Abstract: A display apparatus includes: a display surface that displays information; and a display unit that, in response to a motion to move or place a mobile information terminal closer to or on the display surface, displays a first operation in which a first image is moved from the mobile information terminal to the display surface and displayed on the display surface, or a second operation in which a second image displayed on the display surface is moved from the display surface to the mobile information terminal.

Abstract: Example implementations described herein are directed to systems and methods for anomaly detection through using a segmentation process and an object detection process on images received through a camera system. The segmentation process and object detection process are then matched to detected additive anomalies (e.g., objects added to the environment) and subtractive anomalies (e.g., objects missing from the environment). Based on the type of anomaly detected as well as the underlying object, notifications can be dispatched to the user of the environment or the administrator of the system.

Abstract: A display control apparatus includes a controller. The controller controls a bendable display to display a first screen if the display is deformed in a state where a specific application program is in a first state. The controller controls the display to display a second screen, which is different from the first screen, if the display is deformed in a state where the specific application program is in a second state, which is different from the first state.

Abstract: A message providing device includes: a reception unit that receives, for each user, a request for a registration of an association between (i) a software robot program operating on a message service for an exchange of messages among users and exchanging messages with the user and (ii) an external device; and a registration unit that provides a single user with plural software robot programs in each of which operation setting information of the software robot program is preset, and registers an external device in each of the plural software robot programs in association with each other according to the request from the user.

Abstract: A message providing device includes: a receiver; and a controller. At least first and second operation modes are operations of a software robot program. The program operates on a service exchanging messages between users. In the first mode, a specific service is executed upon reception of a message or a sticker. In the second mode, the specific service is not executed even if the message or the sticker is received. The receiver receives the message or the sticker from the user. When the received message is a first specific message or the received sticker is a first specific sticker, the controller switches the first mode to the second. When the received message is a second specific message different from the first or the received sticker is a second specific sticker which is different from the first, the controller switches the second mode to the first.

Abstract: There is provided a message providing apparatus including a receiver configured to receive a service request message for a software robot program that operates on a message service exchanging messages between users and that exchanges messages with the users, a usage right granting unit configured to grant a usage right to a user who has performed a specific operation on the software robot program, a permission information providing unit configured to provide service permission information to the user to whom the usage right is granted, and a controller configured to, when the receiver receives the service request message, control execution and non-execution of a service according to presence or absence of the service permission information associated with the service request message.

Abstract: A message providing device includes a receiving section that receives a registration request for setting information regarding an operation of a software robot program for each user, the software robot program operating on a message service in which a message is transmitted and received between users, to transmit and receive the message to and from a user, a registration section that registers setting information for a first user in association with identification information of the first user, in response to the registration request from the first user, and a control section that performs control such that at least a portion of the registered setting information for the first user is registered as setting information for a second user in association with identification information of the second user, corresponding to transmission and reception of a message between the first user or the second user, and the software robot program.

Abstract: A message providing device includes a receiving section that receives a registration request for an association of a software robot program with an external device for each user, the software robot program operating on a message service in which a message is transmitted and received between users, to transmit and receive the message to and from a user, and a registration section that provides plural same software robot programs for one user and registers one or plural different external devices from each other in association with each of the plural same software robot programs in accordance with the request from the user.

Abstract: An image reading apparatus includes: a reading unit that reads an image of a document placed on a platen for placing documents; and a display unit that displays part of the image of the document read by the reading unit in a range adjacent to a range, in which the document is placed, of the platen.

Abstract: A display apparatus includes: a reading unit that reads information; and a display unit that, in response to an operation of moving a medium closer to a display surface or placing the medium on the display surface, displays on the display surface guidance information that guides a position, at which information associated with the medium is readable by the reading unit, on the display surface.

Abstract: A display apparatus includes: a display surface that displays information; and a display unit that, in response to a motion to move or place a mobile information terminal closer to or on the display surface, displays a first operation in which a first image is moved from the mobile information terminal to the display surface and displayed on the display surface, or a second operation in which a second image displayed on the display surface is moved from the display surface to the mobile information terminal.

Abstract: A display apparatus includes: a first display unit that displays a plurality of display elements on a first display surface, the first display surface being not touch-sensitive; and a second display unit that displays a specific display element on a second display surface, the specific display element being selected from the plurality of display elements displayed on the first display surface, by an operation performed on the second display surface.

Abstract: A surface of a fiber constituting a polyphenylene sulfide woven fabric contains a hydrophilic group and the oxygen content of the surface of the fiber is 15% by weight or more. The hydrophilic group comprises a carbon-oxygen group and a sulfur-oxygen group, the carbon-oxygen group being at least one of a carboxyl group, a carbonyl group and an aldehyde group. The content of the carbon-oxygen group is 62 to 72% of the total number of the groups in the surface of the fiber, and the content of the sulfur-oxygen group is 6 to 15% of the total number of the groups in the surface of the fiber. The polyphenylene sulfide woven fabric for water electrolysers has good hydrophilicity, high air tightness characteristics, also has characteristics of simple process, energy saving, and low environmental pollution.

Abstract: A system and a method for determining/predicting a tapping time for a metal melt in an electric arc furnace (EAF), at least one electrode is provided for melting the metal melt until it reach a target tapping temperature, the EAF further includes a slag and smoke layer on the surface of the metal melt, wherein an electromagnetic stirrer is provided for stirring the metal melt.

Abstract: A method of fabricating a pressure sensor is disclosed. Initially, a first metal is deposited on top of a substrate, and the first metal is patterned accordingly. A PVDF-TrFE nano fiber is then deposited on top of the first metal layer, and the PVDF-TrFE nano fiber is etched. A second metal layer is subsequently deposited on top of the PVDF-TrFE nano fiber, and the second metal layer is etched to form a pressure sensor.

Abstract: A system and a method for determining/predicting a tapping time for a metal melt in an electric arc furnace (EAF), at least one electrode is provided for melting the metal melt until it reach a target tapping temperature, the EAF further includes a slag and smoke layer on the surface of the metal melt, wherein an electromagnetic stirrer is provided for stirring the metal melt.

Abstract: Provided herein are forward-imaging tunable lens systems and probes. A lens assembly is disclosed herein and comprises at least one tunable lens.

Abstract: A method and device for controlling a melting and refining process in an electric arc furnace for melting a metal, wherein the electric arc furnace includes molten and solid metal and a slag layer on the surface of the molten metal, wherein an electromagnetic stirrer is arranged for stirring the molten metal. The method includes calculating/determining masses of the molten and solid metal at a point of time, wherein the calculation is based on initial values of the molten and solid metal, an arc power supplied to the electric arc furnace, and temperatures of the molten and solid metal, determining a stirring power based on the calculated/determined masses, and supplying the determined stirring power to the electromagnetic stirrer.

Abstract: Disclosed is a control system for a melting process in an electric arc furnace for melting a metallic material that minimizes desired process properties such as the melting time or the total power consumption of the melting process. The system includes a processing unit adapted for receiving or collecting measured data of at least one process variable, determining the current state of the process, performing an optimization of the melting process, determining a process input based on the result of the optimization, and controlling the melting process with the process input. A method is also presented herein.

Abstract: The present invention relates to a rs6311 test kit, which includes a probe, a primer, and a polymerase chain reaction solution, wherein said probe sequence is as follows: rs6311T-fam: CTGTGAGTGTCTGGC (SEQ. ID. NO. 1) and rs6311C-vic: CTGTGAGTGTCCGGC (SEQ. ID. NO. 2); and said primer sequence is as follows: rs6311-F: AGAGAGAACATAAATAAGGCTAGAAAACAGTA (SEQ. ID. NO. 3) and rs6311-R: CACTGTTGGCTTTGGATGGA (SEQ. ID. NO. 4). The test kit is used to determine genotype of a depression patient, in order to treat the depression patient with a combination of serotonin reuptake inhibitors (SSRI) and low dose risperidone. The actual dose of risperidone and the ratio between SSRIs and risperidone is determined by the genotype of the depression patient. The present invention determines human drug metabolism rate through a single nucleotide polymorphism and provides a platform to adjust the patient's treatment.