Abstract: A reaction tank (5) holds crushed cells comprising a pellicle of Bacillus midousuji cultured in the presence of a chlorinated aromatic compound such as dioxins and holds wastewater comprising a contaminated matter such as fly ash which comprises dioxins and which is produced by washing of a facility such as an incinerator. Air is supplied by a blower (6) to a matter held in the reaction tank (5). Accordingly, dioxins having three or more chlorine atoms in the contaminated matter can be decomposed, and the contaminated matter can be easily cleaned at a site where dioxins generate such as a washing or dismantling site of an incineration facility.

Abstract: Disclosed herein is a method for determining the drug sensitivity of a microbe which comprises pouring a microbial suspension into each of the compartments or wells at a position which is in the vicinity of an electrode for measuring dissolved oxygen concentration, measuring current from each electrode at a second time interval for a third time period, each time is obtained based upon each of the measured currents at which the maximum current is obtained, obtaining each current value within a fourth time period which starts from the time at which the maximum current is obtained, detecting drug sensitivity based upon the variation condition of each current value during the fourth time period. The method allows rapid drug susceptibility measurements.

Abstract: A method and apparatus wherein measurement current values output from a first oxygen sensor and a second oxygen sensor are time sequentially measured. Each moving average value is calculated from each sequential measurement current value. Each time differential value is calculated from the pair of each calculated moving average values, by least squares approximation. Then, drug susceptibility is measured based upon each calculated time differential value, so that drug the susceptibility measurement is performed quickly or accurately.

Abstract: A reaction tank (5) holds crushed cells comprising a pellicle of Bacillus midousuji cultured in the presence of a chlorinated aromatic compound such as dioxins and holds wastewater comprising a contaminated matter such as fly ash which comprises dioxins and which is produced by washing of a facility such as an incinerator. Air is supplied by a blower (6) to a matter held in the reaction tank (5). Accordingly, dioxins having three or more chlorine atoms in the contaminated matter can be decomposed, and the contaminated matter can be easily cleaned at a site where dioxins generate such as a washing or dismantling site of an incineration facility.

Abstract: Measurement current values output from a first oxygen sensor, a second oxygen sensor are time sequentially held, respectively, each moving average value is calculated from each time sequentially held measurement current values, each timely differential values is calculated from the pair of each calculated moving average value, by the least squares approximation, drug susceptibility is measured based upon each calculated timely differential value, so that drug susceptibility measurement is performed with a short time period and with accuracy.

Abstract: Microbe suspension is poured into each of the cells at a position which is in vicinity to the electrode for measurement of dissolved oxygen concentration, current from each electrode for measurement of dissolved oxygen concentration is measured at a second time interval for a third time period, each time is obtained based upon each of the measured currents at which the maximum current is obtained, each current value within a fourth time period which starts from the time at which the maximum current is obtained, drug sensitivity is detected based upon the variation condition of each current value during the fourth time period, rapid drug susceptibility measurement is realized as well.

Abstract: To provide a portable blood glucose determination apparatus and a determination method for either invasive or non-invasive measurement of glucose concentration in blood by optical observation excelling in measuring accuracy and reproducibility.

Abstract: A biologically pure culture of a microorganism is provided designated SH2A and deposited under ATCC Accession No. 55926, or a mutant derived therefrom. Further provided is a biologically pure culture of a microorganism designated SH2B and deposited under ATCC Accession No. 202050, or a mutant derived therefrom. A method of degrading an organic material such as sludge is carried out by treating the organic material with an effective, degrading amount of either SH2A or a mutant derived therefrom, or SH2B or a mutant derived therefrom. The microorganism designated SH2A or a mutant derived therefrom, or SH2B or a mutant derived therefrom, is grown by culturing the microorganism at a temperature and in a medium effective to promote growth of the microorganism.

Abstract: A biologically pure culture of a microorganism is provided designated SH2A and deposited under ATCC Accession No. 55926, or a mutant derived therefrom. Further provided is a biologically pure culture of a microorganism designated SH2B and deposited under ATCC Accession No. 202050, or a mutant derived therefrom. A method of degrading an organic material is carried out by treating the organic material with an effective, degrading amount of either SH2A or a mutant derived therefrom, or SH2B or a mutant derived therefrom. The microorganism designated SH2A or a mutant derived therefrom, or SH2B or a mutant derived therefrom, is grown by culturing the microorganism at a temperature and in a medium effective to promote growth of the microorganism.

Abstract: This invention provides a DNA oligomer having the sequence 5'GGACATAGGCTGATCTCTTAGC3' (SEQ ID NO: 1) and which is complementary to Campylobacter pylori 16S ribosomal RNA sequences, for use as a probe to detect Campylobacter pylori.This invention also provides DNA oligomers having the sequences 5'GCGCAATCAGCGTCAGGTAATG3' (SEQ ID NO: 2) and 5'GCTAAGAGATCAGCCTATGTCCC3' (SEQ ID NO: 3) and which are complementary to certain Campylobacter pylori 16S ribosomal RNA sequences, for use as polymerase chain reaction primers for the detection of Campylobacter pylori.This invention also provides a method for producing species-specific bacterial or protozoan DNA oligomers encoding 16S ribosomal RNA by means of the polymerase chain reaction for use as species-specific probes and PCR primers, and methods for detection and identification of bacteria and protozoa.Further, this invention provides a DNA oligomer having the sequence 5'ACGGGCGGTGTGTGC3' (SEQ ID NO: 4).