Abstract: A device implementing polariton optical neural network, comprising: Input layer (100) consisting of optical elements ensuring linear pre-processing and distribution of input optical signals (102), middle layer (104), consisting of nonlinear optical elements, realizing nonlinear transformation of the pre-processed input signals (106), output layer (108) consisting of linear optical elements, realizing linear transformation of the signals that had been transformed nonlinearly (110) and generating output signals, passive optical systems (114) optically coupling the input layer (100), the middle layer (104), the output layer (108) characterized in that the nonlinear transformation in the middle layer occurs as a result of interaction of pre-processed input signals (106) with a nonlinear element or elements in the form of an optical microcavity or multiple optical microcavities hosting exciton-polaritons.

Abstract: The present invention to a method for expressing an exogenous gene specifically in cells of the retinal pigment epithelium of a primate, this method comprising the step of delivering an isolated nucleic acid molecule comprising, or consisting of, the nucleic acid sequence of SEQ ID NO:1, or consisting of a nucleic acid sequence of at least 400 bp having at least 80% overall identity to the sequence of SEQ ID NO:1, to cells of the retinal pigment epithelium of the primate, wherein this isolated nucleic acid molecule specifically leads to the expression of an exogenous gene in cells of the retinal pigment epithelium of primates when a nucleic acid sequence coding for the exogenous gene is operatively linked to this isolated nucleic acid molecule.

Abstract: The present invention to a method for expressing an exogenous gene specifically in cells of the retinal pigment epithelium of a primate, this method comprising the step of delivering an isolated nucleic acid molecule comprising, or consisting of, the nucleic acid sequence of SEQ ID NO:1, or consisting of a nucleic acid sequence of at least 1500 bp having at least 80% overall identity to the sequence of SEQ ID NO:1, to cells of the retinal pigment epithelium of the primate, wherein this isolated nucleic acid molecule specifically leads to the expression of an exogenous gene in cells of the retinal pigment epithelium of primates when a nucleic acid sequence coding for the exogenous gene is operatively linked to this isolated nucleic acid molecule.

Abstract: The present invention provides an isolated nucleic acid molecule comprising, or consisting of, the nucleic acid sequence of SEQ ID NO:1 or a nucleic acid sequence of at least 1000 bp having at least 80% identity to said sequence of SEQ ID NO:1, wherein said isolated nucleic acid molecule specifically leads to the expression in cells of the retinal pigment epithelium of a gene when operatively linked to a nucleic acid sequence coding for said gene.

Abstract: Viral vectors to deliver a heterologous CYP4V2 gene to the retina, e.g., RPE cells of the retina, are provided herein to treat subjects with Bietti crystalline dystrophy.

Abstract: Viral vectors to deliver a heterologous CYP4V2 gene to the retina, e.g., RPE cells of the retina, are provided herein to treat subjects with Bietti crystalline dystrophy.

Abstract: The present invention provides an isolated nucleic acid molecule comprising, or consisting of, the nucleic acid sequence of SEQ ID NO:1 or a nucleic acid sequence of at least 1400 bp having at least 80% identity to said sequence of SEQ ID NO:1, wherein said isolated nucleic acid molecule specifically leads to the expression in retinal ganglion cells of a gene when operatively linked to nucleic acid sequence coding for said gene.

Abstract: The present invention provides an isolated nucleic acid molecule comprising, or consisting of, the nucleic acid sequence of SEQ ID NO:1 or a nucleic acid sequence of at least 600 bp having at least 80% identity to said sequence of SEQ ID NO:1, wherein said isolated nucleic acid molecule specifically leads to the expression in retinal ganglion cells of a gene when operatively linked to a nucleic acid sequence coding for said gene.

Abstract: The present invention provides an isolated nucleic acid molecule comprising, or consisting of, the nucleic acid sequence of SEQ ID NO:1 or a nucleic acid sequence of at least 1400 bp having at least 80% identity to said sequence of SEQ ID NO:1, wherein said isolated nucleic acid molecule specifically leads to the expression in retinal ganglion cells of a gene when operatively linked to a nucleic acid sequence coding for said gene.

Abstract: The present invention provides an isolated nucleic acid molecule comprising, or consisting of, the nucleic acid sequence of SEQ ID NO:1 or a nucleic acid sequence of at least 350 bp having at least 80% identity to said sequence of SEQ ID NO:1, and related uses, wherein said isolated nucleic acid molecule specifically leads to the expression in retinal ganglion cells of a gene when operatively linked to a nucleic acid sequence coding for said gene.

Abstract: The present invention provides an isolated nucleic acid molecule comprising, or consisting of, the nucleic acid sequence of SEQ ID NO:1 or a nucleic acid sequence of at least 800 bp having at least 80% identity to said sequence of SEQ ID NO:1, and related uses, wherein said isolated nucleic acid molecule specifically leads to the expression in protoplasmic astrocytes of a gene when operatively linked to a nucleic acid sequence coding for said gene.

Abstract: The present invention provides an isolated nucleic acid molecule comprising, or consisting of, the nucleic acid sequence of SEQ ID NO:1, or of a nucleic acid sequence of at least 1800 bp having at least 80% identity to said sequence of SEQ ID NO:1, and related uses, wherein said isolated nucleic acid molecule leads to the specific expression of an exogenous gene in photoreceptors when a nucleic acid sequence coding for said exogenous gene is operatively linked to said isolated nucleic acid molecule

Abstract: The present invention provides an isolated nucleic acid molecule comprising, or consisting of, the nucleic acid sequence of SEQ ID NO:1 or a nucleic acid sequence of at least 550 bp having at least 80% identity to said sequence of SEQ ID NO:1, and uses thereof, wherein said isolated nucleic acid molecule specifically leads to the expression in retinal ganglion cells of a gene when operatively linked to a nucleic acid sequence coding for said gene.

Abstract: The present invention provides an isolated nucleic acid molecule comprising, or consisting of, the nucleic acid sequence of SEQ ID NO:1 or a nucleic acid sequence of at least 1400 bp having at least 80% identity to said sequence of SEQ ID NO:1, and related uses, wherein said isolated nucleic acid molecule specifically leads to the expression in retinal ganglion cells of a gene when operatively linked to a nucleic acid sequence coding for said gene.

Abstract: The present invention provides an isolated nucleic acid molecule comprising, or consisting of, the nucleic acid sequence of SEQ ID NO:1 or a nucleic acid sequence of at least 1800 bp having at least 80% identity to said sequence of SEQ ID NO:1, wherein said isolated nucleic acid molecule specifically leads to the expression in retinal ganglion cells of a gene when operatively linked to a nucleic acid sequence coding for said gene.

Abstract: The present invention to a method for expressing an exogenous gene specifically in cells of the retinal pigment epithelium N of a primate, this method comprising the step of delivering an isolated nucleic acid molecule comprising, or consisting of, the nucleic acid sequence of SEQ ID NO:1, or consisting of a nucleic acid sequence of at least 400 bp having at least 80% overall identity to the sequence of SEQ ID NO:1, to cells of the retinal pigment epithelium of the primate, wherein this isolated nucleic acid molecule specifically leads to the expression of an exogenous gene in cells of the retinal pigment epithelium of primates when a nucleic acid sequence coding for the exogenous gene is operatively linked to this isolated nucleic acid molecule.

Abstract: The present invention provides an isolated nucleic acid molecule comprising, or consisting of, the nucleic acid sequence of SEQ ID NO:1 or a nucleic acid sequence of at least 1000 bp having at least 80% identity to said sequence of SEQ ID NO:1, wherein said isolated nucleic acid molecule specifically leads to the expression in cells of the retinal pigment epithelium of a gene when operatively linked to a nucleic acid sequence coding for said gene.

Abstract: The present inventions relates to isolated nucleic acid molecules comprising a nucleotide sequence coding for miRNA-182 (uuuggcaaugguagaacucacacu or ugguucuagacuugccaacua), miRNA-96 (uuuggcacuagcacauuuuugcu or aaucaugugcagugccaauaug) and/or miRNA-183 (uauggcacugguagaauucacu or gugaauuaccgaagggccauaa) for use in treating or ameliorating a ciliopathy and/or a photoreceptor dysfunction.

Abstract: A mechanism is described for facilitating dynamic culling of composite objects producing not visible change in graphics images on computing devices. A method of embodiments, as described herein, includes identifying one or more objects of a plurality of objects of a frame for being potentially insignificant to be included in a subsequent frame, and applying one or more bounding boxes encompassing the one or more objects. The method may further include determining, basing on a vertex transformation, one or more minimum bounding rectangles corresponding to the one or more bounding boxes. The method may further include determining, based on rasterization rules, coverage of the one or more minimum bounding rectangles to one or more pixel centers of one or more pixels, and selecting a first object of the one or more objects to be included in the subsequent frame, if a first of the one or more corresponding minimum bounding rectangles touch or include a pixel center of a pixel.

Abstract: The present inventions relates to isolated nucleic acid molecules comprising a nucleotide sequence coding for mi RNA-182 (uuuggcaaugguagaacucacacu or ugguucuagacuugccaacua), miRNA-96 (uuuggcacuagcacauuuuugcu or aaucaugugcagugccaauaug) and/or mi RNA-183 (uauggcacugguagaauucacu or gugaauuaccgaagggccauaa) for use in treating or ameliorating a ciliopathy and/or a photoreceptor dysfunction.