Patents by Inventor Richard Christopher Andrew Thompson

Richard Christopher Andrew Thompson has filed for patents to protect the following inventions. This listing includes patent applications that are pending as well as patents that have already been granted by the United States Patent and Trademark Office (USPTO).

  • Publication number: 20080317806
    Abstract: A compound of Formula (A), wherein R1 is C1-C5 alkyl, C3-C6 branched alkyl, C4-C7 cycloalkyl, C8-C12 fused or bridged polycycloalkyl, or heterocyclic ring, where any of the preceding alkyl, cycloalkyl or heterocyclic ring groups may be singly or multiply substituted with X; R2 is H or R1; and X is halo, carbonyl carboxylic acid, carboxylic ester, carboxamide, substituted carboxamide, hydroxy, alkoxy, thioalkyl, sulphoxide, sulphone, sulphonamide, substituted sulphonamide, phenoxy, substituted phenoxy, phenyl, substituted phenyl, amino, substituted amino (including quaternary ammonium salts), N-oxide, imino, 5-7 membered heterocycle, or substituted heterocycle.
    Type: Application
    Filed: April 11, 2006
    Publication date: December 25, 2008
    Applicant: Murdoch University
    Inventors: Wayne Morris Best, Colette Gloria Sims, Richard Christopher Andrew Thompson, Simon Andrew Reid, Anthony Armson, James Alexander Reynoldson
  • Patent number: 6054275
    Abstract: The invention provides a purified and isolated Cryptosporidium DNA sequence comprising the nucleotide sequence:GATGGTACTGGATAGATAGTGGAAGTCCCGTATCAGTTCGAGATTCTGAAATTA ATTGGACATCAAGTTATAAAGCAAGCTGGTTATTAAGATTCAAATTTCCCTTTGA AAAGTGTGGCTTTTTTGATATTGGAGGGTTAGGAAGAAGGTT plus methods and kits for detecting and/or identifying the presence of Cryptosporidium.
    Type: Grant
    Filed: March 20, 1998
    Date of Patent: April 25, 2000
    Assignee: Murdoch University
    Inventors: Una Morgan, Richard Christopher Andrew Thompson