Patents by Inventor Thomas Wheatley

Thomas Wheatley has filed for patents to protect the following inventions. This listing includes patent applications that are pending as well as patents that have already been granted by the United States Patent and Trademark Office (USPTO).

  • Patent number: 12001038
    Abstract: The disclosed patterned wavelength-selective material and process for making the patterned wavelength-selective material uses patterned applied adhesive and a structurally weak wavelength-selective material that includes portions that contact the adhesive and break to remain in contact with the adhesive. In one embodiment, the wavelength-selective material comprises an array of sections with cuts at least partially through a wavelength-selective film at each section secured to the adhesive. In another embodiment, the wavelength-selective film comprises a transfer stack of layers.
    Type: Grant
    Filed: July 23, 2019
    Date of Patent: June 4, 2024
    Assignee: 3M Innovative Properties Company
    Inventors: Kui Chen-Ho, Douglas S. Dunn, Tien Yi T. H. Whiting, Bryan T. Whiting, Taylor J. Kobe, Anthony F. Schultz, Duane D. Fansler, Jonah Shaver, John A. Wheatley, Susannah C. Clear, Daniel J. Theis, John T. Strand, Thomas J. Metzler, Kevin W. Gotrik, Scott J. Jones
  • Publication number: 20240167019
    Abstract: This disclosure relates generally to nucleic acid aptamers especially useful for cell transduction, as well as to containers (such as bags) having surfaces comprising one or such aptamers, and to transductions methods using such aptamers and containers. One embodiment of the disclosure provides A DNA aptamer comprising a plurality of nucleotides, the DNA aptamer having at least 80% sequence identity with the sequence of SEQ ID NO: 1 (AAACTGCAGCGATTCATTAGTACGGCCTTT).
    Type: Application
    Filed: November 20, 2023
    Publication date: May 23, 2024
    Inventors: Katie Campbell, Natalie Fekete, Jonathon Wheatley, Jessica Rodriguez, Maranda Gibb, Albert M. Liao, Thomas Caltagirone
  • Patent number: 11987784
    Abstract: The present application is directed to a sampling system for sampling a fluid from a vessel, where the sampling system includes a sterile dispenser assembly operatively connected to the vessel, the sterile dispenser assembly including a valve operatively connected to the vessel, a membrane, and a needle, and a detachable sterile sampling container assembly operatively connected to the sterile dispenser assembly, the detachable sterile sampling container assembly including a sampling container, a membrane attached to the sampling container, and a sampling container housing enclosing the sampling container, where the sampling container housing includes a compressible portion having a deflated configuration and an expanded configuration.
    Type: Grant
    Filed: June 16, 2021
    Date of Patent: May 21, 2024
    Assignee: SAINT-GOBAIN PERFORMANCE PLASTICS CORPORATION
    Inventors: Clemens E. Zoellner, Thomas R. Nixon, Jonathon Wheatley
  • Publication number: 20140366381
    Abstract: Razors comprising a glide member comprising a low to nil level of hygroscopic components.
    Type: Application
    Filed: June 5, 2014
    Publication date: December 18, 2014
    Inventors: Nicola Jacqueline Phipps, Alun Thomas Wheatley, Barry Keith Rockell, Michael John Moloney
  • Publication number: 20140366361
    Abstract: A razor having a removable carrier for attaching one or more glide members which fits between the razor handle and cartridge head.
    Type: Application
    Filed: June 5, 2014
    Publication date: December 18, 2014
    Inventors: Kevin James Wain, Barry Keith Rockell, Alun Thomas Wheatley, Michael John Moloney
  • Patent number: 6266581
    Abstract: A spatial RAM system uses the position of a data sensor to generate a clock pulse that is used to trigger data acquisition. As a consequence, the errors associated with time-based clock sampling are avoided. This enables more accurate sampling of data at locations desired in space and more easily allows for non-uniform sampling.
    Type: Grant
    Filed: May 9, 1997
    Date of Patent: July 24, 2001
    Assignee: The United States of America as represented by the Secretary of Commerce
    Inventors: Thomas Wheatley, E. Clayton Teague
  • Patent number: 6237140
    Abstract: A method, apparatus, and article for solving the year 2000 problem involves limited modifications in the data definition portions of the source code and compiler support for processing the modified source code. Fields in the source code that contain a year or date values are identified and, for each such field, the user selects an appropriate technique (for example, expansion, compression or windowing). The user modifies the data definition for each identified field, by adding new attributes to request the selected technique. The user then compiles the program and resolves any ambiguous references to the variables whose definitions were modified. This procedure is applied, module by module, and each processed module is merged into production, after testing, by using a compiler option to disable the use of the new attributes.
    Type: Grant
    Filed: October 20, 1999
    Date of Patent: May 22, 2001
    Assignee: International Business Machines Corporation
    Inventors: William Augustus Carter, Alan Roeder Elderon, Timothy David Magee, Mark David Nicholas, Henry Y. Saade, Grant Sutherland, William Nicholas John Tindall, Jeffrey Ramesh Urs, Timothy Edward Weinmann, Michael Thomas Wheatley
  • Patent number: 6233728
    Abstract: A method, apparatus, and article for solving the year 2000 problem involves limited modifications in the data definition portions of the source code and compiler support for processing the modified source code. Fields in the source code that contain a year or date values are identified and, for each such field, the user selects an appropriate technique (for example, expansion, compression or windowing). The user modifies the data definition for each identified field, by adding new attributes to request the selected technique. The user then compiles the program and resolves any ambiguous references to the variables whose definitions were modified. This procedure is applied, module by module, and each processed module is merged into production, after testing, by using a compiler option to disable the use of the new attributes.
    Type: Grant
    Filed: April 17, 1998
    Date of Patent: May 15, 2001
    Assignee: International Business Machines Corporation
    Inventors: William Augustus Carter, Alan Roeder Elderon, Timothy David Magee, Mark David Nicholas, Henry Y. Saade, Grant Sutherland, William Nicholas John Tindall, Jeffrey Ramesh Urs, Timothy Edward Weinmann, Michael Thomas Wheatley
  • Patent number: 6226791
    Abstract: A method, apparatus, and article for solving the year 2000 problem involves limited modifications in the data definition portions of the source code and compiler support for processing the modified source code. Fields in the source code that contain a year or date values are identified and, for each such field, the user selects an appropriate technique (for example, expansion, compression or windowing). The user modifies the data definition for each identified field, by adding new attributes to request the selected technique. The user then compiles the program and resolves any ambiguous references to the variables whose definitions were modified. This procedure is applied, module by module, and each processed module is merged into production, after testing, by using a compiler option to disable the use of the new attributes.
    Type: Grant
    Filed: March 27, 1998
    Date of Patent: May 1, 2001
    Assignee: International Business Machines Corporation
    Inventors: William Augustus Carter, Alan Roeder Elderon, Timothy David Magee, Mark David Nicholas, Henry Y. Saade, Grant Sutherland, William Nicholas John Tindall, Jeffrey Ramesh Urs, Timothy Edward Weinmann, Michael Thomas Wheatley
  • Patent number: 6185571
    Abstract: A method, apparatus, and article for solving the year 2000 problem involves limited modifications in the data definition portions of the source code and compiler support for processing the modified source code. Fields in the source code that contain a year or date values are identified and, for each such field, the user selects an appropriate technique (for example, expansion, compression or windowing). The user modifies the data definition for each identified field, by adding new attributes to request the selected technique. The user then compiles the program and resolves any ambiguous references to the variables whose definitions were modified. This procedure is applied, module by module, and each processed module is merged into production, after testing, by using a compiler option to disable the use of the new attributes.
    Type: Grant
    Filed: April 17, 1998
    Date of Patent: February 6, 2001
    Assignee: International Business Machines Corporation
    Inventors: William Augustus Carter, Alan Roeder Elderon, Timothy David Magee, Mark David Nicholas, Henry Y. Saade, Grant Sutherland, William Nicholas John Tindall, Jeffrey Ramesh Urs, Timothy Edward Weinmann, Michael Thomas Wheatley
  • Patent number: 6081655
    Abstract: A method, apparatus, and article for solving the year 2000 problem involves limited modifications in the data definition portions of the source code and compiler support for processing the modified source code. Fields in the source code that contain a year or date values are identified and, for each such field, the user selects an appropriate technique (for example, expansion, compression or windowing). The user modifies the data definition for each identified field, by adding new attributes to request the selected technique. The user then compiles the program and resolves any ambiguous references to the variables whose definitions were modified. This procedure is applied, module by module, and each processed module is merged into production, after testing, by using a compiler option to disable the use of the new attributes.
    Type: Grant
    Filed: November 14, 1997
    Date of Patent: June 27, 2000
    Assignee: International Business Machines Corporation
    Inventors: William Augustus Carter, Alan Roeder Elderon, Timothy David Magee, Mark David Nicholas, Henry Y. Saade, Grant Sutherland, William Nicholas John Tindall, Jeffrey Ramesh Urs, Timothy Edward Weinmann, Michael Thomas Wheatley
  • Patent number: 6078734
    Abstract: A method, apparatus, and article for solving the year 2000 problem involves limited modifications in the data definition portions of the source code and compiler support for processing the modified source code. Fields in the source code that contain a year or date values are identified and, for each such field, the user selects an appropriate technique (for example, expansion, compression or windowing). The user modifies the data definition for each identified field, by adding new attributes to request the selected technique. The user then compiles the program and resolves any ambiguous references to the variables whose definitions were modified. This procedure is applied, module by module, and each processed module is merged into production, after testing, by using a compiler option to disable the use of the new attributes.
    Type: Grant
    Filed: July 23, 1997
    Date of Patent: June 20, 2000
    Assignee: International Business Machines Corporation
    Inventors: William Augustus Carter, Alan Roeder Elderon, Timothy David Magee, Mark David Nicholas, Henry Y. Saade, Grant Sutherland, William Nicholas John Tindall, Jeffrey Ramesh Urs, Timothy Edward Weinmann, Michael Thomas Wheatley
  • Patent number: 6064817
    Abstract: A method, apparatus, and article for solving the year 2000 problem involves limited modifications in the data definition portions of the source code and compiler or interpreter support for processing the modified source code. Fields in the source code that contain a year or date values are identified and, for each such field, the user selects an appropriate technique (for example, expansion, compression or windowing). The user modifies the data definition for each identified field, by adding new attributes to request the selected technique. The user then compiles or interprets the program and resolves any ambiguous references to the variables whose definitions were modified. This procedure is applied, module by module, and each processed module is merged into production, after testing, by using a compiler option to disable the use of the new attributes.
    Type: Grant
    Filed: November 14, 1997
    Date of Patent: May 16, 2000
    Assignee: International Business Machines Corporation
    Inventors: William Augustus Carter, Alan Roeder Elderon, Timothy David Magee, Mark David Nicholas, Henry Y. Saade, Grant Sutherland, William Nicholas John Tindall, Jeffrey Ramesh Urs, Timothy Edward Weinmann, Michael Thomas Wheatley
  • Patent number: 6002873
    Abstract: A method, apparatus, and article for solving the year 2000 problem involves limited modifications in the data definition portions of the source code and compiler support for processing the modified source code. Fields in the source code that contain a year or date values are identified and, for each such field, the user selects an appropriate technique (for example, expansion, compression or windowing). The user modifies the data definition for each identified field, by adding new attributes to request the selected technique. The user then compiles the program and resolves any ambiguous references to the variables whose definitions were modified. This procedure is applied, module by module, and each processed module is merged into production, after testing, by using a compiler option to disable the use of the new attributes.
    Type: Grant
    Filed: November 14, 1997
    Date of Patent: December 14, 1999
    Assignee: International Business Machines Corporation
    Inventors: William Augustus Carter, Alan Roeder Elderon, Timothy David Magee, Mark David Nicholas, Henry Y. Saade, Grant Sutherland, William Nicholas John Tindall, Jeffrey Ramesh Urs, Timothy Edward Weinmann, Michael Thomas Wheatley
  • Patent number: 5754855
    Abstract: Processing an event signifying a condition in a computer system is described. The computer system maintains an invocation stack which includes a plurality of stack frames. Such event processing operates by selecting a stack frame from the invocation stack, and then determining whether a user specified event processing procedure capable of processing the event has been registered with the selected stack frame. If a user specified event processing procedure has been so registered, then the event is processed using the user specified event processing procedure as specified by a set of rules and options defined for the disposition and/or processing of the specific event. Optionally, it is then determined whether a language specific event processing procedure capable of processing the event has been registered with the selected stack frame.
    Type: Grant
    Filed: May 12, 1997
    Date of Patent: May 19, 1998
    Assignee: International Business Machines Corporation
    Inventors: Stephen Sherman Miller, Timothy William Osborn, Robert Milton Smith, II, Michael Thomas Wheatley
  • Patent number: 5725886
    Abstract: A particulate co-processed unattrited microcrystalline cellulose:hydrocolloid composition wherein the respective components are present in a weight ratio of from about 99:1 to 70:30. The composition is useful as a spheronizing agent for producing spheroids of uniform size and sphericity and having high drug loadings. The composition is produced by drying a slurry of the microcrystalline cellulose in an aqueous solution of the hydrocolloid. The preferred hydrocolloid is methylcellulose.
    Type: Grant
    Filed: September 26, 1994
    Date of Patent: March 10, 1998
    Assignee: FMC Corporation
    Inventors: David F. Erkoboni, Scott A. Fiore, Thomas A. Wheatley
  • Patent number: 5486364
    Abstract: A solid dosage form, such as a pharmaceutical tablet, containing a rapidly hydratable konjac glucomannan sustained release excipient such as clarified konjac, cryogenically ground konjac and plasticized konjac. The method of making the tablets by compressing excipient and pharmaceutically active ingredient as dry powders.
    Type: Grant
    Filed: August 15, 1994
    Date of Patent: January 23, 1996
    Assignee: FMC Corporation
    Inventors: Victor L. King, Thomas A. Wheatley, David F. Erkoboni
  • Patent number: 5258436
    Abstract: A water dispersible polymeric film-forming particulate composition for use in coating pharmaceuticals and foods or the like, produced by freeze-drying an aqueous solution of water-soluble cellulose acetate as the film-forming polymer, a plasticizer, and optionally a pigment, is described. The product mixes readily with water to form an aqueous dispersion which is applied in the conventional manner to solid pharmaceutical forms.
    Type: Grant
    Filed: September 23, 1991
    Date of Patent: November 2, 1993
    Assignee: FMC Corporation
    Inventors: Thomas A. Wheatley, Clayton I. Bridges, Jr., Carl R. Steuernagel
  • Patent number: 5248516
    Abstract: A water dispersible film-forming particulate composition for use in coating pharmaceuticals and foods or the like, produced by freeze-drying an aqueous solution of a water-soluble polymer, a plasticizer, and optionally a pigment, is described. The product mixes readily with water to form an aqueous dispersion which is applied in the conventional manner to solid pharmaceutical forms.
    Type: Grant
    Filed: September 12, 1991
    Date of Patent: September 28, 1993
    Assignee: FMC Corporation
    Inventors: Thomas A. Wheatley, Clayton I. Bridges, Jr., Carl R. Steuernagel
  • Patent number: 5206030
    Abstract: A water-dispersible, particulate film-forming composition is produced by blending a mixture of particles of water-soluble cellulose acetate; pigment particles, a plasticizer for the water-soluble cellulose acetate, and a surfactant. The composition is useful as a film-forming material for coating solid pharmaceutical forms.
    Type: Grant
    Filed: February 26, 1990
    Date of Patent: April 27, 1993
    Assignee: FMC Corporation
    Inventors: Thomas A. Wheatley, Clayton I. Bridges, Jr., Carl R. Steuernagel