Abstract: The disclosed patterned wavelength-selective material and process for making the patterned wavelength-selective material uses patterned applied adhesive and a structurally weak wavelength-selective material that includes portions that contact the adhesive and break to remain in contact with the adhesive. In one embodiment, the wavelength-selective material comprises an array of sections with cuts at least partially through a wavelength-selective film at each section secured to the adhesive. In another embodiment, the wavelength-selective film comprises a transfer stack of layers.

Abstract: This disclosure relates generally to nucleic acid aptamers especially useful for cell transduction, as well as to containers (such as bags) having surfaces comprising one or such aptamers, and to transductions methods using such aptamers and containers. One embodiment of the disclosure provides A DNA aptamer comprising a plurality of nucleotides, the DNA aptamer having at least 80% sequence identity with the sequence of SEQ ID NO: 1 (AAACTGCAGCGATTCATTAGTACGGCCTTT).

Abstract: The present application is directed to a sampling system for sampling a fluid from a vessel, where the sampling system includes a sterile dispenser assembly operatively connected to the vessel, the sterile dispenser assembly including a valve operatively connected to the vessel, a membrane, and a needle, and a detachable sterile sampling container assembly operatively connected to the sterile dispenser assembly, the detachable sterile sampling container assembly including a sampling container, a membrane attached to the sampling container, and a sampling container housing enclosing the sampling container, where the sampling container housing includes a compressible portion having a deflated configuration and an expanded configuration.

Abstract: Razors comprising a glide member comprising a low to nil level of hygroscopic components.

Abstract: A razor having a removable carrier for attaching one or more glide members which fits between the razor handle and cartridge head.

Abstract: A spatial RAM system uses the position of a data sensor to generate a clock pulse that is used to trigger data acquisition. As a consequence, the errors associated with time-based clock sampling are avoided. This enables more accurate sampling of data at locations desired in space and more easily allows for non-uniform sampling.

Abstract: A method, apparatus, and article for solving the year 2000 problem involves limited modifications in the data definition portions of the source code and compiler support for processing the modified source code. Fields in the source code that contain a year or date values are identified and, for each such field, the user selects an appropriate technique (for example, expansion, compression or windowing). The user modifies the data definition for each identified field, by adding new attributes to request the selected technique. The user then compiles the program and resolves any ambiguous references to the variables whose definitions were modified. This procedure is applied, module by module, and each processed module is merged into production, after testing, by using a compiler option to disable the use of the new attributes.

Abstract: A method, apparatus, and article for solving the year 2000 problem involves limited modifications in the data definition portions of the source code and compiler support for processing the modified source code. Fields in the source code that contain a year or date values are identified and, for each such field, the user selects an appropriate technique (for example, expansion, compression or windowing). The user modifies the data definition for each identified field, by adding new attributes to request the selected technique. The user then compiles the program and resolves any ambiguous references to the variables whose definitions were modified. This procedure is applied, module by module, and each processed module is merged into production, after testing, by using a compiler option to disable the use of the new attributes.

Abstract: A method, apparatus, and article for solving the year 2000 problem involves limited modifications in the data definition portions of the source code and compiler support for processing the modified source code. Fields in the source code that contain a year or date values are identified and, for each such field, the user selects an appropriate technique (for example, expansion, compression or windowing). The user modifies the data definition for each identified field, by adding new attributes to request the selected technique. The user then compiles the program and resolves any ambiguous references to the variables whose definitions were modified. This procedure is applied, module by module, and each processed module is merged into production, after testing, by using a compiler option to disable the use of the new attributes.

Abstract: A method, apparatus, and article for solving the year 2000 problem involves limited modifications in the data definition portions of the source code and compiler support for processing the modified source code. Fields in the source code that contain a year or date values are identified and, for each such field, the user selects an appropriate technique (for example, expansion, compression or windowing). The user modifies the data definition for each identified field, by adding new attributes to request the selected technique. The user then compiles the program and resolves any ambiguous references to the variables whose definitions were modified. This procedure is applied, module by module, and each processed module is merged into production, after testing, by using a compiler option to disable the use of the new attributes.

Abstract: A method, apparatus, and article for solving the year 2000 problem involves limited modifications in the data definition portions of the source code and compiler support for processing the modified source code. Fields in the source code that contain a year or date values are identified and, for each such field, the user selects an appropriate technique (for example, expansion, compression or windowing). The user modifies the data definition for each identified field, by adding new attributes to request the selected technique. The user then compiles the program and resolves any ambiguous references to the variables whose definitions were modified. This procedure is applied, module by module, and each processed module is merged into production, after testing, by using a compiler option to disable the use of the new attributes.

Abstract: A method, apparatus, and article for solving the year 2000 problem involves limited modifications in the data definition portions of the source code and compiler support for processing the modified source code. Fields in the source code that contain a year or date values are identified and, for each such field, the user selects an appropriate technique (for example, expansion, compression or windowing). The user modifies the data definition for each identified field, by adding new attributes to request the selected technique. The user then compiles the program and resolves any ambiguous references to the variables whose definitions were modified. This procedure is applied, module by module, and each processed module is merged into production, after testing, by using a compiler option to disable the use of the new attributes.

Abstract: A method, apparatus, and article for solving the year 2000 problem involves limited modifications in the data definition portions of the source code and compiler or interpreter support for processing the modified source code. Fields in the source code that contain a year or date values are identified and, for each such field, the user selects an appropriate technique (for example, expansion, compression or windowing). The user modifies the data definition for each identified field, by adding new attributes to request the selected technique. The user then compiles or interprets the program and resolves any ambiguous references to the variables whose definitions were modified. This procedure is applied, module by module, and each processed module is merged into production, after testing, by using a compiler option to disable the use of the new attributes.

Abstract: A method, apparatus, and article for solving the year 2000 problem involves limited modifications in the data definition portions of the source code and compiler support for processing the modified source code. Fields in the source code that contain a year or date values are identified and, for each such field, the user selects an appropriate technique (for example, expansion, compression or windowing). The user modifies the data definition for each identified field, by adding new attributes to request the selected technique. The user then compiles the program and resolves any ambiguous references to the variables whose definitions were modified. This procedure is applied, module by module, and each processed module is merged into production, after testing, by using a compiler option to disable the use of the new attributes.

Abstract: Processing an event signifying a condition in a computer system is described. The computer system maintains an invocation stack which includes a plurality of stack frames. Such event processing operates by selecting a stack frame from the invocation stack, and then determining whether a user specified event processing procedure capable of processing the event has been registered with the selected stack frame. If a user specified event processing procedure has been so registered, then the event is processed using the user specified event processing procedure as specified by a set of rules and options defined for the disposition and/or processing of the specific event. Optionally, it is then determined whether a language specific event processing procedure capable of processing the event has been registered with the selected stack frame.

Abstract: A particulate co-processed unattrited microcrystalline cellulose:hydrocolloid composition wherein the respective components are present in a weight ratio of from about 99:1 to 70:30. The composition is useful as a spheronizing agent for producing spheroids of uniform size and sphericity and having high drug loadings. The composition is produced by drying a slurry of the microcrystalline cellulose in an aqueous solution of the hydrocolloid. The preferred hydrocolloid is methylcellulose.

Abstract: A solid dosage form, such as a pharmaceutical tablet, containing a rapidly hydratable konjac glucomannan sustained release excipient such as clarified konjac, cryogenically ground konjac and plasticized konjac. The method of making the tablets by compressing excipient and pharmaceutically active ingredient as dry powders.

Abstract: A water dispersible polymeric film-forming particulate composition for use in coating pharmaceuticals and foods or the like, produced by freeze-drying an aqueous solution of water-soluble cellulose acetate as the film-forming polymer, a plasticizer, and optionally a pigment, is described. The product mixes readily with water to form an aqueous dispersion which is applied in the conventional manner to solid pharmaceutical forms.

Abstract: A water dispersible film-forming particulate composition for use in coating pharmaceuticals and foods or the like, produced by freeze-drying an aqueous solution of a water-soluble polymer, a plasticizer, and optionally a pigment, is described. The product mixes readily with water to form an aqueous dispersion which is applied in the conventional manner to solid pharmaceutical forms.

Abstract: A water-dispersible, particulate film-forming composition is produced by blending a mixture of particles of water-soluble cellulose acetate; pigment particles, a plasticizer for the water-soluble cellulose acetate, and a surfactant. The composition is useful as a film-forming material for coating solid pharmaceutical forms.