC, in a gene coding for a IL1 receptor antagonist, IL1-RN and ascertaining whether the repeat is present five times.

Abstract: Provided herein are novel organoid culture media, organoid culture systems, and methods of culturing tumor organoids using the subject organoid culture media. Also provided herein are tumor organoids developed using such organoid culture systems, methods for assessing the clonal diversity of the tumor organoids, and methods for using such tumor organoids, for example, for tumor modelling and drug development applications. In particular embodiments, the tumor organoid culture media provided herein is substantially free of R-spondins (e.g., R-spondin1).

Abstract: This document provides methods and materials related to genetic variations of developmental disorders. For example, this document provides methods for using such genetic variations to assess susceptibility of developing Autism Spectrum Disorder.

Abstract: The present disclosure provides methods, systems, compositions, and kits for the high-throughput detection of multi-molecule biomarkers in a biological sample. The disclosed methods, systems, compositions, and kits utilize antibody-oligonucleotide tags to detect two or more molecules that are in close proximity.

Abstract: The invention provides a gene signature for use in determining a likelihood of a latent tuberculosis (TB) infection in a subject transitioning to active TB disease. The gene signature comprises at least SEPT4 and BLK, and optionally also GAS6 and/or CD1C. Expression levels of these genes are detected in a sample from the subject, and the ratios of expression of at least two of the above genes are calculated (e.g. SEPT4:BLK, SEPT4:CD1C, GAS6:BLK and/or GAS6:CD1C). A score is assigned to each ratio, the score being indicative of the likelihood of the latent TB infection transitioning into active TB disease, based on the ratio for the respective gene pair. The subject can be identified as having a latent TB infection that is likely to transition into active TB disease or that is not likely to transition into active TB disease based on the score or on the average of the scores.

Abstract: Compositions and methods for the detection and treatment of ADHD are provided.

Abstract: Methods for predicting the development of sepsis in a subject at risk for developing sepsis are provided. In one method, features in a biomarker profile of the subject are evaluated. The subject is likely to develop sepsis if these features satisfy a particular value set. Methods for predicting the development of a stage of sepsis in a subject at risk for developing a stage of sepsis are provided. In one method, a plurality of features in a biomarker profile of the subject is evaluated. The subject is likely to have the stage of sepsis if these feature values satisfy a particular value set. Methods of diagnosing sepsis in a subject are provided. In one such method, a plurality of features in a biomarker profile of the subject is evaluated. The subject is likely to develop sepsis when the plurality of features satisfies a particular value set.

Abstract: It is intended to provide a kit or a device for the detection of esophageal cancer and a method for detecting esophageal cancer. The present invention provides a kit or a device for the detection of esophageal cancer, comprising nucleic acid(s) capable of specifically binding to miRNA(s) in a sample f a subject, and a method for detecting esophageal cancer, comprising measuring the miRNA in vitro.

Abstract: The present invention is directed to methods and kits for determining the presence of a mutated SLC30A2 polynucleotide. The invention is further directed to methods of determining a subject's genetic-susceptibility to zinc deficiency and evaluating zinc levels in a composition comprising breast milk.

Abstract: It is intended to provide a kit or a device for the detection of lung cancer and a method for detecting lung cancer. The present invention provides a kit or a device for the detection of lung cancer, comprising a nucleic acid capable of specifically binding to a miRNA in a sample from a subject, and a method for detecting lung cancer, comprising measuring the miRNA in vitro.

Abstract: An object of the present invention is to provide a kit or a device for the detection of prostate cancer and a method for detecting prostate cancer. The present invention provides a kit or a device for the detection of prostate cancer, comprising a nucleic acid capable of specifically binding to a miRNA in a sample of a subject, and a method for detecting prostate cancer, comprising measuring the miRNA in vitro.

Abstract: It is intended to provide a kit or device for the detection of liver cancer and a method for detecting liver cancer. The present invention relates to a kit or device for the detection of liver cancer, comprising a nucleic acid capable of specifically binding to miRNA in a sample of a subject, and a method for detecting liver cancer, comprising measuring the miRNA in vitro.

Abstract: The present invention provides a kit or device for the detection of biliary tract cancer, and a method for detecting biliary tract cancer. The present invention relates to a kit or device for the detection of biliary tract cancer, comprising a nucleic acid capable of specifically binding to miRNA in a sample of a subject, and a method for detecting biliary tract cancer, comprising measuring the miRNA in vitro.

Abstract: This invention relates to a kit or a device for the detection of stomach cancer and a method for detecting stomach cancer, and provides a kit or a device for the detection of stomach cancer, comprising a nucleic acid(s) capable of specifically binding to a miRNA(s) in a sample from a subject, and a method for detecting stomach cancer, comprising measuring the miRNA(s) in vitro.

Abstract: Disclosed herein is a combination of genomic sequences whose methylation patterns have utility for the improved detection and differentiation between colorectal neoplasms. Further disclosed herein are methods, nucleic acids and kits for detecting or differentiating between colorectal neoplasms.