Abstract: A server is configured to determine translations of queries from a first language into a second language, associated with a first specialized search engine, to obtain translated queries. The server is also configured to use a first model, associated with the first specialized search engine, to determine values for the translated queries. A value of the values, corresponding to a translated query of the translated queries, reflects a probability that the translated query is a type of query for which first specialized search results are responsive. The server is configured to create training data based on the queries and the values, and to create a second model based on the training data. The second model may be used to predict whether a particular query, received by the web search engine, is the type of query for which second specialized search results, from a second specialized search engine, are responsive.

Abstract: Slide switch assemblies with structural enhancements are provided for use in electronic devices. Slide switch assemblies in accordance with embodiments the invention can include a button, an engagement member, and switch box. The engagement member couples the button to the switch box and translates any movement of the button to the switch box. The switch box is mounted offset with respect to the button because another component such as, for example, a display screen occupies the space that would have been a better mounting position for the switch box. To compensate for the offset, and the added torsion that is applied to the engagement member during button movement events, the engagement member is structurally enhanced.

Abstract: Slide switch assemblies with structural enhancements are provided for use in electronic devices. Slide switch assemblies in accordance with embodiments the invention can include a button, an engagement member, and switch box. The engagement member couples the button to the switch box and translates any movement of the button to the switch box. The switch box is mounted offset with respect to the button because another component such as, for example, a display screen occupies the space that would have been a better mounting position for the switch box. To compensate for the offset, and the added torsion that is applied to the engagement member during button movement events, the engagement member is structurally enhanced.

Abstract: An electronic device may be provided with an ejectable component assembly having a connector that can receive and retain a removable module within a housing of the electronic device. The ejectable component assembly may also be provided with an ejector mechanism for at least partially ejecting the removable module from the connector. The ejector mechanism may receive a user input force at an ejector user interface, translate that user input force into an ejection force, and apply that ejection force onto the removable module for ejecting the module. The ejector user interface may be provided at any suitable position of the housing that may not interfere with other functions of the device. The path along which the ejector mechanism translates the user input force into the ejection force between the ejector user interface and the removable module may be provided in any suitable way throughout the device.

Abstract: Slide switch assemblies with structural enhancements are provided for use in electronic devices. Slide switch assemblies in accordance with embodiments the invention can include a button, an engagement member, and switch box. The engagement member couples the button to the switch box and translates any movement of the button to the switch box. The switch box is mounted offset with respect to the button because another component such as, for example, a display screen occupies the space that would have been a better mounting position for the switch box. To compensate for the offset, and the added torsion that is applied to the engagement member during button movement events, the engagement member is structurally enhanced.

Abstract: The present invention relates to the selection and development of superior strain of Bacillus spp for improving plant growth and health by inhibiting pathogenic fungi

Abstract: The present invention relates to a pair of primers with forward primer of SEQ ID NO. 1 having sequence of CCAAGCTTGCTGAACGCATCGG, and reverse primer of SEQ ID No. 2 having sequence of CCAAGCTTGCCACGCAGGATTATC, and a screening method for early identification of plants Artemisia annua having high content of artemisinin and thereby helping generation of plant population with further high content of artemisinin.