Abstract: Forced expression of a handful of transcription factors (TFs) can induce conversion between cell identities; however, the extent to which TFs can alter cell identity has not been systematic ally assessed. Here, we assembled a “human TFome,” a comprehensive expression library of 1,578 human TF clones with fall coverage of the major TF families. By systematically screening the human TFome, we identified many individual TFs that induce loss of human-induced-pluripotent-stem-cell (hiPSC) identity, suggesting a pervasive ability for TFs to alter cell identity. Using large-scale computational cell type classification trained on thousands of tissue expression pantiles, we identified cell types generated by these TFs with high efficiency and speed, without additional selections or mechanical perturbations. TF expression in adult human tissues only correlated with some of the cell lineage generated, suggesting more complexity than observation studies can explain.

Abstract: Forced expression of a handful of transcription factors (TFs) can induce conversions between cell identities; however, the extent to which TFs can alter cell identity has not been systematically assessed. Here, we assembled a human TFome, a comprehensive expression library of 1,578 human TF clones with full coverage of the major TF families. By systematically screening the human TFome, we identified 77 individual TFs that induce loss of human-induced-pluripotent-stem-cell (hiPSC) identity, suggesting a pervasive ability for TFs to alter cell identity. Using large-scale computational cell type classification trained on thousands of tissue expression profiles, we identified cell types generated by these TFs with high efficiency and speed, without additional selections or mechanical perturbations. TF expression in adult human tissues only correlated with some of the cell lineage generated, suggesting more complexity than observation studies can explain.

Abstract: A method for producing induced photoreceptor cells from an initial cell is provided, the method includes providing one or more transcription factors (TFs) including at least GON4L to the initial cell. In some versions, the initial cell is a human induced pluripotent stem cell (iPSC). In other embodiments the method includes providing the TFs OTX2 and/or NEUROD1 to the initial cell. Cells produced and obtainable by the method are also provided, the use of these cells as a medicament in the treatment of retinopathy, vectors for inducing the photoreceptor cells and combinations of transcription factors intended for this use.

Abstract: The present invention relates to the use of an isolated nucleic acid molecule comprising a nucleotide sequence coding for a hyperpolarizing light-gated ion channel or pump gene from an archeon or for a light-active fragment of said gene, or the nucleotide sequence complementary to said nucleotide sequence, for treating or ameliorating blindness. The light-gated ion channel or pump gene can be a halorhodopsin gene.

Abstract: Forced expression of a handful of transcription factors (TFs) can induce conversions between cell identities; however, the extent to which TFs can alter cell identity has not been systematically assessed. Here, we assembled a “human TFome,” a comprehensive expression library of 1,578 human TF clones with full coverage of the major TF families. By systematically screening the human TFome, we identified many individual TFs that induce loss of human-induced-pluripotent-stem-cell (hiPSC) identity, suggesting a pervasive ability for TFs to alter cell identity. Using large-scale computational cell type classification trained on thousands of tissue expression profiles, we identified cell types generated by these TFs with high efficiency and speed, without additional selections or mechanical perturbations. TF expression in adult human tissues only correlated with some of the cell lineage generated, suggesting more complexity than observation studies can explain.

Abstract: Forced expression of a handful of transcription factors (TFs) can induce conversions between cell identities; however, the extent to which TFs can alter cell identity has not been systematically assessed. Here, we assembled a human TFome, a comprehensive expression library of 1,578 human TF clones with full coverage of the major TF families. By systematically screening the human TFome, we identified 77 individual TFs that induce loss of human-induced-pluripotent-stem-cell (hiPSC) identity, suggesting a pervasive ability for TFs to alter cell identity. Using large-scale computational cell type classification trained on thousands of tissue expression profiles, we identified cell types generated by these TFs with high efficiency and speed, without additional selections or mechanical perturbations. TF expression in adult human tissues only correlated with some of the cell lineage generated, suggesting more complexity than observation studies can explain.

Abstract: The present inventions relates to isolated nucleic acid molecules comprising a nucleotide sequence coding for miRNA-182 (uuuggcaaugguagaacucacacu or ugguucuagacuugccaacua), miRNA-96 (uuuggcacuagcacauuuuugcu or aaucaugugcagugccaauaug) and/or miRNA-183 (uauggcacugguagaauucacu or gugaauuaccgaagggccauaa) for use in treating or ameliorating a ciliopathy and/or a photoreceptor dysfunction.

Abstract: The present invention relates to the use of an isolated nucleic acid molecule comprising a nucleotide sequence coding for a hyperpolarizing light-gated ion channel or pump gene from an archeon or for a light-active fragment of said gene, or the nucleotide sequence complementary to said nucleotide sequence, for treating or ameliorating blindness. The light-gated ion channel or pump gene can be a halorhodopsin gene.

Abstract: The present inventions relates to the use of an isolated nucleic acid molecule comprising a nucleotide sequence coding for a hyperpolarizing light-gated ion channel or pump gene from an archeon or for a light-active fragment of said gene, or the nucleotide sequence complementary to said nucleotide sequence, for treating or ameliorating blindness. The light-gated ion channel or pump gene can be a halorhodopsin gene.

Abstract: The present inventions relates to isolated nucleic acid molecules comprising a nucleotide sequence coding for mi RNA-182 (uuuggcaaugguagaacucacacu or ugguucuagacuugccaacua), miRNA-96 (uuuggcacuagcacauuuuugcu or aaucaugugcagugccaauaug) and/or mi RNA-183 (uauggcacugguagaauucacu or gugaauuaccgaagggccauaa) for use in treating or ameliorating a ciliopathy and/or a photoreceptor dysfunction.

Abstract: The present inventions relates to the use of an isolated nucleic acid molecule comprising a nucleotide sequence coding for a hyperpolarizing light-gated ion channel or pump gene from an archeon or for a light-active fragment of said gene, or the nucleotide sequence complementary to said nucleotide sequence, for treating or ameliorating blindness. The light-gated ion channel or pump gene can be a halorhodopsin gene.

Abstract: The present inventions relates to the use of an isolated nucleic acid molecule comprising a nucleotide sequence coding for a hyperpolarizing light-gated ion channel or pump gene from an archeon or for a light-active fragment of said gene, or the nucleotide sequence complementary to said nucleotide sequence, for treating or ameliorating blindness. The light-gated ion channel or pump gene can be a halorhodopsin gene.

Abstract: The present invention provides an organotypic system comprising a portion of a retina containing live cells in a cultured in medium, wherein photosensitivity has been restored in at least some of said live cells. Methods of use thereof are also provided.