Patents by Inventor In Chan Kim

In Chan Kim has filed for patents to protect the following inventions. This listing includes patent applications that are pending as well as patents that have already been granted by the United States Patent and Trademark Office (USPTO).

  • Publication number: 20240196664
    Abstract: A light emitting display device includes a first display area, and a second display area disposed outside of the first display area. The second display area includes a pixel driver, a main light-emitting device electrically connected to the pixel driver, and an additional light-emitting device electrically connected to the main light-emitting device. The additional light-emitting device overlaps a peripheral driver that generates signals that are provided to the pixel driver. The main light-emitting device and the additional light-emitting device include a first electrode, an emission layer, and a second electrode. The pixel driver is electrically connected to the second electrode of the main light-emitting device and the second electrode of the additional light-emitting device. The second electrode of the additional light-emitting device and the second electrode of the main light-emitting device are surrounded by a separator in a plan view.
    Type: Application
    Filed: November 30, 2023
    Publication date: June 13, 2024
    Applicant: Samsung Display Co., LTD.
    Inventors: Hye Won KIM, Chung Sock CHOI, Yoo Min KO, Sun Ho KIM, Ju Chan PARK, Pil Suk LEE, Sung Jin HONG
  • Publication number: 20240194146
    Abstract: A scan signal driver includes: stages to sequentially output scan signals in an active period, and to selectively output sensing signals in a vertical blank period. At least one of the stages includes: a sensing control circuit to supply a gate-on voltage to a sensing control node in response to a holding control signal during the active period, and to output the gate-on voltage of the sensing control node in response to a selectively input line select signal during the vertical blank period; an output node control circuit to supply the gate-on voltage to a pull-up node when the gate-on voltage of the sensing control node is output during the vertical blank period; and an output circuit to output a scan clock signal as a sensing signal to one of scan signal lines when the gate-on voltage is supplied to the pull-up node during the vertical blank period.
    Type: Application
    Filed: July 5, 2023
    Publication date: June 13, 2024
    Inventors: Dong Woo KIM, Kee Chan PARK, Yi Kyoung YOU, Chong Chul CHAI, Kyung Ho KIM, Joon Ho LEE
  • Publication number: 20240190509
    Abstract: An embodiment rear structure of a vehicle body includes a rear quarter roof side member defining part of an upper closed structure above the vehicle body, defining part of a rear closed structure behind the vehicle body, and including a side connection portion and a rear pillar upper reinforcement defining part of the rear closed structure, connected with a rear part of the rear quarter roof side member and a part of an upper part of the rear quarter roof side member, and including an upper pillar connection portion provided thereon, wherein the upper pillar connection portion is connected to the side connection portion by a fastener.
    Type: Application
    Filed: September 1, 2023
    Publication date: June 13, 2024
    Inventors: HaeHoon Lee, Jungho Lee, ChangHak Kang, Chan Woong Jeon, Sang Kyoung Han, Youngrock Kim
  • Publication number: 20240191237
    Abstract: Therapeutic compounds for red blood cell-mediated delivery of an active pharmaceutical ingredient to a target cell are described. The therapeutic compounds are configured to bind CD47 on the surface of a red blood cell and to be subsequently transferred to CD47 on the surface of the target cell, the therapeutic compound ultimately being internalized by the target cell via endocytosis. The target cell may be a cancer cell.
    Type: Application
    Filed: January 9, 2024
    Publication date: June 13, 2024
    Inventors: HoWon J. Kim, In-San Kim, Jay S. Kim, Sun Hwa Kim, Ick Chan Kwon, Jong Won Lee, Yoo Soo Yang, Hong Yeol Yoon
  • Publication number: 20240189435
    Abstract: Disclosed is an agent capable of inhibiting the activity or enhancing expression of various cancer-related RNAs in TAMS and cancer cells. Disclosed is also a dual-targeted drug delivery system capable of binding to both tumor cells and macrophages in which the PD-L1 receptor is overexpressed.
    Type: Application
    Filed: December 13, 2022
    Publication date: June 13, 2024
    Applicant: KOREA INSTITUTE OF SCIENCE AND TECHNOLOGY
    Inventors: Yoo Soo YANG, Sun Hwa KIM, Ick Chan KWON, Eun Hye KIM
  • Patent number: 12006502
    Abstract: Therapeutic compounds for red blood cell-mediated delivery of an active pharmaceutical ingredient to a target cell are described. The therapeutic compounds are configured to bind CD47 on the surface of a red blood cell and to be subsequently transferred to CD47 on the surface of the target cell, the therapeutic compound ultimately being internalized by the target cell via endocytosis. The target cell may be a fibrotic cell.
    Type: Grant
    Filed: January 9, 2024
    Date of Patent: June 11, 2024
    Assignees: K2B Therapeutics, Inc., KIST (Korea Institute of Science and Technology)
    Inventors: HoWon J. Kim, In-San Kim, Jay S. Kim, Sun Hwa Kim, Ick Chan Kwon, Jong Won Lee, Yoo Soo Yang, Hong Yeol Yoon
  • Patent number: 12009151
    Abstract: A capacitor component includes a body including a dielectric layer and an internal electrode layer, and an external electrode disposed on the body and connected to the internal electrode layer. The dielectric layer includes dielectric grains, at least a portion of the dielectric grains has a core-shell structure, and a shell of the core-shell structure contains a rare earth element having an average concentration of more than 0.5 at %.
    Type: Grant
    Filed: March 4, 2022
    Date of Patent: June 11, 2024
    Assignee: SAMSUNG ELECTRO-MECHANICS CO., LTD.
    Inventors: Min Soo Kim, Jung Hyun An, Yun Kim, Seung Yong Lee, Dong Chan Seo, Yu Ra Shin, Jin Bok Shin, Choong Seop Jeon, Yun Jeong Cha
  • Publication number: 20240185929
    Abstract: The present technology relates to an electronic device. A memory device according to the present technology may include a first plane, a second plane, a data input/output circuit, and an encoder. The data input/output circuit may output data read from the first and second planes. The encoder may compress second data read from the second plane while first data read from the first plane is being output. The data input/output circuit may output the compressed second data after outputting the first data.
    Type: Application
    Filed: May 30, 2023
    Publication date: June 6, 2024
    Applicant: SK hynix Inc.
    Inventors: Hyeok Chan SOHN, Beom Ju SHIN, Byung Ryul KIM, Kang Wook JO
  • Publication number: 20240181161
    Abstract: The present invention is configured so that a user can adjust injection attributes including drug injection mode, injection amount, injection depth, and injection speed, and thus has the advantage that convenience of use can be further improved, wherein the user can set desired injection attributes through a user interface, and thus convenience can be improved and a number of outputs, a period, an amplitude, an output time, and an output off time of a pulse applied to a solenoid coil can be adjusted to adjust the injection attributes of a drug to those desired by the user.
    Type: Application
    Filed: May 10, 2022
    Publication date: June 6, 2024
    Applicant: BAZ BIOMEDIC CO., LTD.
    Inventors: Jung Kook KIM, Hwi Chan HAM, Sung Hun LEE
  • Publication number: 20240182855
    Abstract: The present disclosure provides a method for producing a population of regulatory T cells comprising culturing an initial population of regulatory T cells obtained from umbilical cord blood in a media comprising an oligonucleotide having the sequence of AATCGTAACCGTCGTATCGGCGAT (SEQ ID NO: 1) to expand the initial population of regulatory T cells, a method of treating an autoimmune disease comprising administering to a subject in need thereof an effective amount of a composition comprising the regulatory T cells prepared by the above method, and a composition for treating an autoimmune disease, the composition comprising the regulatory T cells.
    Type: Application
    Filed: March 31, 2022
    Publication date: June 6, 2024
    Inventors: Yong Chan KIM, Nari BYUN, Jeong Heon YOON
  • Publication number: 20240180918
    Abstract: The present invention relates to a pharmaceutical composition for preventing and/or treating inflammatory disease, the composition comprising a pyrrolopyridine-derivative compound as an active ingredient; the compound represented by Chemical Formula 1 according to the present invention, enantiomers thereof or pharmaceutically acceptable salts thereof, which have excellent inhibitory activity against not only protein kinases but also inflammatory factors and inflammatory cytokines; therefore a pharmaceutical composition comprising the same as an active ingredient may be useful in prevention, treatment and/or improvement of inflammatory disease, in particular but not limited to inflammatory bowel disease, rheumatoid arthritis, or lupus.
    Type: Application
    Filed: October 13, 2023
    Publication date: June 6, 2024
    Inventors: Soo Chan KIM, Dae Kwon KIM, Dong Hyuk SEO, Hyun Kyung KIM, Sung Hwan KIM, Hye Min HWANG, Ji Eun CHOI
  • Publication number: 20240181904
    Abstract: A control box for charging includes a second connector disposed at a first end of the control box and configured to be coupled to a first connector provided at a first end of a supply cable configured to be connected to an external power source. The control box includes a retainer configured to prevent separation of the first connector when the first connector and the second connector are completely coupled. A top of the control box is open at a position corresponding to the second connector and the retainer is inserted through the open top and moved up and down.
    Type: Application
    Filed: April 17, 2023
    Publication date: June 6, 2024
    Applicants: HYUNDAI MOTOR COMPANY, KIA CORPORATION, KOREA ELECTRIC TERMINAL CO., LTD., THN CORPORATION
    Inventors: Yun Jae Jung, Seung Min Yoo, Byeong Kyu Kim, Yun Chan Hwang, Jeong Ki Kyeong, Jong Hyok Kim, Tae Hong Yun, Seong Cheol Hong, Wan June Kim, Ja Min Kim
  • Publication number: 20240184824
    Abstract: There is provided a data interworking method between a oneM2M system and an NGSI-LD system. The data interworking method according to an embodiment of the present disclosure includes: retrieving, by an IPE, resources in the oneM2M system that perform data interworking with the NGSI-LD system; retrieving labels of the retrieved resources; acquiring a mapping-rule from the retrieved labels; and storing the acquired mapping-rule. Accordingly, data interworking between data platforms using different standards is performed more easily, so that technology may go one step further to the goal of interconnecting and servicing all things in a global environment as IoT ultimately pursues.
    Type: Application
    Filed: October 19, 2021
    Publication date: June 6, 2024
    Applicant: Korea Electronics Technology Institute
    Inventors: Seong Yun KIM, Sung Chan CHOI, Jong Hong PARK, Sung Wook JUNG
  • Publication number: 20240181162
    Abstract: A needleless syringe, according to the present invention can cause a piston for pressurizing and injecting a drug to repeatedly reciprocate forward and backward, and thus can repeatedly inject a predetermined drug at high speed so that multiple injections, rather than a single injection, are possible during a single procedure to a wider range of skin such as that of the face in the fields of skin care and the like, wherein a user can automatically and repeatedly inject a small amount of drug at high speed without separate loading and the needleless syringe includes a recoil offset part for offsetting recoil generated during the advancing and retreating of the piston, and thus can have more improved convenience of use.
    Type: Application
    Filed: November 26, 2020
    Publication date: June 6, 2024
    Applicant: BAZ BIOMEDIC CO., LTD.
    Inventors: Sung Hun LEE, Jung Kook KIM, Hwi Chan HAM
  • Patent number: 11999354
    Abstract: The present invention relates to a method and apparatus for estimating a road surface type by using an ultrasonic signal and, more particularly, to a method for estimating a road surface type by using an artificial neural network model machine-learned with respect to a reflected ultrasonic signal and an apparatus for performing same. According to the present invention, provided are a method and apparatus for providing highly accurate road surface information at low cost, by machine-learning both characteristics of an ultrasonic signal reflected from a road surface and a road surface state, establishing a model between the two, and then estimating the type of the road surface by utilizing the model. In particular, even a road surface where thin ice, that is, black ice, is formed, which was not detectable in the conventional method for estimating a road-surface friction coefficient, may be accurately estimated, thereby contributing to safer driving.
    Type: Grant
    Filed: February 26, 2021
    Date of Patent: June 4, 2024
    Assignee: KOREA ADVANCED INSTITUTE OF SCIENCE AND TECHNOLOGY
    Inventors: Sei-Bum Choi, Min-Hyun Kim, Jin-Rak Park, Seung-In Shin, Jong-Chan Park
  • Patent number: 12004279
    Abstract: A control method of an appliance, including: the appliance includes a first unit that includes a first lamp, a first cavity, a first door and a first sensor; a second unit that includes a second lamp, a second cavity, a second door and a second sensor; and a controller that controls operations of the first unit and the second unit, includes sensing vibrations generated in any one of the first unit or the second unit by the first sensor and the second sensor; determining whether the sensed vibrations are caused by a knock, and when determining that the sensed vibrations are caused by a knock using the first sensor and the second sensor, transferring a knock-on signal to the controller; and comparing the knock-on signals received from the first sensor and the second sensor and determining which of the first unit or the second unit is given the knock by the controller, and outputting a lamp-on output signal to the first unit or the second unit in which the knock is generated by the controller.
    Type: Grant
    Filed: August 10, 2022
    Date of Patent: June 4, 2024
    Assignee: LG ELECTRONICS INC.
    Inventors: Myeongsu Shin, Wanglim Lee, Janghoon Kim, Chan-Yong Yeo
  • Publication number: 20240173901
    Abstract: Disclosed herein is a method of manufacturing an auxetic stretchable substrate with a flexible joint structure. The method includes preparing a substrate made of an elastic material, forming an auxetic to form a plurality of first regions on the substrate, and forming flexible joints in each of the plurality of first regions, wherein each of the plurality of first regions is a region in which a material constituting the auxetic is not printed, and at least some of the flexible joints formed in each of the plurality of first regions have different Young's moduli.
    Type: Application
    Filed: January 18, 2023
    Publication date: May 30, 2024
    Applicant: KOREA INSTITUTE OF SCIENCE AND TECHNOLOGY
    Inventors: Seungjun CHUNG, Jun Chan CHOI, Phillip LEE, Jeong Gon SON, Jae Hong KIM, Heesuk KIM, Tae Ann KIM
  • Publication number: 20240174898
    Abstract: The present invention relates to a functional pressure-sensitive composition having high heat resistance and bending resistance characteristics, including: 40 to 55 wt % of a urethane acrylate oligomer, 30 to 44 wt % of an acrylate monomer, 2 to 5 wt % of a photoinitiator, 0.2 to 2 wt % of a silane coupling agent, 0.1 to 1 wt % of a light stabilizer, 0.1 to 1 wt % of an ultraviolet absorber and 0.1 to 1 wt % of an antioxidant, and an electrical component with a 3D structure using the same.
    Type: Application
    Filed: August 18, 2023
    Publication date: May 30, 2024
    Applicants: HYUNDAI MOBIS CO., LTD., Sonid Inc.
    Inventors: Jae Joon CHANG, Hyeon Don KIM, Eun Chang LEE, Jae Min LEE, Byeong Chan SONG, Hyun LEE, Tae Won HWANG, So Yeon LIM
  • Publication number: 20240178848
    Abstract: The present disclosure relates to a multi-chip clock synchronization device and a method capable of reducing an operating frequency and power consumption when a plurality of chips share clocks for multi-chip clock synchronization, which may include a reference clock supply unit connected to a plurality of chips and supplying a reference clock of a first frequency to each chip and a target clock generation unit generating a target clock of a second frequency based on the reference clock of the first frequency, wherein the reference clock supply unit may generate the reference clock of the first frequency which is N times lower than the second frequency of the target clock to supply the generated reference clock to each chip, and the target clock generation unit may multiply the first frequency of the reference clock by N times when the reference clock of the first frequency is input to generate the target clock of the second frequency.
    Type: Application
    Filed: November 24, 2023
    Publication date: May 30, 2024
    Applicant: LX SEMICON CO., LTD.
    Inventors: Jae Hwan LEE, Yoon Hoe KIM, Ji Hye KIM, Seung Chan JUNG, Hyun Soo CHUNG
  • Publication number: 20240178436
    Abstract: To improve pressure measurement reliability and safety of a battery cell and finely control pressure, the disclosure of the present application provides a battery cell pressing device comprising: a battery cell; a plurality of upper plates disposed above the battery cell; a plurality of lower plates disposed below the battery cell; a first pressing member interposed between the plurality of upper plates; and a second pressing member interposed between the plurality of lower plates, wherein a magnetic force is generated at the first pressing member and the second pressing member by an applied current.
    Type: Application
    Filed: October 13, 2023
    Publication date: May 30, 2024
    Inventors: Kyu Beom KIM, Chae Rin RYOU, Hyeon Su BAE, Ye Jin YUN, Jeong Hyeon YUN, Hyea Won YUN, Ji Hyeon LEE, Jong Chan IM