Patents by Inventor Albert A. Rodriguez

Albert A. Rodriguez has filed for patents to protect the following inventions. This listing includes patent applications that are pending as well as patents that have already been granted by the United States Patent and Trademark Office (USPTO).

  • Publication number: 20240167019
    Abstract: This disclosure relates generally to nucleic acid aptamers especially useful for cell transduction, as well as to containers (such as bags) having surfaces comprising one or such aptamers, and to transductions methods using such aptamers and containers. One embodiment of the disclosure provides A DNA aptamer comprising a plurality of nucleotides, the DNA aptamer having at least 80% sequence identity with the sequence of SEQ ID NO: 1 (AAACTGCAGCGATTCATTAGTACGGCCTTT).
    Type: Application
    Filed: November 20, 2023
    Publication date: May 23, 2024
    Inventors: Katie Campbell, Natalie Fekete, Jonathon Wheatley, Jessica Rodriguez, Maranda Gibb, Albert M. Liao, Thomas Caltagirone
  • Patent number: 11981080
    Abstract: According to one example there is provided a build material supply unit for additive manufacturing systems. The build material supply unit may comprise a sloping support surface for the build material, which has no hard edges, a mesh above the sloping support surface, and a vibrator to vibrate the mesh and cause the descent of build material.
    Type: Grant
    Filed: April 23, 2019
    Date of Patent: May 14, 2024
    Assignee: HEWLETT-PACKARD DEVELOPMENT COMPANY, L.P.
    Inventors: Gerard Mosquera Donate, Lluis Pare Barniol, Albert Rodriguez Fernandez
  • Publication number: 20240109128
    Abstract: According to an example, a device comprises a sidewall and a base movable relative to the sidewall. The sidewall and base define an internal volume for receipt of build material in an additive manufacturing process. The example device further comprises a membrane. A first end of the membrane is attached to the base such that the membrane is movable with the base. The membrane at least partially extends along the sidewall to form a flexible barrier between the internal volume and the sidewall.
    Type: Application
    Filed: February 24, 2020
    Publication date: April 4, 2024
    Applicant: HEWLETT-PACKARD DEVELOPMENT COMPANY, L.P.
    Inventors: Alejandro Rodriguez Romero, Gabriel De La Cal Mendoza, Albert Rodriguez Fernandez, Francesc Melia Sune
  • Publication number: 20240028901
    Abstract: According to one embodiment, a learning apparatus includes a processor. The processor performs, on a neural network model, an adaptation processing that includes at least either insertion of an activation function, or correction of the activation function. The processor generates a trained model by training the neural network model on which the adaptation processing has been performed. The processor performs pruning on the trained model to generate a reconstructed model from which a parameter has been reduced.
    Type: Application
    Filed: February 22, 2023
    Publication date: January 25, 2024
    Applicant: KABUSHIKI KAISHA TOSHIBA
    Inventors: Albert RODRIGUEZ MULET, Shuhei NITTA, Yoshiyuki KOKOJIMA, Ryusuke HIRAI, Yasutaka FURUSHO, Manabu NISHIYAMA, Yusuke NATSUI
  • Publication number: 20240028902
    Abstract: According to one embodiment, a learning apparatus includes a processor. The processor trains a neural network model having a plurality of pathways and generate a trained model. The processor performs pruning on the trained model and calculate a number of remaining parameters of each of the pathways. The processor generates a candidate model for reconstruction, the candidate model for reconstruction being generated by deleting a pathway in which the number of parameters is equal to or less than a threshold. The processor determines whether or not deletion of a further pathway included in the candidate model for reconstruction is possible. If it is determined that deletion of the further pathway is possible, the candidate model for reconstruction is subjected to each of the training, the pruning, and the generating.
    Type: Application
    Filed: February 24, 2023
    Publication date: January 25, 2024
    Applicant: KABUSHIKI KAISHA TOSHIBA
    Inventors: Albert RODRIGUEZ MULET, Shuhei NITTA, Ryusuke HIRAI
  • Publication number: 20230056947
    Abstract: According to one embodiment, a learning apparatus includes a processing circuit. The processing circuit acquires a first training condition and a first model trained in accordance with the first training condition, sets a second training condition used to reduce a model size of the first model, different from the first training condition, in accordance with the second training condition and based on the first model, trains a second model whose model size is smaller than that of the first model, and in accordance with a third training condition that is not the same as the second training condition and complies with the first training condition, trains a third model based on the second model.
    Type: Application
    Filed: February 28, 2022
    Publication date: February 23, 2023
    Applicant: KABUSHIKI KAISHA TOSHIBA
    Inventors: Shuhei NITTA, Yasutaka Furusho, Albert Rodriguez Mulet, Atsushi Yaguchi, Akiyuki TANIZAWA
  • Publication number: 20220402206
    Abstract: A 3D printing apparatus is disclosed herein. The 3D printing apparatus comprises a non-powered compartment defining a chamber to contain build material, and a passive latching element connected to a lateral wall of the compartment to be engaged with a complementary latching element of a platform. A drive mechanism of a 3D printing device is engageable with the platform to apply an upward vertical force to the platform to move the platform upwardly. The complementary latching elements are to: passively latch the platform and the compartment together at a latched position such that upward movement of the platform causes upward movement of the compartment until the compartment is restrained at a sealing position; and to passively unlatch the platform from the compartment, upon further upward movement of the platform.
    Type: Application
    Filed: March 24, 2020
    Publication date: December 22, 2022
    Inventors: Albert RODRIGUEZ FERNANDEZ, Marius VALLES GONZALEZ, Gabriel DE LA CAL MENDOZA, Joaquim BRUGUE GARVI, Francesc MELIA SUNE
  • Publication number: 20220371278
    Abstract: A 3D printing apparatus is disclosed herein. The 3D printing apparatus comprises a build compartment defining a build chamber within which a 3D object is to be generated; and a non-powered platform, moveable within the build chamber, comprising a platform drive interface to engage with an external drive mechanism to cause the platform to move. The 3D printing apparatus further comprises a powder compartment located laterally adjacent to the build compartment, within which build material is to be stored for use in the generation of the 3D object. The 3D printing apparatus also comprises a locking interface to couple the 3D printing apparatus with an external hosting device.
    Type: Application
    Filed: January 30, 2020
    Publication date: November 24, 2022
    Applicant: Hewlett-Packard Development Company, L.P.
    Inventors: Pau MARTIN VIDAL, Marius VALLES GONZALEZ, Gerard MOSQUERA DONATE, Albert RODRIGUEZ FERNANDEZ, Gabriel DE LA CAL MENDOZA, Francesc MELIA SUNE
  • Publication number: 20220072790
    Abstract: According to one example there is provided a build material supply unit for additive manufacturing systems. The build material supply unit may comprise a sloping support surface for the build material, which has no hard edges, a mesh above the sloping support surface, and a vibrator to vibrate the mesh and cause the descent of build material.
    Type: Application
    Filed: April 23, 2019
    Publication date: March 10, 2022
    Inventors: Gerard Mosquera Donate, Lluis PARE BARNIOL, Albert Rodriguez Fernandez
  • Patent number: 11096509
    Abstract: A dual-chambered beverage container assembly for separating two beverages includes a shell that defines an interior space. The shell has a top that is open. A wall is coupled to an inner surface of the shell and bisects the interior space from the top to a bottom of the shell to define a first and second chambers. A first beverage that is positioned in the first chamber is separated by the wall from a second beverage that is positioned in the second chamber. Each of a pair of tubes is coupled to a respective opposing side of the wall. A lower end of the tube is positioned proximate to a bottom of the shell and an upper end extends from the top of the shell. The tubes are configured to permit a user to simultaneously draw the first beverage and the second beverage into a mouth of the user.
    Type: Grant
    Filed: May 9, 2018
    Date of Patent: August 24, 2021
    Inventor: Albert Rodriguez
  • Publication number: 20190343310
    Abstract: A dual-chambered beverage container assembly for separating two beverages includes a shell that defines an interior space. The shell has a top that is open. A wall is coupled to an inner surface of the shell and bisects the interior space from the top to a bottom of the shell to define a first and second chambers. A first beverage that is positioned in the first chamber is separated by the wall from a second beverage that is positioned in the second chamber. Each of a pair of tubes is coupled to a respective opposing side of the wall. A lower end of the tube is positioned proximate to a bottom of the shell and an upper end extends from the top of the shell. The tubes are configured to permit a user to simultaneously draw the first beverage and the second beverage into a mouth of the user.
    Type: Application
    Filed: May 9, 2018
    Publication date: November 14, 2019
    Inventor: Albert Rodriguez
  • Patent number: 9431149
    Abstract: A device in connection with the corona effect, which is applicable in particular to connection nodes between conductor tubes of a power substation, and which includes an electrically conductive primary filamentous element wound onto itself forming an enveloping figure.
    Type: Grant
    Filed: June 21, 2012
    Date of Patent: August 30, 2016
    Assignee: SBI CONNECTORS ESPANA, S.A.
    Inventors: Albert Rodriguez Lopez, Josep Sanllehi Muñoz, Said Lalaouna, Joan Hernandez Guiteras, Jordi Roger Riba Ruiz
  • Patent number: 8942798
    Abstract: A method, apparatus, and system for determining an adverse operational condition associated with a lead assembly in an implantable medical device used for providing a therapeutic electrical signal to a cranial nerve. A first impedance associated with the lead assembly configured to provide the therapeutic electrical signal to a cranial nerve is detected. A determination is made as to whether the first impedance is outside a first predetermined range. A second impedance is detected. The detection of the second impedance is performed within a predetermined period of time from the time of the detection of the first impedance. A determination is made as to whether the second impedance is outside a second predetermined range. If the first impedance is outside the first range and the second impedance is outside the second range, the implantable medical device is prevented from providing the therapeutic electrical signal.
    Type: Grant
    Filed: October 26, 2007
    Date of Patent: January 27, 2015
    Assignee: Cyberonics, Inc.
    Inventors: Randolph K. Armstrong, Albert A. Rodriguez, Steven E. Maschino
  • Publication number: 20140345908
    Abstract: The invention relates to a device for reducing the corona effect, which is applicable in particular to connection nodes between conductor tubes of a power substation, which includes an electrically conductive primary filamentous element wound onto itself forming an enveloping figure.
    Type: Application
    Filed: June 21, 2012
    Publication date: November 27, 2014
    Applicant: SBI CONNECTORS ESPANA, S.A.
    Inventors: Albert Rodriguez Lopez, Josep Sanllehi Muñoz, Said Lalaouna, Joan Hernandez Guiteras, Jordi Roger Riba Ruiz
  • Patent number: 8682445
    Abstract: A method, system, graphical user interface, and apparatus are provided for performing a patient management function for treating depression using an implantable medical device. At least one patient parameter relating to an electrical signal provided by the implantable medical device for treating depression is acquired. At least one therapy parameter defining the electrical signal is correlated with at least one patient parameter. An indication relating to the correlation of the therapy parameter and the patient parameter is provided.
    Type: Grant
    Filed: July 28, 2006
    Date of Patent: March 25, 2014
    Assignee: Cyberonics, Inc.
    Inventors: Sejal B. Patel, Jason D. Begnaud, Chris G. DuPont, Albert A. Rodriguez
  • Patent number: 7729760
    Abstract: A method, system, graphical user interface, and apparatus are provided for performing a patient management function providing parameter data for delivering a therapeutic signal. A first electrical signal comprising a first therapy parameter is applied to a portion of a patient's body for providing a therapy. At least one patient parameter relating to an effect of applying the first electrical signal is acquired. A second therapy parameter for defining a second electrical signal to provide a therapy is determined in response to the patient parameter. The second therapy parameter is displayed on an external device. An input signal for defining the second electrical signal is received. The input signal includes a signal indicative of the whether the second therapy parameter was accepted or not.
    Type: Grant
    Filed: October 27, 2006
    Date of Patent: June 1, 2010
    Assignee: Cyberonics, Inc.
    Inventors: Sejal B. Patel, Jason D. Begnaud, Chris G. DuPont, Albert A. Rodriguez
  • Publication number: 20090125079
    Abstract: The present invention provides for a method, apparatus, and system for determining an adverse operational condition associated with a lead assembly in an implantable medical device used for providing a therapeutic electrical signal to a cranial nerve. A first impedance associated with the lead assembly configured to provide the therapeutic electrical signal to a cranial nerve is detected. A determination is made as to whether the first impedance is outside a first predetermined range of values. A second impedance is detected. The detection of the second impedance is performed within a predetermined period of time from the time of the detection of the first impedance. A determination is made as to whether the second impedance is outside a second predetermined range of values. A determination that a lead condition problem exists is made in response to a determination that the first is outside the first predetermined range of values and second impedance is outside the second predetermined range of values.
    Type: Application
    Filed: October 26, 2007
    Publication date: May 14, 2009
    Inventors: Randolph K. Armstrong, Albert A. Rodriguez, Steven E. Maschino
  • Publication number: 20080183246
    Abstract: A method, apparatus, and system, are provided for guiding a medical procedure relating to an implantable medical device operatively coupled to a cranial nerve. Communications between the implantable medical device and an external device are established. An implant procedure is performed for implanting the implantable medical device. A first diagnostic process of the implantable medical device is performed. Using the external device a first signal is received from the implantable medical device based on the first diagnostic process. A first instruction is displayed using the external device based upon the first signal received by the external device. The first instruction includes information relating to guiding the implant procedure.
    Type: Application
    Filed: January 26, 2007
    Publication date: July 31, 2008
    Inventors: Sejal B. Patel, Jason D. Begnaud, Chris G. DuPont, Albert A. Rodriguez
  • Publication number: 20080103546
    Abstract: A method, system, graphical user interface, and apparatus are provided for performing a patient management function for treating epilepsy using an implantable medical device. At least one patient parameter relating to an electrical signal provided by the implantable medical device for treating epilepsy is acquired. At least one therapy parameter defining the electrical signal is correlated with the at least one patient parameter. An indication relating to the correlation of the therapy parameter and the patient parameter is provided using an external computing device.
    Type: Application
    Filed: October 27, 2006
    Publication date: May 1, 2008
    Inventors: Sejal B. Patel, Jason D. Begnaud, Chris G. DuPont, Albert A. Rodriguez
  • Publication number: 20080103533
    Abstract: A method, system, graphical user interface, and apparatus are provided for performing a patient management function providing parameter data for delivering a therapeutic signal. A first electrical signal comprising a first therapy parameter is applied to a portion of a patient's body for providing a therapy. At least one patient parameter relating to an effect of applying the first electrical signal is acquired. A second therapy parameter for defining a second electrical signal to provide a therapy is determined in response to the patient parameter. The second therapy parameter is displayed on an external device. An input signal for defining the second electrical signal is received. The input signal includes a signal indicative of the whether the second therapy parameter was accepted or not.
    Type: Application
    Filed: October 27, 2006
    Publication date: May 1, 2008
    Inventors: Sejal B. Patel, Jason D. Begnaud, Chris G. DuPont, Albert A. Rodriguez