Abstract: This disclosure relates generally to nucleic acid aptamers especially useful for cell transduction, as well as to containers (such as bags) having surfaces comprising one or such aptamers, and to transductions methods using such aptamers and containers. One embodiment of the disclosure provides A DNA aptamer comprising a plurality of nucleotides, the DNA aptamer having at least 80% sequence identity with the sequence of SEQ ID NO: 1 (AAACTGCAGCGATTCATTAGTACGGCCTTT).

Abstract: The present application is directed to a sampling system for sampling a fluid from a vessel, where the sampling system includes a sterile dispenser assembly operatively connected to the vessel, the sterile dispenser assembly including a valve operatively connected to the vessel, a membrane, and a needle, and a detachable sterile sampling container assembly operatively connected to the sterile dispenser assembly, the detachable sterile sampling container assembly including a sampling container, a membrane attached to the sampling container, and a sampling container housing enclosing the sampling container, where the sampling container housing includes a compressible portion having a deflated configuration and an expanded configuration.

Abstract: The present application is directed to a sampling system for sampling a fluid from a vessel, where the sampling system includes a sterile dispenser assembly operatively connected to the vessel, the sterile dispenser assembly including a valve operatively connected to the vessel, a membrane, and a needle, and a detachable sterile sampling container assembly operatively connected to the sterile dispenser assembly, the detachable sterile sampling container assembly including a sampling container, a membrane attached to the sampling container, and a sampling container housing enclosing the sampling container, where the sampling container housing includes a compressible portion having a deflated configuration and an expanded configuration.