Abstract: A lightweight and extensible information model for machine-to-machine systems is disclosed. A service layer information management architecture uses three categories of atomic objects, subjects, actions, and descriptions. Information for use within the model is built using the atomic information objects. Application programming interfaces are used to perform operations and information processing by different nodes. Common service functions are used in the model as instances of a generic common service information model.

Abstract: A cover for an underground enclosure may include an upper surface comprising a pattern of bosses, a first slot and a second slot disposed on the upper surface, a lower surface opposite the upper surface. A first reinforcement member may be coupled to the lower surface. The first slot may extend into the first reinforcement member, and a second reinforcement member may be coupled to the lower surface and aligned with the first reinforcement member. The second slot may extend into the second reinforcement member. The cover may be configured to be lifted by the first slot and the second slot.

Abstract: A low-pressure sand-casting system includes a sand-casting mold receiving a molten casting material to cast an automobile vehicle cylinder head. A port is created in the automobile vehicle cylinder head. A manifold port metal core assembly includes a metal core. A compressible material coating is applied on the manifold port core metal core.

Abstract: A composition for the treatment of bladder fibrosis in a patient in need that includes a miR-29 mimic is disclosed. The miR-29 mimic may include a working RNA strand with the nucleotide sequence UAGCACCAUCUGAAAUCGGUUUU (SEQ ID NO 4) and a passenger RNA strand comprising the nucleotide sequence: AACCGAUUUCuuuUGGUGCUAUU (SEQ ID NO 5). The passenger RNA strand includes a 2?-O-methylation modification to increase stability. Cholesterol is conjugated to the 3?-end of the passenger RNA strand to enhance cellular uptake. The composition may further include a carrier molecule including, but not limited to, branched polyethylenimine at an N/P ratio of 0.8, where N denotes the nitrogens of the polyethylenimine and P denotes the phosphate groups of the working and passenger RNA strands. In some aspects, the composition may be an injectable composition that includes a polyplex dissolved in a 0.5% glucose solution, where the polyplex is formed from the working and passenger RNA strands and the carrier molecule.

Abstract: An interworking service entity receives server registration requests including indications of service layer protocols used by each server, maintains a repository of server information, and uses the repository for interworking requests of devices to servers of different protocols based on a server type provided in discovery requests. Other matching information may include, for example, server security protocol, supported services, service territory, availability, capacity, or loading, as device information or preferences, such a supported service, supported interface type, or a supported device type.

Abstract: A component for a vehicle interior may comprise a light guide to allow light transmission from a light source, and a cover to cover the light guide. The light guide may comprise an icon or indicator and the cover may comprise a depression or indentation in an inner surface of the cover. The icon/indicator of the light guide may comprise a light-transmissive resin material configured to fit within the depression/indentation in the cover. The icon/indicator may be presented when illuminated and hidden by the cover when not illuminated. The cover may comprise a polymer material coupled to the light guide. The cover may present a user interface. A surface of the cover may comprise an information region and/or a decorative region. The component may comprise a steering wheel, console, floor console, center console, instrument panel, door panel, dashboard, display, armrest, or cockpit.

Abstract: A high pressure die casting (HPDC) system for casting ultra-large single-piece castings for vehicles. The HPDC system includes a clear feeding path from at least one ingate to a predetermined thicker section of a mold cavity, a last to solidify ingate having an equivalent or larger feeding modulus than the highest feeding modulus of the other ingates, and thermal management elements. The clear feeding path, last to solidify ingate, and thermal management elements ensure sufficient supplemental molten metal flow to the thicker portion of the mold cavity to accommodate for shrinkage of the thicker portion of an ultra large casting during the casting and solidification process.

Abstract: System and methods that improve the use of network functions on edge data networks are disclosed. A mechanism that supports edge-assisted UE context and trigger collection is described herein, where a UE can actively send its context information and/or any trigger (e.g. a request for a network function/service to be deployed in edge data networks, etc.) to an edge enabler server, which processes the received context and triggers from its UEs. The edge enabler server may also forward UE context and triggers to 5G core network (5GC) upon receiving a solicitation request from the 5GC, or if the 5GC has already made a subscription for getting notification on UE context and triggers. A network repository function is provided as a new network function collect, store, and manage edge data network information.

Abstract: Lightweight, dynamic mechanisms are provided to support service layer interworking and resource extensibility. For example, one mechanism disclosed herein comprises defining a new service layer (SL) resource definition registration procedure that allows for specifying custom attributes of service layer resources to represent third party technology resources. A second mechanism disclosed herein comprises defining a new SL data model mapping registration procedure to map service layer resources to third party data models and to provide a new interworked retargeting indicator to the service layer. Further, a third mechanism disclosed herein comprises defining a SL generic interworking procedure to intelligently retarget requests toward interworked resources based on the interworked retargeting indicator provided by the data model mapping.

Abstract: An electronic device may be provided with peripheral conductive housing structures, a first antenna, and a second antenna. A gap may divide the housing structures into a first segment forming an arm of the first antenna and a second segment forming an arm of the second antenna. A first feed terminal may be coupled to the first segment and a second feed terminal may be coupled to the second segment. Switchable components may be coupled in parallel between the first and second feed terminals across the gap. The switchable components may be adjusted to tune the frequency response of the first and/or second antenna. The switchable components may have a first state in which only the first feed terminal feeds the first antenna and may have a second state in which both the first and second feed terminals feed the first antenna.

Abstract: A component for a vehicle interior may comprise a light guide to allow light transmission from a light source for a user interface, and a cover to cover the light guide. The user interface may be presented at the cover. The cover may comprise a depression in an inner surface of the cover and the light guide may comprise a projection comprising a light-transmissive resin fit within the depression. The projection may comprise an icon to be presented at the user interface when illuminated, and to be hidden by the cover when not illuminated. The user interface may comprise a light display and an input device connected to a sensor. The icon may comprise an image. The cover thickness may be greater than the projection height. The component may comprise a steering wheel, console, floor console, center console, instrument panel, door panel, dashboard, display, armrest, or cockpit.

Abstract: Methods and systems for managing data processing systems are disclosed. A data processing system may include hardware and/or software components. The operation of the data processing system may depend on the operation of these components. To manage the operation of the data processing system, a system may include a data processing system manager. The data processing system manager may obtain logs for components of the data processing system reflecting the historical operation of these components and use the log to predict the future operation of the data processing system, identify similar operation of other data processing systems, and/or for other purposes. Based on the predictions, the data processing system manager may take action to reduce the likelihood of the data processing system becoming impaired.

Abstract: Methods and systems for managing data processing systems based on indications of anomalous behaviors in logs are disclosed. A data processing system may include and depend on the operation of hardware and/or software components. To manage the operation of the data processing system, a data processing system manager may obtain logs for components of the data processing system that reflect the historical and/or current operation of these components. The logs may be used to identify the operational state of the data processing system, improving the context of the log information. Based on the identified state, inference models may be implemented to predict future infrastructure issues by detecting anomalous behaviors of the data processing system (e.g., behaviors that are unusual for the given state) recorded in the logs. Based on the predictions, the data processing system manager may take action to reduce the likelihood of the data processing system becoming impaired.

Abstract: Methods and systems for managing data processing systems are disclosed. A data processing system may include hardware and/or software components. The operation of the data processing system may depend on the operation of these components. To manage the operation of the data processing system, a system may include a data processing system manager. The data processing system manager may obtain logs for components of the data processing system reflecting the historical operation of these components and use the log to predict the future operation of the data processing system, identify similar operation of other data processing systems, and/or for other purposes. Based on the predictions, the data processing system manager may take action to reduce the likelihood of the data processing system becoming impaired.

Abstract: Methods and systems for managing deployments are disclosed. A deployment may include one or more devices. The devices may include hardware and/or software components. The operation of the deployment may depend on the operation of these devices and components. To manage the operation of the deployment, a system may include a deployment manager. The deployment manager may obtain logs for components of the deployment reflecting the historical operation of these components and use the log to predict the future operation of the deployment. Based on the predictions, the deployment manager may take proactive action to reduce the likelihood of the deployment becoming impaired.

Abstract: Methods and systems for managing data processing systems are disclosed. A data processing system may include hardware and/or software components. The operation of the data processing system may depend on the operation of these components. To manage the operation of the data processing system, a system may include a data processing system manager. The data processing system manager may obtain logs for components of the data processing system reflecting the historical operation of these components and use the log to predict the future operation of the data processing system, actions that may be performed to address predicted undesirable operation of the data processing system, and/or for other purposes. Based on the predictions, the data processing system manager may take action to reduce the likelihood of the data processing system operating in an undesirable manner.

Abstract: A method, system and/or computer usable program product for automatically providing an issue prediction to an IT (information technology) issue including receiving a trouble ticket regarding the IT issue, the trouble ticket including information identifying a categorized set of symptoms of the IT issue and identifying a set of IT assets impacted by the symptoms; utilizing the categorized set of symptoms and identified set of IT assets to query a trouble ticket system model for an automated issue prediction, the issue prediction including a predicted case classification based on case classifications of prior resolved trouble tickets with associated symptoms and IT assets corresponding to the trouble ticket symptoms and IT assets; and utilizing the predicted case classification to resolve the trouble ticket.

Abstract: Methods and systems for managing deployments are disclosed. A deployment may include one or more devices. The devices may include hardware and/or software components. The operation of the deployment may depend on the operation of these devices and components. To manage the operation of the deployment, a system may include a deployment manager. The deployment manager may obtain logs for components of the deployment reflecting the historical operation of these components and use the log to predict the future operation of the deployment. Based on the predictions, the deployment manager may take proactive action to reduce the likelihood of the deployment becoming impaired.