Patents by Inventor Hideaki Miyake

Hideaki Miyake has filed for patents to protect the following inventions. This listing includes patent applications that are pending as well as patents that have already been granted by the United States Patent and Trademark Office (USPTO).

  • Patent number: 6900187
    Abstract: A compound consisting of an oligonucleotide of sequence CAGCAGCAGAGTCTTCATCAT, where the oligonucleotide has a phosphorothioate backbone throughout, the sugar moieties of nucleotides 1-4 and 18-21 bear 2?-O-methoxyethyl modifications, and the remaining nucleotides (nucleotides 5-17) are 2?-deoxynucleotides, and where the cytosines of nucleotides 1, 4 and 19 are 5-methylcytosines. The compound has increased stability in vivo and improved in vitro and in vivo antitumor activity.
    Type: Grant
    Filed: February 22, 2002
    Date of Patent: May 31, 2005
    Assignee: The University of British Columbia
    Inventors: Martin Gleave, Paul S. Rennie, Hideaki Miyake, Colleen Nelson, Brett P. Monia
  • Publication number: 20030166591
    Abstract: A compound consisting of an oligonucleotide of sequence CAGCAGCAGAGTCTTCATCAT, where the oligonucleotide has a phosphorothioate backbone throughout, the sugar moieties of nucleotides 1-4 and 18-21 bear 2′-O-methoxyethyl modifications, and the remaining nucleotides (nucleotides 5-17) are 2′-deoxynucleotides, and where the cytosines of nucleotides 1, 4 and 19 are 5-methylcytosines. The compound has increased stability in vivo and improved in vitro and in vivo antitumor activity.
    Type: Application
    Filed: February 22, 2002
    Publication date: September 4, 2003
    Inventors: Martin Gleave, Paul S. Rennie, Hideaki Miyake, Colleen Nelson, Brett P. Monia
  • Publication number: 20010028550
    Abstract: A fan box has a principal inlet side and a principal outlet side disposed opposite to each other, in which sides a plurality of inlets and a plurality of outlets are formed respectively. In the fan box, a plurality of fan units, each of which holds a multiblade fan, are arranged side by side with the axial directions of the multiblade fans oriented in the same direction. Each fan unit has the construction in which a fan inlet is in communication with the inlets through a suction duct and a fan outlet is in communication with the outlets. Check valves are provided on the respective outlets, and when the multiblade fan of a specific fan unit stops operating, the check valve of the outlet corresponding to that multiblade fan is autonomously closed to prevent a reduction in the cooling capacity due to the air flowing back and circulating within the multiblade fan to continue the operation.
    Type: Application
    Filed: February 26, 2001
    Publication date: October 11, 2001
    Inventors: Hideaki Miyake, Yuichi Fukuda, Takashi Moriyama, Shigemi Ota
  • Publication number: 20010027387
    Abstract: Disclosed are a debugging supporting apparatus, a debugging supporting method and its recording medium so constituted that even if an application developed in a simulation environment by OS simulator stops, OS control information can be referred to at that moment.
    Type: Application
    Filed: March 21, 2001
    Publication date: October 4, 2001
    Inventors: Hideaki Miyake, Masayoshi Kareki, Katsumi Tsurumoto
  • Patent number: 5617788
    Abstract: A continuously operative printing machine and a method of operating the same are disclosed. The printing machine has a plurality of switchable printing units to be used selectively by switching. For continuous printing the printing units are switched alternately by coupling and decoupling first coupling/decoupling means while a continuous printing web is held running. Plate change of stationary printing units is done with independent drive means to be ready for the next printing. Then the stationary printing units are restored to the printing state through synchronous control by rotational control means. Thus plate change printing or the like can be carried out continuously without stopping the printing machine. In addition, high quality printing can be obtained efficiently. Further, it is possible to obtain double side printing.
    Type: Grant
    Filed: April 19, 1996
    Date of Patent: April 8, 1997
    Assignee: Toshiba Kikai Kabushiki Kaisha
    Inventors: Takeshi Horiguchi, Satoru Sasaki, Hideaki Miyake
  • Patent number: 4596315
    Abstract: A disc brake device including a piston, an automatic adjuster and a sleeve piston within the cylinder of a caliper body, wherein braking and automatic braking-gap adjustment are achieved by a hydraulic input, and said piston is pushed by a mechanical input through said sleeve piston and said automatic adjuster for braking.
    Type: Grant
    Filed: August 27, 1984
    Date of Patent: June 24, 1986
    Assignees: Nissin Kogyo Kabushiki Kaisha, Honda Giken Kogyo Kabushiki Kaisha
    Inventors: Hiroo Takeuchi, Hideaki Miyake, Yoshito Hanazato, Kimio Koyano