Abstract: A near-bit constant-power wireless short-distance transmission apparatus includes a transmitting portion and a receiving portion. The transmitting portion is connected to a near-bit measurement sub while the receiving portion is connected to a measurement while drilling system. The transmitting portion processes data received by the bit measurement sub and then transmits it to the receiving portion. The receiving portion further processes the information and then transmits it to the measurement while drilling system. An insulating sub is inserted in the transmitting portion and separates the transmitting portion into a transmitting positive pole and a transmitting negative pole, which become electrically isolated from each other. Another insulating sub is inserted in the receiving portion and separates the receiving portion into a receiving positive pole and a receiving negative pole, which become electrically isolated from each other.

Abstract: Graft-versus-host disease (GVHD) is a lethal complication of allograft transplantation. The current strategy of using immunosuppressive agents to control GVHD may cause general immune suppression and limit the effectiveness of allograft transplantation. Adoptive transfer of regulatory T cells (Treg) can prevent GVHD in rodents, indicating the therapeutic potential of Treg for GVHD in humans. However, the clinical application of Treg-based therapy is hampered by the low frequency of human Treg and the lack of a reliable model to test their therapeutic effects in vivo. Human alloantigen-specific Treg are generated from antigenically-naïve precursors in a large scale ex vivo using allogeneic activated B cells as stimulators. Here, a human allogeneic GVHD model is established in humanized mice to mimic GVHD after allograft transplantation in humans.

Abstract: The present invention relates generally to an attrition resistant core-in-shell composite adsorbent comprising at least a zeolite-containing CO2 removal adsorbent and a binder on an inert dense core. The attrition resistant core-in-shell composite adsorbent has an attrition loss of less than about 2 wt %. The core-in-shell composite adsorbent is preferably used in a multi-layered adsorption system in a cyclic adsorption process, preferably used in a PSA prepurification process prior to cryogenic air separation.

Abstract: A system enhances existing audio-visual content with audio describing the setting of the visual content. A scene annotation module classifies scene elements from an image frame received from a host system and generates a caption describing the scene elements.

Abstract: A system enhances existing audio visual content with audio describing the action and setting of the visual content. The system may also provide subtitle content describing the important sound or sounds occurring within audio. Accommodation for color or visual impairments may be implemented by selective color substitution. A Graphical Style Modification module may apply a style from one image to another to adapt the style of a video per a gamer's preference.

Abstract: An azimuthal acoustic LWD apparatus is sequentially provided with a centralizer, a transmitting circuit, transmitting transducers, an acoustic insulator, a receiving transducer array, ultrasonic transducers and a receiving circuit on a drill collar. The azimuthal acoustic LWD apparatus is capable of operating in a dipole mode or a unipole mode, to cover all the sectors around a wellbore by adopting a fixed time interval measurement mode or an alternating time interval measurement mode according to a relationship of an interval between measurement times and a rotation speed of the apparatus, thereby achieving azimuthal acoustic LWD. This apparatus overcomes problems that the fixed time interval measurement mode may not cover all the sectors and further may not achieve azimuthal acoustic imaging in a case where the rotation speed and the interval between measurement times are under certain conditions.

Abstract: An azimuthal acoustic LWD apparatus is sequentially provided with a centralizer, a transmitting circuit, transmitting transducers, an acoustic insulator, a receiving transducer array, ultrasonic transducers and a receiving circuit on a drill collar. The azimuthal acoustic LWD apparatus is capable of operating in a dipole mode or a unipole mode, to cover all the sectors around a wellbore by adopting a fixed time interval measurement mode or an alternating time interval measurement mode according to a relationship of an interval between measurement times and a rotation speed of the apparatus, thereby achieving azimuthal acoustic LWD. This apparatus overcomes problems that the fixed time interval measurement mode may not cover all the sectors and further may not achieve azimuthal acoustic imaging in a case where the rotation speed and the interval between measurement times are under certain conditions.

Abstract: In an apparatus for multi-pole acoustic logging while drilling, a N-cycle sinusoidal wave signal is generated by utilizing a signal processor, and amplified into a high-voltage sinusoidal excitation signal by utilizing a power amplifier, and output to a transmitting transducer. The signal processor simultaneously generates an enable signal. The enable signal includes a transient discharge enable signal. The power amplifier is connected with a transient discharge circuit. After the signal processor generates N cycles of a sinusoidal wave, the transient discharge enable signal enables the transient discharge circuit to discharge to release an energy storage current of a power transformer so as to eliminate a high-voltage ringing effect and improve an excitation efficiency of the transducer.

Abstract: The present invention relates to a marker piRNA-54265 and a method in diagnosis, treatment, and prognostic evaluation of colorectal cancer. The marker piRNA-54265 is capable of being used for diagnosing and/or treating colorectal cancer, wherein the marker piRNA-54265 is selected from any of molecules as follows: (1) SEQ ID NO.29: tggaggtgatgaactgtctgagcctgacc; (2) SEQ ID NO.30: UGGAGGUGAUGAACUGUCUGAGCCUGACC; (3) SEQ ID NO.31: GGUCAGGCUCAGACAGUUCAUCACCUCCA; (4) a piR-54265 variant and a piR-54265 derivative modified from the molecule shown in (1), (2) or (3) with a same function; (5) a piR-54265 polynucleotide construct capable of down-regulating an amount of the piR-54265 in vivo after being introduced; and (6) an expression vector containing the polynucleotide construct of (5). The method is used for diagnosing/screening colorectal cancer, evaluating chemosensitivity of a colorectal cancer patient, evaluating a prognosis of a colorectal cancer patient or treating colorectal cancer.

Abstract: A space vector pulse width modulation (SVPWM) method for suppressing a common-mode voltage of a multiphase motor includes the following steps: (1) dividing all basic vectors of the multiphase motor into q types, and selecting therefrom x types having equal common-mode voltage magnitude of which an absolute value is smallest; (2) for each type in the x types of basic vectors, structuring y classes of auxiliary vectors according to an optimization model; (3) synthesizing reference vectors by virtue of the auxiliary vectors to obtain functioning time of basic vectors functioning in each switching period; and (4) obtaining an optimal functioning sequence of the basic vectors functioning in each switching period with fewest switching operations of a converter as a purpose. The present invention may effectively suppress a magnitude and frequency of the common-mode voltage of the multiphase motor without increasing calculation complexity or reducing other performance indexes.

Abstract: A apparatus for downhole near-bit wireless transmission includes a bit connecting housing, a mud motor connecting housing, an insulating sub made of an insulating material. The insulating sub is serially connected between the bit connecting housing and the mud motor connecting housing to electrical insulate the bit connecting housing and the mud motor connecting housing from each other. The bit connecting housing and the mud motor connecting housing respectively form an electromagnetic transmitting positive pole and an electromagnetic transmitting negative pole. The mechanical apparatus further includes measurement units, which are configured to acquire parameters measured near the bit and a data transmitting unit, which is configured to realize wireless transmission; and the data transmitting unit is configured to receive and transmit the parameters measured near the bit.

Abstract: Modified hepatitis C virus polypeptides are described. The polypeptides include the HCV NS4a domain and modified NS3 domain. The polypeptides retain conformational epitopes. HCV immunoassays including the polypeptides are also described.

Abstract: A space vector pulse width modulation (SVPWM) method for suppressing a common-mode voltage of a multiphase motor includes the following steps: (1) dividing all basic vectors of the multiphase motor into q types, and selecting therefrom x types having equal common-mode voltage magnitude of which an absolute value is smallest; (2) for each type in the x types of basic vectors, structuring y classes of auxiliary vectors according to an optimization model; (3) synthesizing reference vectors by virtue of the auxiliary vectors to obtain functioning time of basic vectors functioning in each switching period; and (4) obtaining an optimal functioning sequence of the basic vectors functioning in each switching period with fewest switching operations of a converter as a purpose.

Abstract: The present disclosure relates to the technical field of acoustic logging while drilling, and provides an integral packaging device for acoustic receiving transducers while drilling, wherein, the receiving transducers are directly arranged in a signal processing circuit, which is installed in an internal supporting frame fitted in a rectangular bellow; one side of the bellow has a deformable surface that is of a corrugated structure, and oil is filled in the bellow; the receiving transducers are arranged on the side that has a deformable surface; a shock absorbing rubber piece is of a U-shaped structure; one end of a connecting unit is connected to the signal processing circuit, and the other end of the connecting unit is connected to a main control circuit in a logging while drilling instrument. The present disclosure employs an integral packaging structure, which is easy to install structurally.

Abstract: An azimuthally acoustic imaging logging while drilling (LWD) apparatus employs two sets of transmitting transducers to excite multipole mode waves. One set is high-frequency monopole and polarized pole transmitting transducers, and the other set is low-frequency dipole and quadrupole transmitting transducers. Separation of a high-frequency transmitting state from a low-frequency transmitting state is realized by using a dual-row transmission solution. Each set of transmitting transducers operates at transducer resonance points through a matching circuit, thereby greatly increasing the transmitted energy.

Abstract: An acoustic source testing apparatus of an azimuthally acoustic logging while drilling (LWD) instrument includes a water tank, a silicone oil, a drill collar, an azimuthally acoustic while drilling quadrupole transmitting apparatus and an acoustic signal reception apparatus. The bottom of the water tank is symmetrically provided with two supporting columns, the drill collar is disposed in U-shaped grooves on the supporting columns, the azimuthally acoustic quadrupole LWD transmitting apparatus and the acoustic signal reception apparatus are disposed on the drill collar, the silicone oil is filled in the water tank, and the drill collar, the azimuthally acoustic quadrupole LWD transmitting apparatus and the acoustic signal reception apparatus are completely covered in the silicone oil.

Abstract: A near-bit dynamic well deviation angle measurement apparatus includes a circuit board and 2n+1 accelerometers. One accelerometer is installed in an axial direction of a drilling tool and forms n sets of three-axis orthogonal installation together with other 2n accelerometers. The accelerometer installed in the axial direction measures Az?, and the remaining accelerometers respectively measure n X-axis radial components and n Y-axis radial components corresponding to the n X-axis radial components. A filter and a data processing unit are integrated on the circuit board. The circuit board acquires signals in which the components are eliminated by the accelerators in real time, and further high-frequency vibration and impact interference in the signals are filtered out by using the filter to obtain non-interference gravitational acceleration components Ax, Ay and Az, and further a well deviation angle is calculated.

Abstract: The present disclosure relates to a technical field of a security detection device, and particularly, to a security detection system, comprising one or more detection devices, wherein the detection device comprises a first ray emitter, a ray receiver, and a movable frame, wherein the first ray emitter comprises a first ray source for generating first detection rays and is provided at a bottom portion of the movable frame, so that the first detection rays can penetrate through a detected object from a bottom of the detected object; the ray receiver comprises a ray detector provided on the movable frame, for correspondingly receiving the first detection rays having penetrated through the detected object; and the movable frame is movable in a direction in which the first ray emitter and the ray receiver are capable of moving through a detection region for the detected object.

Abstract: The present disclosure relates to the technical field of acoustic logging while drilling, and provides an integral packaging device for acoustic receiving transducers while drilling, wherein, the receiving transducers are directly arranged in a signal processing circuit, which is installed in an internal supporting frame fitted in a rectangular bellow; one side of the bellow has a deformable surface that is of a corrugated structure, and oil is filled in the bellow; the receiving transducers are arranged on the side that has a deformable surface; a shock absorbing rubber piece is of a U-shaped structure; one end of a connecting unit is connected to the signal processing circuit, and the other end of the connecting unit is connected to a main control circuit in a logging while drilling instrument. The present disclosure employs an integral packaging structure, which is easy to install structurally.