Patents by Inventor Albert A. Rodriguez
Albert A. Rodriguez has filed for patents to protect the following inventions. This listing includes patent applications that are pending as well as patents that have already been granted by the United States Patent and Trademark Office (USPTO).
-
Publication number: 20240167019Abstract: This disclosure relates generally to nucleic acid aptamers especially useful for cell transduction, as well as to containers (such as bags) having surfaces comprising one or such aptamers, and to transductions methods using such aptamers and containers. One embodiment of the disclosure provides A DNA aptamer comprising a plurality of nucleotides, the DNA aptamer having at least 80% sequence identity with the sequence of SEQ ID NO: 1 (AAACTGCAGCGATTCATTAGTACGGCCTTT).Type: ApplicationFiled: November 20, 2023Publication date: May 23, 2024Inventors: Katie Campbell, Natalie Fekete, Jonathon Wheatley, Jessica Rodriguez, Maranda Gibb, Albert M. Liao, Thomas Caltagirone
-
Patent number: 11981080Abstract: According to one example there is provided a build material supply unit for additive manufacturing systems. The build material supply unit may comprise a sloping support surface for the build material, which has no hard edges, a mesh above the sloping support surface, and a vibrator to vibrate the mesh and cause the descent of build material.Type: GrantFiled: April 23, 2019Date of Patent: May 14, 2024Assignee: HEWLETT-PACKARD DEVELOPMENT COMPANY, L.P.Inventors: Gerard Mosquera Donate, Lluis Pare Barniol, Albert Rodriguez Fernandez
-
Publication number: 20240109128Abstract: According to an example, a device comprises a sidewall and a base movable relative to the sidewall. The sidewall and base define an internal volume for receipt of build material in an additive manufacturing process. The example device further comprises a membrane. A first end of the membrane is attached to the base such that the membrane is movable with the base. The membrane at least partially extends along the sidewall to form a flexible barrier between the internal volume and the sidewall.Type: ApplicationFiled: February 24, 2020Publication date: April 4, 2024Applicant: HEWLETT-PACKARD DEVELOPMENT COMPANY, L.P.Inventors: Alejandro Rodriguez Romero, Gabriel De La Cal Mendoza, Albert Rodriguez Fernandez, Francesc Melia Sune
-
Publication number: 20240028901Abstract: According to one embodiment, a learning apparatus includes a processor. The processor performs, on a neural network model, an adaptation processing that includes at least either insertion of an activation function, or correction of the activation function. The processor generates a trained model by training the neural network model on which the adaptation processing has been performed. The processor performs pruning on the trained model to generate a reconstructed model from which a parameter has been reduced.Type: ApplicationFiled: February 22, 2023Publication date: January 25, 2024Applicant: KABUSHIKI KAISHA TOSHIBAInventors: Albert RODRIGUEZ MULET, Shuhei NITTA, Yoshiyuki KOKOJIMA, Ryusuke HIRAI, Yasutaka FURUSHO, Manabu NISHIYAMA, Yusuke NATSUI
-
Publication number: 20240028902Abstract: According to one embodiment, a learning apparatus includes a processor. The processor trains a neural network model having a plurality of pathways and generate a trained model. The processor performs pruning on the trained model and calculate a number of remaining parameters of each of the pathways. The processor generates a candidate model for reconstruction, the candidate model for reconstruction being generated by deleting a pathway in which the number of parameters is equal to or less than a threshold. The processor determines whether or not deletion of a further pathway included in the candidate model for reconstruction is possible. If it is determined that deletion of the further pathway is possible, the candidate model for reconstruction is subjected to each of the training, the pruning, and the generating.Type: ApplicationFiled: February 24, 2023Publication date: January 25, 2024Applicant: KABUSHIKI KAISHA TOSHIBAInventors: Albert RODRIGUEZ MULET, Shuhei NITTA, Ryusuke HIRAI
-
Publication number: 20230056947Abstract: According to one embodiment, a learning apparatus includes a processing circuit. The processing circuit acquires a first training condition and a first model trained in accordance with the first training condition, sets a second training condition used to reduce a model size of the first model, different from the first training condition, in accordance with the second training condition and based on the first model, trains a second model whose model size is smaller than that of the first model, and in accordance with a third training condition that is not the same as the second training condition and complies with the first training condition, trains a third model based on the second model.Type: ApplicationFiled: February 28, 2022Publication date: February 23, 2023Applicant: KABUSHIKI KAISHA TOSHIBAInventors: Shuhei NITTA, Yasutaka Furusho, Albert Rodriguez Mulet, Atsushi Yaguchi, Akiyuki TANIZAWA
-
Publication number: 20220402206Abstract: A 3D printing apparatus is disclosed herein. The 3D printing apparatus comprises a non-powered compartment defining a chamber to contain build material, and a passive latching element connected to a lateral wall of the compartment to be engaged with a complementary latching element of a platform. A drive mechanism of a 3D printing device is engageable with the platform to apply an upward vertical force to the platform to move the platform upwardly. The complementary latching elements are to: passively latch the platform and the compartment together at a latched position such that upward movement of the platform causes upward movement of the compartment until the compartment is restrained at a sealing position; and to passively unlatch the platform from the compartment, upon further upward movement of the platform.Type: ApplicationFiled: March 24, 2020Publication date: December 22, 2022Inventors: Albert RODRIGUEZ FERNANDEZ, Marius VALLES GONZALEZ, Gabriel DE LA CAL MENDOZA, Joaquim BRUGUE GARVI, Francesc MELIA SUNE
-
Publication number: 20220371278Abstract: A 3D printing apparatus is disclosed herein. The 3D printing apparatus comprises a build compartment defining a build chamber within which a 3D object is to be generated; and a non-powered platform, moveable within the build chamber, comprising a platform drive interface to engage with an external drive mechanism to cause the platform to move. The 3D printing apparatus further comprises a powder compartment located laterally adjacent to the build compartment, within which build material is to be stored for use in the generation of the 3D object. The 3D printing apparatus also comprises a locking interface to couple the 3D printing apparatus with an external hosting device.Type: ApplicationFiled: January 30, 2020Publication date: November 24, 2022Applicant: Hewlett-Packard Development Company, L.P.Inventors: Pau MARTIN VIDAL, Marius VALLES GONZALEZ, Gerard MOSQUERA DONATE, Albert RODRIGUEZ FERNANDEZ, Gabriel DE LA CAL MENDOZA, Francesc MELIA SUNE
-
Publication number: 20220072790Abstract: According to one example there is provided a build material supply unit for additive manufacturing systems. The build material supply unit may comprise a sloping support surface for the build material, which has no hard edges, a mesh above the sloping support surface, and a vibrator to vibrate the mesh and cause the descent of build material.Type: ApplicationFiled: April 23, 2019Publication date: March 10, 2022Inventors: Gerard Mosquera Donate, Lluis PARE BARNIOL, Albert Rodriguez Fernandez
-
Patent number: 11096509Abstract: A dual-chambered beverage container assembly for separating two beverages includes a shell that defines an interior space. The shell has a top that is open. A wall is coupled to an inner surface of the shell and bisects the interior space from the top to a bottom of the shell to define a first and second chambers. A first beverage that is positioned in the first chamber is separated by the wall from a second beverage that is positioned in the second chamber. Each of a pair of tubes is coupled to a respective opposing side of the wall. A lower end of the tube is positioned proximate to a bottom of the shell and an upper end extends from the top of the shell. The tubes are configured to permit a user to simultaneously draw the first beverage and the second beverage into a mouth of the user.Type: GrantFiled: May 9, 2018Date of Patent: August 24, 2021Inventor: Albert Rodriguez
-
Publication number: 20190343310Abstract: A dual-chambered beverage container assembly for separating two beverages includes a shell that defines an interior space. The shell has a top that is open. A wall is coupled to an inner surface of the shell and bisects the interior space from the top to a bottom of the shell to define a first and second chambers. A first beverage that is positioned in the first chamber is separated by the wall from a second beverage that is positioned in the second chamber. Each of a pair of tubes is coupled to a respective opposing side of the wall. A lower end of the tube is positioned proximate to a bottom of the shell and an upper end extends from the top of the shell. The tubes are configured to permit a user to simultaneously draw the first beverage and the second beverage into a mouth of the user.Type: ApplicationFiled: May 9, 2018Publication date: November 14, 2019Inventor: Albert Rodriguez
-
Patent number: 9431149Abstract: A device in connection with the corona effect, which is applicable in particular to connection nodes between conductor tubes of a power substation, and which includes an electrically conductive primary filamentous element wound onto itself forming an enveloping figure.Type: GrantFiled: June 21, 2012Date of Patent: August 30, 2016Assignee: SBI CONNECTORS ESPANA, S.A.Inventors: Albert Rodriguez Lopez, Josep Sanllehi Muñoz, Said Lalaouna, Joan Hernandez Guiteras, Jordi Roger Riba Ruiz
-
Patent number: 8942798Abstract: A method, apparatus, and system for determining an adverse operational condition associated with a lead assembly in an implantable medical device used for providing a therapeutic electrical signal to a cranial nerve. A first impedance associated with the lead assembly configured to provide the therapeutic electrical signal to a cranial nerve is detected. A determination is made as to whether the first impedance is outside a first predetermined range. A second impedance is detected. The detection of the second impedance is performed within a predetermined period of time from the time of the detection of the first impedance. A determination is made as to whether the second impedance is outside a second predetermined range. If the first impedance is outside the first range and the second impedance is outside the second range, the implantable medical device is prevented from providing the therapeutic electrical signal.Type: GrantFiled: October 26, 2007Date of Patent: January 27, 2015Assignee: Cyberonics, Inc.Inventors: Randolph K. Armstrong, Albert A. Rodriguez, Steven E. Maschino
-
Publication number: 20140345908Abstract: The invention relates to a device for reducing the corona effect, which is applicable in particular to connection nodes between conductor tubes of a power substation, which includes an electrically conductive primary filamentous element wound onto itself forming an enveloping figure.Type: ApplicationFiled: June 21, 2012Publication date: November 27, 2014Applicant: SBI CONNECTORS ESPANA, S.A.Inventors: Albert Rodriguez Lopez, Josep Sanllehi Muñoz, Said Lalaouna, Joan Hernandez Guiteras, Jordi Roger Riba Ruiz
-
Patent number: 8682445Abstract: A method, system, graphical user interface, and apparatus are provided for performing a patient management function for treating depression using an implantable medical device. At least one patient parameter relating to an electrical signal provided by the implantable medical device for treating depression is acquired. At least one therapy parameter defining the electrical signal is correlated with at least one patient parameter. An indication relating to the correlation of the therapy parameter and the patient parameter is provided.Type: GrantFiled: July 28, 2006Date of Patent: March 25, 2014Assignee: Cyberonics, Inc.Inventors: Sejal B. Patel, Jason D. Begnaud, Chris G. DuPont, Albert A. Rodriguez
-
Patent number: 7729760Abstract: A method, system, graphical user interface, and apparatus are provided for performing a patient management function providing parameter data for delivering a therapeutic signal. A first electrical signal comprising a first therapy parameter is applied to a portion of a patient's body for providing a therapy. At least one patient parameter relating to an effect of applying the first electrical signal is acquired. A second therapy parameter for defining a second electrical signal to provide a therapy is determined in response to the patient parameter. The second therapy parameter is displayed on an external device. An input signal for defining the second electrical signal is received. The input signal includes a signal indicative of the whether the second therapy parameter was accepted or not.Type: GrantFiled: October 27, 2006Date of Patent: June 1, 2010Assignee: Cyberonics, Inc.Inventors: Sejal B. Patel, Jason D. Begnaud, Chris G. DuPont, Albert A. Rodriguez
-
Publication number: 20090125079Abstract: The present invention provides for a method, apparatus, and system for determining an adverse operational condition associated with a lead assembly in an implantable medical device used for providing a therapeutic electrical signal to a cranial nerve. A first impedance associated with the lead assembly configured to provide the therapeutic electrical signal to a cranial nerve is detected. A determination is made as to whether the first impedance is outside a first predetermined range of values. A second impedance is detected. The detection of the second impedance is performed within a predetermined period of time from the time of the detection of the first impedance. A determination is made as to whether the second impedance is outside a second predetermined range of values. A determination that a lead condition problem exists is made in response to a determination that the first is outside the first predetermined range of values and second impedance is outside the second predetermined range of values.Type: ApplicationFiled: October 26, 2007Publication date: May 14, 2009Inventors: Randolph K. Armstrong, Albert A. Rodriguez, Steven E. Maschino
-
Publication number: 20080183246Abstract: A method, apparatus, and system, are provided for guiding a medical procedure relating to an implantable medical device operatively coupled to a cranial nerve. Communications between the implantable medical device and an external device are established. An implant procedure is performed for implanting the implantable medical device. A first diagnostic process of the implantable medical device is performed. Using the external device a first signal is received from the implantable medical device based on the first diagnostic process. A first instruction is displayed using the external device based upon the first signal received by the external device. The first instruction includes information relating to guiding the implant procedure.Type: ApplicationFiled: January 26, 2007Publication date: July 31, 2008Inventors: Sejal B. Patel, Jason D. Begnaud, Chris G. DuPont, Albert A. Rodriguez
-
Publication number: 20080103546Abstract: A method, system, graphical user interface, and apparatus are provided for performing a patient management function for treating epilepsy using an implantable medical device. At least one patient parameter relating to an electrical signal provided by the implantable medical device for treating epilepsy is acquired. At least one therapy parameter defining the electrical signal is correlated with the at least one patient parameter. An indication relating to the correlation of the therapy parameter and the patient parameter is provided using an external computing device.Type: ApplicationFiled: October 27, 2006Publication date: May 1, 2008Inventors: Sejal B. Patel, Jason D. Begnaud, Chris G. DuPont, Albert A. Rodriguez
-
Publication number: 20080103533Abstract: A method, system, graphical user interface, and apparatus are provided for performing a patient management function providing parameter data for delivering a therapeutic signal. A first electrical signal comprising a first therapy parameter is applied to a portion of a patient's body for providing a therapy. At least one patient parameter relating to an effect of applying the first electrical signal is acquired. A second therapy parameter for defining a second electrical signal to provide a therapy is determined in response to the patient parameter. The second therapy parameter is displayed on an external device. An input signal for defining the second electrical signal is received. The input signal includes a signal indicative of the whether the second therapy parameter was accepted or not.Type: ApplicationFiled: October 27, 2006Publication date: May 1, 2008Inventors: Sejal B. Patel, Jason D. Begnaud, Chris G. DuPont, Albert A. Rodriguez