Patents by Inventor In Chan Kim
In Chan Kim has filed for patents to protect the following inventions. This listing includes patent applications that are pending as well as patents that have already been granted by the United States Patent and Trademark Office (USPTO).
-
Publication number: 20240196664Abstract: A light emitting display device includes a first display area, and a second display area disposed outside of the first display area. The second display area includes a pixel driver, a main light-emitting device electrically connected to the pixel driver, and an additional light-emitting device electrically connected to the main light-emitting device. The additional light-emitting device overlaps a peripheral driver that generates signals that are provided to the pixel driver. The main light-emitting device and the additional light-emitting device include a first electrode, an emission layer, and a second electrode. The pixel driver is electrically connected to the second electrode of the main light-emitting device and the second electrode of the additional light-emitting device. The second electrode of the additional light-emitting device and the second electrode of the main light-emitting device are surrounded by a separator in a plan view.Type: ApplicationFiled: November 30, 2023Publication date: June 13, 2024Applicant: Samsung Display Co., LTD.Inventors: Hye Won KIM, Chung Sock CHOI, Yoo Min KO, Sun Ho KIM, Ju Chan PARK, Pil Suk LEE, Sung Jin HONG
-
Publication number: 20240194146Abstract: A scan signal driver includes: stages to sequentially output scan signals in an active period, and to selectively output sensing signals in a vertical blank period. At least one of the stages includes: a sensing control circuit to supply a gate-on voltage to a sensing control node in response to a holding control signal during the active period, and to output the gate-on voltage of the sensing control node in response to a selectively input line select signal during the vertical blank period; an output node control circuit to supply the gate-on voltage to a pull-up node when the gate-on voltage of the sensing control node is output during the vertical blank period; and an output circuit to output a scan clock signal as a sensing signal to one of scan signal lines when the gate-on voltage is supplied to the pull-up node during the vertical blank period.Type: ApplicationFiled: July 5, 2023Publication date: June 13, 2024Inventors: Dong Woo KIM, Kee Chan PARK, Yi Kyoung YOU, Chong Chul CHAI, Kyung Ho KIM, Joon Ho LEE
-
Publication number: 20240190509Abstract: An embodiment rear structure of a vehicle body includes a rear quarter roof side member defining part of an upper closed structure above the vehicle body, defining part of a rear closed structure behind the vehicle body, and including a side connection portion and a rear pillar upper reinforcement defining part of the rear closed structure, connected with a rear part of the rear quarter roof side member and a part of an upper part of the rear quarter roof side member, and including an upper pillar connection portion provided thereon, wherein the upper pillar connection portion is connected to the side connection portion by a fastener.Type: ApplicationFiled: September 1, 2023Publication date: June 13, 2024Inventors: HaeHoon Lee, Jungho Lee, ChangHak Kang, Chan Woong Jeon, Sang Kyoung Han, Youngrock Kim
-
Publication number: 20240191237Abstract: Therapeutic compounds for red blood cell-mediated delivery of an active pharmaceutical ingredient to a target cell are described. The therapeutic compounds are configured to bind CD47 on the surface of a red blood cell and to be subsequently transferred to CD47 on the surface of the target cell, the therapeutic compound ultimately being internalized by the target cell via endocytosis. The target cell may be a cancer cell.Type: ApplicationFiled: January 9, 2024Publication date: June 13, 2024Inventors: HoWon J. Kim, In-San Kim, Jay S. Kim, Sun Hwa Kim, Ick Chan Kwon, Jong Won Lee, Yoo Soo Yang, Hong Yeol Yoon
-
Publication number: 20240189435Abstract: Disclosed is an agent capable of inhibiting the activity or enhancing expression of various cancer-related RNAs in TAMS and cancer cells. Disclosed is also a dual-targeted drug delivery system capable of binding to both tumor cells and macrophages in which the PD-L1 receptor is overexpressed.Type: ApplicationFiled: December 13, 2022Publication date: June 13, 2024Applicant: KOREA INSTITUTE OF SCIENCE AND TECHNOLOGYInventors: Yoo Soo YANG, Sun Hwa KIM, Ick Chan KWON, Eun Hye KIM
-
Patent number: 12006502Abstract: Therapeutic compounds for red blood cell-mediated delivery of an active pharmaceutical ingredient to a target cell are described. The therapeutic compounds are configured to bind CD47 on the surface of a red blood cell and to be subsequently transferred to CD47 on the surface of the target cell, the therapeutic compound ultimately being internalized by the target cell via endocytosis. The target cell may be a fibrotic cell.Type: GrantFiled: January 9, 2024Date of Patent: June 11, 2024Assignees: K2B Therapeutics, Inc., KIST (Korea Institute of Science and Technology)Inventors: HoWon J. Kim, In-San Kim, Jay S. Kim, Sun Hwa Kim, Ick Chan Kwon, Jong Won Lee, Yoo Soo Yang, Hong Yeol Yoon
-
Patent number: 12009151Abstract: A capacitor component includes a body including a dielectric layer and an internal electrode layer, and an external electrode disposed on the body and connected to the internal electrode layer. The dielectric layer includes dielectric grains, at least a portion of the dielectric grains has a core-shell structure, and a shell of the core-shell structure contains a rare earth element having an average concentration of more than 0.5 at %.Type: GrantFiled: March 4, 2022Date of Patent: June 11, 2024Assignee: SAMSUNG ELECTRO-MECHANICS CO., LTD.Inventors: Min Soo Kim, Jung Hyun An, Yun Kim, Seung Yong Lee, Dong Chan Seo, Yu Ra Shin, Jin Bok Shin, Choong Seop Jeon, Yun Jeong Cha
-
Publication number: 20240185929Abstract: The present technology relates to an electronic device. A memory device according to the present technology may include a first plane, a second plane, a data input/output circuit, and an encoder. The data input/output circuit may output data read from the first and second planes. The encoder may compress second data read from the second plane while first data read from the first plane is being output. The data input/output circuit may output the compressed second data after outputting the first data.Type: ApplicationFiled: May 30, 2023Publication date: June 6, 2024Applicant: SK hynix Inc.Inventors: Hyeok Chan SOHN, Beom Ju SHIN, Byung Ryul KIM, Kang Wook JO
-
Publication number: 20240181161Abstract: The present invention is configured so that a user can adjust injection attributes including drug injection mode, injection amount, injection depth, and injection speed, and thus has the advantage that convenience of use can be further improved, wherein the user can set desired injection attributes through a user interface, and thus convenience can be improved and a number of outputs, a period, an amplitude, an output time, and an output off time of a pulse applied to a solenoid coil can be adjusted to adjust the injection attributes of a drug to those desired by the user.Type: ApplicationFiled: May 10, 2022Publication date: June 6, 2024Applicant: BAZ BIOMEDIC CO., LTD.Inventors: Jung Kook KIM, Hwi Chan HAM, Sung Hun LEE
-
Publication number: 20240182855Abstract: The present disclosure provides a method for producing a population of regulatory T cells comprising culturing an initial population of regulatory T cells obtained from umbilical cord blood in a media comprising an oligonucleotide having the sequence of AATCGTAACCGTCGTATCGGCGAT (SEQ ID NO: 1) to expand the initial population of regulatory T cells, a method of treating an autoimmune disease comprising administering to a subject in need thereof an effective amount of a composition comprising the regulatory T cells prepared by the above method, and a composition for treating an autoimmune disease, the composition comprising the regulatory T cells.Type: ApplicationFiled: March 31, 2022Publication date: June 6, 2024Inventors: Yong Chan KIM, Nari BYUN, Jeong Heon YOON
-
Publication number: 20240180918Abstract: The present invention relates to a pharmaceutical composition for preventing and/or treating inflammatory disease, the composition comprising a pyrrolopyridine-derivative compound as an active ingredient; the compound represented by Chemical Formula 1 according to the present invention, enantiomers thereof or pharmaceutically acceptable salts thereof, which have excellent inhibitory activity against not only protein kinases but also inflammatory factors and inflammatory cytokines; therefore a pharmaceutical composition comprising the same as an active ingredient may be useful in prevention, treatment and/or improvement of inflammatory disease, in particular but not limited to inflammatory bowel disease, rheumatoid arthritis, or lupus.Type: ApplicationFiled: October 13, 2023Publication date: June 6, 2024Inventors: Soo Chan KIM, Dae Kwon KIM, Dong Hyuk SEO, Hyun Kyung KIM, Sung Hwan KIM, Hye Min HWANG, Ji Eun CHOI
-
Publication number: 20240181904Abstract: A control box for charging includes a second connector disposed at a first end of the control box and configured to be coupled to a first connector provided at a first end of a supply cable configured to be connected to an external power source. The control box includes a retainer configured to prevent separation of the first connector when the first connector and the second connector are completely coupled. A top of the control box is open at a position corresponding to the second connector and the retainer is inserted through the open top and moved up and down.Type: ApplicationFiled: April 17, 2023Publication date: June 6, 2024Applicants: HYUNDAI MOTOR COMPANY, KIA CORPORATION, KOREA ELECTRIC TERMINAL CO., LTD., THN CORPORATIONInventors: Yun Jae Jung, Seung Min Yoo, Byeong Kyu Kim, Yun Chan Hwang, Jeong Ki Kyeong, Jong Hyok Kim, Tae Hong Yun, Seong Cheol Hong, Wan June Kim, Ja Min Kim
-
Publication number: 20240184824Abstract: There is provided a data interworking method between a oneM2M system and an NGSI-LD system. The data interworking method according to an embodiment of the present disclosure includes: retrieving, by an IPE, resources in the oneM2M system that perform data interworking with the NGSI-LD system; retrieving labels of the retrieved resources; acquiring a mapping-rule from the retrieved labels; and storing the acquired mapping-rule. Accordingly, data interworking between data platforms using different standards is performed more easily, so that technology may go one step further to the goal of interconnecting and servicing all things in a global environment as IoT ultimately pursues.Type: ApplicationFiled: October 19, 2021Publication date: June 6, 2024Applicant: Korea Electronics Technology InstituteInventors: Seong Yun KIM, Sung Chan CHOI, Jong Hong PARK, Sung Wook JUNG
-
Publication number: 20240181162Abstract: A needleless syringe, according to the present invention can cause a piston for pressurizing and injecting a drug to repeatedly reciprocate forward and backward, and thus can repeatedly inject a predetermined drug at high speed so that multiple injections, rather than a single injection, are possible during a single procedure to a wider range of skin such as that of the face in the fields of skin care and the like, wherein a user can automatically and repeatedly inject a small amount of drug at high speed without separate loading and the needleless syringe includes a recoil offset part for offsetting recoil generated during the advancing and retreating of the piston, and thus can have more improved convenience of use.Type: ApplicationFiled: November 26, 2020Publication date: June 6, 2024Applicant: BAZ BIOMEDIC CO., LTD.Inventors: Sung Hun LEE, Jung Kook KIM, Hwi Chan HAM
-
Patent number: 11999354Abstract: The present invention relates to a method and apparatus for estimating a road surface type by using an ultrasonic signal and, more particularly, to a method for estimating a road surface type by using an artificial neural network model machine-learned with respect to a reflected ultrasonic signal and an apparatus for performing same. According to the present invention, provided are a method and apparatus for providing highly accurate road surface information at low cost, by machine-learning both characteristics of an ultrasonic signal reflected from a road surface and a road surface state, establishing a model between the two, and then estimating the type of the road surface by utilizing the model. In particular, even a road surface where thin ice, that is, black ice, is formed, which was not detectable in the conventional method for estimating a road-surface friction coefficient, may be accurately estimated, thereby contributing to safer driving.Type: GrantFiled: February 26, 2021Date of Patent: June 4, 2024Assignee: KOREA ADVANCED INSTITUTE OF SCIENCE AND TECHNOLOGYInventors: Sei-Bum Choi, Min-Hyun Kim, Jin-Rak Park, Seung-In Shin, Jong-Chan Park
-
Patent number: 12004279Abstract: A control method of an appliance, including: the appliance includes a first unit that includes a first lamp, a first cavity, a first door and a first sensor; a second unit that includes a second lamp, a second cavity, a second door and a second sensor; and a controller that controls operations of the first unit and the second unit, includes sensing vibrations generated in any one of the first unit or the second unit by the first sensor and the second sensor; determining whether the sensed vibrations are caused by a knock, and when determining that the sensed vibrations are caused by a knock using the first sensor and the second sensor, transferring a knock-on signal to the controller; and comparing the knock-on signals received from the first sensor and the second sensor and determining which of the first unit or the second unit is given the knock by the controller, and outputting a lamp-on output signal to the first unit or the second unit in which the knock is generated by the controller.Type: GrantFiled: August 10, 2022Date of Patent: June 4, 2024Assignee: LG ELECTRONICS INC.Inventors: Myeongsu Shin, Wanglim Lee, Janghoon Kim, Chan-Yong Yeo
-
Publication number: 20240173901Abstract: Disclosed herein is a method of manufacturing an auxetic stretchable substrate with a flexible joint structure. The method includes preparing a substrate made of an elastic material, forming an auxetic to form a plurality of first regions on the substrate, and forming flexible joints in each of the plurality of first regions, wherein each of the plurality of first regions is a region in which a material constituting the auxetic is not printed, and at least some of the flexible joints formed in each of the plurality of first regions have different Young's moduli.Type: ApplicationFiled: January 18, 2023Publication date: May 30, 2024Applicant: KOREA INSTITUTE OF SCIENCE AND TECHNOLOGYInventors: Seungjun CHUNG, Jun Chan CHOI, Phillip LEE, Jeong Gon SON, Jae Hong KIM, Heesuk KIM, Tae Ann KIM
-
Publication number: 20240174898Abstract: The present invention relates to a functional pressure-sensitive composition having high heat resistance and bending resistance characteristics, including: 40 to 55 wt % of a urethane acrylate oligomer, 30 to 44 wt % of an acrylate monomer, 2 to 5 wt % of a photoinitiator, 0.2 to 2 wt % of a silane coupling agent, 0.1 to 1 wt % of a light stabilizer, 0.1 to 1 wt % of an ultraviolet absorber and 0.1 to 1 wt % of an antioxidant, and an electrical component with a 3D structure using the same.Type: ApplicationFiled: August 18, 2023Publication date: May 30, 2024Applicants: HYUNDAI MOBIS CO., LTD., Sonid Inc.Inventors: Jae Joon CHANG, Hyeon Don KIM, Eun Chang LEE, Jae Min LEE, Byeong Chan SONG, Hyun LEE, Tae Won HWANG, So Yeon LIM
-
Publication number: 20240178848Abstract: The present disclosure relates to a multi-chip clock synchronization device and a method capable of reducing an operating frequency and power consumption when a plurality of chips share clocks for multi-chip clock synchronization, which may include a reference clock supply unit connected to a plurality of chips and supplying a reference clock of a first frequency to each chip and a target clock generation unit generating a target clock of a second frequency based on the reference clock of the first frequency, wherein the reference clock supply unit may generate the reference clock of the first frequency which is N times lower than the second frequency of the target clock to supply the generated reference clock to each chip, and the target clock generation unit may multiply the first frequency of the reference clock by N times when the reference clock of the first frequency is input to generate the target clock of the second frequency.Type: ApplicationFiled: November 24, 2023Publication date: May 30, 2024Applicant: LX SEMICON CO., LTD.Inventors: Jae Hwan LEE, Yoon Hoe KIM, Ji Hye KIM, Seung Chan JUNG, Hyun Soo CHUNG
-
Publication number: 20240178436Abstract: To improve pressure measurement reliability and safety of a battery cell and finely control pressure, the disclosure of the present application provides a battery cell pressing device comprising: a battery cell; a plurality of upper plates disposed above the battery cell; a plurality of lower plates disposed below the battery cell; a first pressing member interposed between the plurality of upper plates; and a second pressing member interposed between the plurality of lower plates, wherein a magnetic force is generated at the first pressing member and the second pressing member by an applied current.Type: ApplicationFiled: October 13, 2023Publication date: May 30, 2024Inventors: Kyu Beom KIM, Chae Rin RYOU, Hyeon Su BAE, Ye Jin YUN, Jeong Hyeon YUN, Hyea Won YUN, Ji Hyeon LEE, Jong Chan IM