Abstract: A method for detecting a genetic mutation is provided. The method comprising: carrying out PCR using a template DNA, a forward primer, a reverse primer and a wild-type oligonucleotide; and detecting an amplified DNA. In the method, the wild-type oligonucleotide comprises LNA or BNA, and on a DNA strand of the template, with which the wild-type oligonucleotide is hybridized, a region with which the wild-type oligonucleotide is a hybridized and a region with which the forward primer or the reverse primer is hybridized partially overlap each other, or the regions are separated from each other by 1 to 18 bases.

Abstract: The present invention relates to a method of distinguishing genotypes using PCR-PHFA including: a nucleic acid amplification step in which a mutation site-including region of a gene is amplified by a nucleic acid amplification reaction, thereby obtaining an amplification reaction solution; and a distinction step in which the amplification reaction solution obtained from the nucleic acid amplification step is mixed with a reference double-stranded nucleic acid having a specific genotype on the mutation site as well as being labeled with a labeling substance, and the mixture is subjected to a competitive strand displacement reaction, and the level of the occurrence of strand displacement is assessed so as to distinguish the identity; and the competitive strand displacement reaction is performed under a condition to suppress a polymerase extension reaction, and a genotype distinguishing kit for use in the distinct of genotypes by this method.

Abstract: The method of the present invention is a method for determining an HLA-A*24 group, which includes determining the HLA-A*24 group on the basis of the results of the typing of (a) a 211st base and (b) a 395th base, in which A (adenine) in the initiation codon for an HLA gene is defined as the 1st base in the genomic DNA of a test subject.

Abstract: A method for identifying a base sequence accompanying competitive hybridization that includes a thermal denaturation subjecting a sample double-stranded nucleic acid and a reference double-stranded nucleic acid containing the same base sequence as a target base sequence to thermal denaturation treatment in a single reaction solution, a temperature lowering carrying out competitive hybridization between the sample double-stranded nucleic acid and the reference double-stranded nucleic acid by lowering the temperature of the reaction solution after the thermal denaturation, a measurement measuring a double-stranded nucleic acid formed by a nucleic acid strand that composed the reference double-stranded nucleic acid and a nucleic acid strand that composed the sample double-stranded nucleic acid, and an identification identifying identity between the reference double-stranded nucleic acid and the sample double-stranded nucleic acid based on measurement results obtained from the measurement, the temperature lowerin

Abstract: Disclosed is a method of detecting a target base sequence having a polymorphic base, the method including: (a) a step of adding to a nucleic acid sample having a target nucleic acid that includes a base sequence including the target base sequence: at least one type of detection primer, at least one type of competitive primer, and at least one type of common primer; (b) a step of annealing the detection primer and the competitive primer to the target nucleic acid in a competitive manner, thereby synthesizing an extension product A; (c) a step of annealing the common primer to the extension product A obtained in the step (b) or in the following step (d), thereby synthesizing an extension product B; (d) a step of annealing the detection primer or the competitive primer to the extension product B obtained in the previous step (c), thereby synthesizing the extension product A; and (e) a step of detecting the extension product A or the extension product B.

Abstract: The present invention relates to a method of distinguishing genotypes using PCR-PHFA including: a nucleic acid amplification step in which a mutation site-including region of a gene is amplified by a nucleic acid amplification reaction, thereby obtaining an amplification reaction solution; and a distinction step in which the amplification reaction solution obtained from the nucleic acid amplification step is mixed with a reference double-stranded nucleic acid having a specific genotype on the mutation site as well as being labeled with a labeling substance, and the mixture is subjected to a competitive strand displacement reaction, and the level of the occurrence of strand displacement is assessed so as to distinguish the identity; and the competitive strand displacement reaction is performed under a condition to suppress a polymerase extension reaction, and a genotype distinguishing kit for use in the distinct of genotypes by this method.

Abstract: An empty bag supply method and apparatus first lifting up with a first suction member an empty bag of which bag bottom being in contact with and positioned by a first positioning stopper. The lifted bag is then held by chucks and transported upwards so that the empty bag is vertical with the bag bottom facing upward, and then a second suction member suctions the empty bag near the bag mouth and transports it onto a conveyor with the bag mouth facing forward, so that the bag mouth of the bag is stopped and positioned by a second positioning stopper. The empty bag is then lifted up by a third suction member, held by a chuck and transported upward so that the attitude of the bag is changed to vertical with the bag mouth facing upward, and then the bag is transferred to a gripper of a packaging apparatus.

Abstract: The present invention relates to a process for synthesizing or amplifying efficiently a nucleic acid comprising a target nucleic acid sequence. In the process according to the present invention, a primer comprising in its 3?-end portion a sequence (Ac?) which hybridizes a sequence (A) in the 3?-end portion of the target nucleic acid sequence, and in the 5?-side of said sequence (Ac?) a sequence (B?) which hybridizes the complementary sequence (Bc) of a sequence (B) positioned in the 5?-side of said sequence (A) on the target nucleic acid sequence, wherein {X?(Y?Y?)}/X is in the range of ?1.00 to 1.00, in which X denotes the number of bases in said sequence (Ac?), Y denotes the number of bases in the region flanked by said sequences (A) and (B) in the target nucleic acid sequence, and Y? denotes the number of bases in an intervening sequence between said sequences (Ac?) and (B?) (Y? may be zero).

Abstract: To provide a photocrosslinkable compound and a photocrosslinking agent which are capable of ligation of nucleic acids within a short period of time compared to the conventional cases, and to which modifications depending on the intended use can easily be made, and a method of producing the photocrosslinking agent. Nucleic acids including a group represented by the formulae I, III, IV, or V as a nucleobase; a photocrosslinking agent including the nucleic acids, a method of producing nucleic acids by reacting nucleic acids including a group represented by the formulae VI, VII, VIII, or IX as a nucleobase with an aromatic azidated product represented by the formula X.

Abstract: The present invention relates to a process for synthesizing or amplifying efficiently a nucleic acid comprising a target nucleic acid sequence. The process involves providing a primer comprising in its 3?-end portion a sequence (Ac?) which hybridizes a sequence (A) in the 3?-end portion of the target nucleic acid sequence, and in the 5?-side of the sequence (Ac?) a sequence (B?) which hybridizes the complementary sequence (Bc) of a sequence (B) positioned in the 5?-side of the sequence (A) on the target nucleic acid sequence, wherein {X?(Y?Y?)}/X is in the range of ?1.00 to 1.00, in which X denotes the number of bases in the sequence (Ac?), Y denotes the number of bases in the region flanked by the sequences (A) and (B) in the target nucleic acid sequence, and Y? denotes the number of bases in an intervening sequence between the sequences (Ac?) and (B?) (Y? may be zero).

Abstract: An empty bag supply method and apparatus first lifting up with a first suction member an empty bag of which bag bottom being in contact with and positioned by a first positioning stopper. The lifted bag is then held by chucks and transported upwards so that the empty bag is vertical with the bag bottom facing upward, and then a second suction member suctions the empty bag near the bag mouth and transports it onto a conveyor with the bag mouth facing forward, so that the bag mouth of the bag is stopped and positioned by a second positioning stopper. The empty bag is then lifted up by a third suction member, held by a chuck and transported upward so that the attitude of the bag is changed to vertical with the bag mouth facing upward, and then the bag is transferred to a gripper of a packaging apparatus.

Abstract: Active carboxylic acid ester groups are coupled on the surfaces of microspheres so as to reduce protocols for microsphere processing, control side reactions, and stably preserve beads containing active carboxylic acid ester groups. Further, microspheres labeled with at least one fluorescent dye cage in the microspheres, and the microspheres are preserved in lower alcohol.

Abstract: In accordance with the present invention, active carboxylic acid ester groups are coupled on the surfaces of microspheres so as to reduce protocols for microsphere processing, control side reactions, and stably preserve beads containing active carboxylic acid ester groups. Further, microspheres labeled with at least one fluorescent dye cage in the microspheres, and the microspheres are preserved in lower alcohol.

Abstract: In accordance with the present invention, active carboxylic acid ester groups are coupled on the surfaces of microspheres so as to reduce protocols for microsphere processing, control side reactions, and stably preserve beads containing active carboxylic acid ester groups. Further, microspheres labeled with at least one fluorescent dye cage in the microspheres, and the microspheres are preserved in lower alcohol.

Abstract: The present invention relates to a process for synthesizing or amplifying efficiently a nucleic acid comprising a target nucleic acid sequence. In the process according to the present invention, a primer comprising in its 3?-end portion a sequence (Ac?) which hybridizes a sequence (A) in the 3?-end portion of the target nucleic acid sequence, and in the 5?-side of said sequence (Ac?) a sequence (B?) which hybridizes the complementary sequence (Bc) of a sequence (B) positioned in the 5?-side of said sequence (A) on the target nucleic acid sequence, wherein {X?(Y?Y?)}/X is in the range of ?1.00 to 1.00, in which X denotes the number of bases in said sequence (Ac?), Y denotes the number of bases in the region flanked by said sequences (A) and (B) in the target nucleic acid sequence, and Y? denotes the number of bases in an intervening sequence between said sequences (Ac?) and (B?) (Y? may be zero).

Abstract: The present invention provides CD36 mutant gene and methods and kits for diagnosing diseases caused by a lipid metabolism abnormality.

Abstract: An object of the present invention is to suppress nonspecific extension reaction of the primer in the primer extension method.The primer extension reaction to form a nucleic acid strand complementary to a nucleic acid template strand with the use of a primer according to the present invention is characterized in that the reaction between the primer and the template strand is carried out in the presence of a nucleic acid or a derivative thereof which is complementary to said primer and has an affinity for said primer is equivalent to or less than that of said primer for the nucleic acid template strand.

Abstract: A nucleic acid differentiation method utilizing complementary strand-exchange reaction in competitive hybridization can clearly differentiate a site of gene mutation or a difference between genes in a target nucleic acid even when the gene mutation or difference is located near the primer binding site of the target nucleic acid.

Abstract: A method of detecting falciparum, tertian, quartan and ovale malaria parasites by using primers represented by the sequences (SEQ ID NO:1), (SEQ ID NO:3) to (SEQ ID NO:10):5'AAGTCATCTTTCGAGGTGAC3' (SEQ ID NO:4)5'GAATTTTCTCTTCGGAGTTTA3' (SEQ ID NO:5)5'GAGACATTCTTATATATG3' (SEQ ID NO:3)5'GAAAATTCCTTTCGGGGA3' (SEQ ID NO:1)5'CGACTAGGTGTTGGATGA3' (SEQ ID NO:6)5'GAACGAAAGTTAAGGGAGT3' (SEQ ID NO:7)5'ACTGAAGGAAGCAATCTAA3' (SEQ ID NO:8)5'TCAGATACCGTCGTAATCTT3' (SEQ ID NO:9)5'CCAAAGACTTTGATTTCTCAT3' (SEQ ID NO:10)This invention allows all of the plasmodia, which infect the human, to be detected easily, rapidly and with a high sensitivity or distinguished accurately from one another, thus permitting treatment for malaria and large-scale mass examination in the area where malaria is prevalent.

Abstract: A microtiter well in which a single stranded nucleic acid including a plurality of sequences specifically hybridizalbe with a target nucleic acid is immobilized is disclosed. The single stranded nucleic acid is derived from a phage or a phage-plasmid. The microtiter well enables a target nucleic acid to be specifically detected with a high sensitivity and high efficiency and further enables the detection procedure to be automated.