Patents by Inventor Stephan Christgau
Stephan Christgau has filed for patents to protect the following inventions. This listing includes patent applications that are pending as well as patents that have already been granted by the United States Patent and Trademark Office (USPTO).
-
Patent number: 6197564Abstract: A DNA construct encoding an enzyme(s) exhibiting xylanase activity, which enzyme is immunologically reactive with antibody raised against a purified xylanase derived from Aspergillus aculealus, CBS 101.43, recombinant vectors and cells comprising said construct and a method for producing said enzyme using said cell comprising said construct.Type: GrantFiled: December 22, 1998Date of Patent: March 6, 2001Assignee: Novo Nordisk A/SInventors: Lene Venke Kofod, MArkus Sakari Kauppinen, Stephan Christgau, Hans Peter Heldt-Hansen, Henrik Dalbøge, Lene Nonboe Andersen, Joan Qi Si, Tina Sejersgård Jacobsen, Niels Munk, Anette Müllertz
-
Patent number: 6190905Abstract: An isolated and purified enzyme exhibiting protease activity at a pH of 4-7 which exhibits protease in 5% hydrogen peroxide and which is encoded by a DNA sequence which hybridizes to a DNA sequence depicted in SEQ ID NO: 1 or 2. Methods are described for using the protease compositions in reducing vescosity, cleaning contact lenses, baking, and preparing animal feed.Type: GrantFiled: September 29, 1999Date of Patent: February 20, 2001Inventors: Henrik Dalbøge, Stephan Christgau, Lene Nonboe Andersen, Lene Venke Kofod, Markus Sakari Kauppinen, Jack Bech Nielsen, Claus Dambmann
-
Patent number: 6159718Abstract: An enzyme exhibiting polygalacturonase activity, which enzyme is immunologically reactive with an antibody raised against a purified polygalacturonase derived from Aspergillus aculeatus, CBS 101.43. The enzyme may be produced by recombinant DNA techniques and may be used for degradation of plant cell walls, for instance in the wine and juice production.Type: GrantFiled: May 29, 1998Date of Patent: December 12, 2000Assignee: Novo Nordisk A/SInventors: Henrik Dalboege, Lene Nonboe Andersen, Lene Venke Kofoed, Markus Sakari Kauppinen, Stephan Christgau, Hans Peter Heldt-Hansen, Torben Halkier
-
Patent number: 6140096Abstract: An enzyme having endo-1,3(4)-.beta.-glucanase activity is described which is encoded by the DNA sequence ATGTGGTCTCCCAAGGTTGCTGCTGCCGTCCTCGCCTTTGTTGGTGCTACCAACGCCT GGCAGCCCCCGACCTACAGCGGCTTCAACTTGGTCTGGACTGACACCTTCGCTGGCAACGGTGGCACTTCTCCT A ACCAGAACAACTGGAACATCATCACCGGAAACTTGAACGTCAACGCCGAGCAGGAGACCTACTCCTCCAGCAC C GCCAATGTTCAGCTCAGTGGTGGCAGCACCCTTCAGCTGGTCCCCTGGAGAGACAGCAGCAAGGGAACCAGCA C CTTTGGTGGCTGGACCTCCGGTCGTCTTGAGTCCAAGTACACATTCACTCCCGCGGCCGGCAAGGTCACCCGT CTT GAAGCCGCCATCCGCTTCGGCAGCAACGCTCAGGCCAACAAGCAGGGTATCTGGCCTGCTTTCTGGATGCTGGG T GACTCCCTCCGTCAACCGGGCGGCAGCTGGCCCAACTGTGGTGAGATCGACATCATGGAGACTGTCGACGGCC A GGCTACCGGCCACGGTACCCTTCACTGCGACGTCTACCCCGGCGGTATCTGCAACGAGGGTAACGGTATTGGA GG CCCTGTCAACATCGCCAACGTCAACGACTGGCACGCTTGGCGTGTTGAGATCGACCGCACTCCCAGCAGCTGGC A ATCCGAGACCCTCACCTGGTCCCTCGACGGCACCATCTACTTCCAGATCACTGGCTCTCGCATTGGCAACCAG GG CGTCTGGAACAACATTGCTCACAGCCCCCTCTTCTTCATTCTTAACGTTGCTGTCGGTGGCAACTGGCCTGGCA AC CCCAACAGCGCTACCCTCGATGGCTACGGAAGCATGATGGAGGTTGGCTACGTCGCTCAGTACTCTACCTAA (SEQ ID NO:3).Type: GrantFiled: June 17, 1998Date of Patent: October 31, 2000Assignee: Novo Nordisk A/SInventors: Lene Venke Kofod, Lene Nonboe Andersen, Markus Sakari Kauppinen, Stephan Christgau, Henrlk Dalb.o slashed.ge, Hans Sejr Olsen, Jens Breinholt
-
Patent number: 6080567Abstract: An enzyme exhibiting xylanase activity, which enzyme is immunologically reactive with antibody raised against a purified xylanase derived from Aspergillus aculeatus, CBS 101.43. The enzyme may be used for degrading plant cell wall components, e.g., in the preparation of feed, in baking, in the paper and pulp industry, and in connection with separation of wheat into starch and gluten.Type: GrantFiled: July 16, 1998Date of Patent: June 27, 2000Assignee: Novo Nordisk A/SInventors: Lene Venke Kofod, Markus Sakari Kauppinen, Stephan Christgau, Hans Peter Heldt-Hansen, Henrik Dalb.o slashed.ge, Lene Nonboe Andersen, Joan Qi Si, Tina Sejersg.ang.rd Jacobsen, Niels Munk, Anette Mullertz
-
Patent number: 6037161Abstract: The present invention provides an enzyme with acetyl esterase activity comprising the amino acid sequence IxFGDxYYT(SEQ ID NO: 1), in which x designates any amino acid residue. The enzyme exhibits activity towards acetylated xylan and acetylated mannan and may be used for modifying or degrading plant containing materials.Type: GrantFiled: November 3, 1998Date of Patent: March 14, 2000Assignee: Novo Nordisk A/SInventors: Stephan Christgau, Thomas Sandal, Markus Sakari Kauppinen, Torben Halkier, Henrik Dalb.o slashed.ge
-
Patent number: 6033900Abstract: Animal feed compositions and methods for treating one or more of soy, pea or rape-seed, or other material derived from Fabales or Cruciferaceae, with an enzyme having rhamnogalacturonase activity, wherein the enzyme having rhamnogalacturonase activity cleaves a rhamnogalacturonan backbone to produce rhamnose as a non-reducing end (RGase II) or cleaves a rhamnogalaturonan backbone to produce galacturonic acid as a non-reducing end.Type: GrantFiled: November 30, 1998Date of Patent: March 7, 2000Assignee: Novo Nordisk A/SInventors: Lene Venke Kofod, Lene Nonboe Andersen, Henrik Dalb.o slashed.ge, Markus Sakari Kauppinen, Stephan Christgau, Hans Peter Heldt-Hansen, Claus Christophersen, Per Munk Nielsen, Alphons Gerard Joseph Voragen, Hendrik Arie Schols
-
Patent number: 6022723Abstract: The present invention relates to an enzyme with .beta.-(1-6)-endoglucanase activity encoded by a DNA sequence, which DNA sequence a) comprises the DNA sequence shown in SEQ ID No. 3, or b) comprises an analogue of the DNA sequence shown in SEQ ID No. 3, which i) is homologous with the DNA sequences shown in or SEQ ID No. 3, and/or ii) hybridizes with the same oligonucleotide probe as the DNA sequence shown in SEQ ID No. 3, and/or iii) encodes a polypeptide which is homologous with the polypeptide encoded by a DNA sequence comprising the DNA sequence shown in SEQ ID No. 3, and/or iv) encodes a polypeptide which is immunologically reactive with an antibody raised against a purified .beta.-(1-6)-glucanase shown in SEQ ID No. 4 derived from Trichoderma harzianum, CBS 243.71.Type: GrantFiled: March 18, 1998Date of Patent: February 8, 2000Assignee: Novo Nordisk A/SInventors: Lene Venke Kofod, Lene Nonboe Andersen, Markus Sakari Kauppinen, Stephan Christgau, Henrik Dalb.o slashed.ge, Hans Sejr Olsen
-
Patent number: 5998190Abstract: An isolated and purified enzyme exhibiting protease activity at a pH of 4-7 which exhibits protease activity in 5% hydrogen peroxide and which is encoded by a DNA sequence which hybridizes to a DNA sequence depicted in SEQ ID NO. 1 or 2.Type: GrantFiled: November 12, 1998Date of Patent: December 7, 1999Assignee: Novo Nordisk A/SInventors: Henrik Dalb.o slashed.ge, Stephan Christgau, Lene Nonboe Andersen, Lene Venke Kofod, Markus Sakari Kauppinen, Jack Bech Nielsen, Claus Dambmann
-
Patent number: 5885819Abstract: An enzyme exhibiting xylanase activity, which enzyme is immunologically reactive with an antibody raised against a purified xylanase derived from Aspergillus aculeatus, CBS 101.43. The enzyme may be used for degrading plant cell wall components e.g. in the preparation of feed, in baking, in the paper and pulp industry and in connection with separation of wheat into starch and gluten.Type: GrantFiled: July 30, 1997Date of Patent: March 23, 1999Assignee: Novo Nordisk A/SInventors: Lene Venke Kofod, Markus Sakari Kauppinen, Stephan Christgau, Hans Peter Heldt-Hansen, Henrik Dalb.o slashed.ge, Lene Nonboe Andersen, Joan Qi Si, Tina Sejersg.ang.rd Jacobsen, Niels Munk, Anette Mullertz
-
Patent number: 5882911Abstract: The present invention relates to DNA sequences encoding a rhamnogalacturonase which comprises(a) the DNA sequence of nucleotides 64-1587 of SEQ ID NO:1;(b) a DNA sequence which hybridizes to the same probe as nucleotides 64-1587 of SEQ ID NO:1 under conditions of presoaking in 5.times.SSC and prehybridizing for 1 hour at -40.degree. C. in a solution of 5.times.SSC, 5.times.Denhardt's solution, 50 mM sodium phosphate, pH 6.8, and 50 mg of denatured sonicated calf thymus DNA, followed by hybridization in the same solution supplemented with 50 .mu.Ci 32-P-dCTP labelled probe for 18 h at -40.degree. C., followed by washing three times in 2.times.SSC, 0.2% SDS at 40.degree. C. for 30 minutes; or(c) a DNA sequence encoding an amino acid sequence having amino acids 20-527 of the sequence of SEQ ID NO;2.Type: GrantFiled: June 22, 1998Date of Patent: March 16, 1999Assignee: Novo Nordisk A/SInventors: Lene Venke Kofod, Lene Nonboe Andersen, Henrik Dalb.o slashed.ge, Markus Sakari Kauppinen, Stephan Christgau, Hans Peter Heldt-Hansen, Claus Christophersen, Per Munk Nielsen, Alphons Gerard Joseph Voragen, Hendrik Arie Schols
-
Patent number: 5874275Abstract: The present invention relates to polypeptides having mutanase activity and isolated nucleic acid sequences encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the nucleic acid sequences as well as methods for producing the polypeptides. The present invention further relates to oral cavity compositions and methods for degrading mutan.Type: GrantFiled: October 22, 1997Date of Patent: February 23, 1999Assignees: Novo Nordisk A/S, Novo Nordisk Biotech, Inc.Inventors: Randy M Berka, Stephan Christgau, Torben Halkier, Jeff Shuster, Claus Crone Fuglsang
-
Patent number: 5871966Abstract: A partial amino acid sequence of an endo-.beta.-1,4-glucanase obtainable by means of Aspergillus aculeatus is described, and also corresponding recombinant DNA sequences, vectors and transformed hosts. Use of the endo-.beta.- 1,4-glucanase or a pectinase preparation enriched with the endo-.beta.-1,4-glucanase for degradation or modification of plant cell walls is described.Type: GrantFiled: November 8, 1996Date of Patent: February 16, 1999Assignee: Novo Nordisk A/SInventors: Lene Venke Kofod, Lene Nonboe Andersen, Markus Sakari Kauppinen, Stephan Christgau, Henrik Dalb.o slashed.ge, Hans Sejr Olsen, Jens Breinholt
-
Patent number: 5858760Abstract: The nucleic acid sequence encoding a pectin lyase from Aspergillus aculeatus, CBS 101.43 and the corresponding amino acid sequence are disclosed. The nucleic acid is used to transform a host cell which is utilized in a method to make the pectin lyase. The catalytic properties and stability characteristics of the enzyme are reported. The enzyme is useful for the degradation of plant cell wall components.Type: GrantFiled: July 2, 1997Date of Patent: January 12, 1999Assignee: Novo Nordisk A/SInventors: Henrik Dalb.o slashed.ge, Lene Venke Kofod, Markus Sakari Kauppinen, Lene Nonboe Andersen, Stephan Christgau, Hans Peter Heldt-Hansen
-
Patent number: 5853702Abstract: The present invention relates to polypeptides having mutanase activity and isolated nucleic acid sequences encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the nucleic acid sequences as well as methods for producing the polypeptides. The present invention further relates to oral cavity compositions and methods for degrading mutan.Type: GrantFiled: February 7, 1997Date of Patent: December 29, 1998Assignees: Novo Nordisk A/S, Novo Nordisk Biotech, Inc.Inventors: Randy M. Berka, Stephan Christgau, Torben Halkier, Jeff Shuster, Claus Crone Fuglsang
-
Patent number: 5854050Abstract: A DNA construct comprising a DNA sequence encoding an enzyme exhibiting protease activity, which DNA sequence comprises the DNA sequence shown in SEQ ID No. 1 or 2 or an analog of any of these sequences being at least 80% homologous to the DNA sequence shown in SEQ ID No. 1 or 2. The proteases encoded by the DNA sequences have an acid pH optimum.Type: GrantFiled: February 1, 1996Date of Patent: December 29, 1998Assignee: Novo Nordisk A/SInventors: Henrik Dalb.o slashed.ge, Stephan Christgau, Lene Nonboe Andersen, Lene Venke Kofod, Markus Sakari Kauppinen, Jack Bech Nielsen, Claus Dambmann
-
Patent number: 5817499Abstract: DNA encoding an endoglucanase from Trichoderma harzianum is disclosed. The endoglucanase has activity toward mixed .beta.-1,3-1,4 glucans and is especially useful in brewing processes.Type: GrantFiled: January 3, 1996Date of Patent: October 6, 1998Assignee: Novo Nordisk A/SInventors: Henrik Dalb.o slashed.ge, Stephan Christgau, Lene Nonboe Andersen, Lene Venke Kofod, Markus Sakari Kauppinen
-
Patent number: 5811291Abstract: An enzyme exhibiting rhamnogalacturonase activity, capable of cleaving a rhamnogalacturonan backbone in such a manner that galacturonic acids are left as the non-reducing ends, and which exhibits activity on hairy regions from a soy bean material and/or on saponified hairy regions from a sugar beet material. The enzyme has the amino acid sequence of SEQ ID NO:2 and is encoded by the DNA sequence of SEQ ID NO:1.Type: GrantFiled: September 25, 1995Date of Patent: September 22, 1998Assignee: Novo Nordisk A/SInventors: Lene Venke Kofod, Lene Nonboe Andersen, Henrik Dalb.o slashed.ge, Markus Sakari Kauppinen, Stephan Christgau, Hans Peter Heldt-Hansen, Claus Christophersen, Per Munk Nielsen, Alphons Gerar Joseph Voragen, Hendrik Arie Schols
-
Patent number: 5795764Abstract: An enzyme exhibiting mannanase activity, which enzyme i) is immunologically reactive with an antibody raised against a purified mannanase derived from Aspergillus aculeatus, CBS 101.43; ii) is encoded by the DNA sequences shown in SEQ ID No. 1 or an analogue of said sequence, and/or; iii) comprises the amino acid sequence shown in SEQ ID No. 2 or a sequence being an least 70% homologous thereto. The enzyme may be used for various purposes for which degradation or modification of a plant or algal cell wall material is desirable.Type: GrantFiled: September 21, 1995Date of Patent: August 18, 1998Assignee: Novo Nordisk A/SInventors: Stephan Christgau, Lene Venke Kofod, Lene Nonboe Andersen, Sakari Kauppinen, Hans Peter Heldt-Hansen, Henrik Dalboege
-
Patent number: 5770406Abstract: The present invention relates to an enzyme with .beta.-(1-6)-endoglucanase activity encoded by a DNA sequence, which DNA sequence a) comprises the DNA sequence shown in SEQ ID No. 3, or b) comprises an analogue of the DNA sequence shown in SEQ ID No. 3, which i) is homologous with the DNA sequences shown in or SEQ ID No. 3, and/or ii) hybridizes with the same oligonucleotide probe as the DNA sequence shown in SEQ ID No. 3, and/or iii) encodes a polypeptide which is homologous with the polypeptide encoded by a DNA sequence comprising the DNA sequence shown in SEQ ID No. 3, and/or iv) encodes a polypeptide which is immunologically reactive with an antibody raised against a purified .beta.-(1-6)-glucanase shown in SEQ ID No. 4 derived from Trichoderma harzianum, CBS 243.71.Type: GrantFiled: November 8, 1996Date of Patent: June 23, 1998Inventors: Lene Venke Kofod, Lene Nonboe Andersen, Markus Sakari Kauppinen, Stephan Christgau, Henrik Dalb.o slashed.ge, Hans Sejr Olsen