Patents by Inventor Yong Chan Kim

Yong Chan Kim has filed for patents to protect the following inventions. This listing includes patent applications that are pending as well as patents that have already been granted by the United States Patent and Trademark Office (USPTO).

  • Patent number: 11673368
    Abstract: A decoration member including: a color developing layer including a light reflective layer and a light absorbing layer provided on the light reflective layer; and a substrate provided on one surface of the color developing layer. The substrate includes a pattern layer, and the light absorbing layer includes silicon (Si).
    Type: Grant
    Filed: December 14, 2018
    Date of Patent: June 13, 2023
    Assignee: LG CHEM, LTD
    Inventors: Yong Chan Kim, Ki Hwan Kim, Nansra Heo, Jeong Woo Shon, Jin Suk Song, Pilsung Jo
  • Publication number: 20230161089
    Abstract: The present disclosure relates to a decoration element comprising a light reflective layer; a light absorbing layer provided on the light reflective layer; and a color developing layer comprising a color film provided on a surface opposite to the surface facing the light absorbing layer of the light reflective layer, between the light reflective layer and the light absorbing layer, or on a surface opposite to the surface facing the light reflective layer of the light absorbing layer.
    Type: Application
    Filed: July 4, 2018
    Publication date: May 25, 2023
    Inventors: Pilsung Jo, Song Ho Jang, Yong Chan Kim, Jeong Woo Shon, Jin Suk Song, Ki Hwan Kim
  • Patent number: 11644730
    Abstract: An electrochromic device including an electrode layer, an electrochromic layer and a conductive band having a closed ring shape. The electrochromic device having the above structure has excellent color-switching speeds and electrochromic uniformity.
    Type: Grant
    Filed: April 23, 2018
    Date of Patent: May 9, 2023
    Assignee: LG CHEM, LTD.
    Inventors: Yong Chan Kim, Ki Hwan Kim, Pil Sung Jo
  • Publication number: 20230133220
    Abstract: A secondary battery includes: an electrode assembly; a case accommodating the electrode assembly; a cap plate sealing the case; and an insulating member between the electrode assembly and the cap plate, and a relationship of M/E=R1 is satisfied, where M is a melting point (° C.) of the insulating member, E is an energy density (Wh/kg) of the secondary battery, and R1 is 0.5 to 3.5.
    Type: Application
    Filed: September 23, 2022
    Publication date: May 4, 2023
    Inventors: Yong Chan KIM, Dong Hyuk KIM, Bo Hyun KIM, Mun Ho NAM, Jeong Won OH
  • Patent number: 11639045
    Abstract: A decorative member including: a color developing layer including a light reflective layer and a light absorbing layer provided on the light reflective layer; and a substrate provided on one surface of the color developing layer. The light absorbing layer includes a copper oxynitride (CuaObNc).
    Type: Grant
    Filed: December 14, 2018
    Date of Patent: May 2, 2023
    Assignee: LG CHEM, LTD.
    Inventors: Yong Chan Kim, Ki Hwan Kim, Nansra Heo, Jeong Woo Shon, Jin Suk Song, Pilsung Jo
  • Publication number: 20230130574
    Abstract: A presbyopia diagnosis apparatus includes: a measurement bar that is elongated along an axis in one direction, has a front end arranged to face the eyes of a subject for presbyopia measurement, and a rear end connected to a support, wherein a scale for measuring a distance is marked on the measurement bar; and a sliding unit that is movably installed on the measurement bar and has an installation groove formed therein, the installation groove for mounting a card for measuring presbyopia.
    Type: Application
    Filed: January 11, 2021
    Publication date: April 27, 2023
    Inventors: Yong Chan KIM, Kee Il LEE
  • Patent number: 11634821
    Abstract: The present disclosure relates to a method for manufacturing a film for a decoration element, the method including depositing two or more islands on one surface of a film; and forming a pattern portion by dry etching the film using the island as a mask.
    Type: Grant
    Filed: September 2, 2019
    Date of Patent: April 25, 2023
    Assignee: LG Chem, Ltd.
    Inventors: Pilsung Jo, Song Ho Jang, Ki Hwan Kim, Yong Chan Kim, Nansra Heo, Jeong Woo Shon
  • Patent number: 11597912
    Abstract: The present disclosure provides a method for producing a population of regulatory T cells comprising culturing an initial population of regulatory T cells obtained from umbilical cord blood in a media comprising an oligonucleotide having the sequence of AATCGTAACCGTCGTATCGGCGAT (SEQ ID NO: 1) to expand the initial population of regulatory T cells, and a method of treating an autoimmune disease comprising administering to a subject in need thereof an effective amount of a composition comprising the regulatory T cells prepared by the above method.
    Type: Grant
    Filed: March 31, 2022
    Date of Patent: March 7, 2023
    Assignee: TERAIMMUNE, INC.
    Inventors: Yong Chan Kim, Nari Byun, Jeong Heon Yoon
  • Patent number: 11589663
    Abstract: The present disclosure relates to a decoration member comprising a color developing layer comprising a light reflective layer and a light absorbing layer provided on the light reflective layer; and a substrate provided on one surface of the color developing layer, wherein the light absorbing layer comprises a molybdenum-titanium oxide (MoaTibOx).
    Type: Grant
    Filed: June 14, 2019
    Date of Patent: February 28, 2023
    Assignee: LG Chem, Ltd.
    Inventors: Yong Chan Kim, Ki Hwan Kim, Nansra Heo, Jeong Woo Shon, Pilsung Jo
  • Patent number: 11561447
    Abstract: A decoration element including a color developing layer including a light reflective layer, a light absorbing layer provided on the light reflective layer, and a convex portion or concave portion having an asymmetric-structured cross-section; an electrochromic device provided on any one surface of the color developing layer; and an in-mold label layer provided on the other surface of the color developing layer.
    Type: Grant
    Filed: December 13, 2018
    Date of Patent: January 24, 2023
    Assignee: LG CHEM, LTD.
    Inventors: Yong Chan Kim, Ki Hwan Kim, Nansra Heo, Jeong Woo Shon, Pilsung Jo
  • Patent number: 11559966
    Abstract: The present disclosure relates to a decoration element comprising a light reflective layer, and a light absorbing layer provided on the light reflective layer and comprising Si.
    Type: Grant
    Filed: June 27, 2018
    Date of Patent: January 24, 2023
    Assignee: LG CHEM, LTD.
    Inventors: Jeong Woo Shon, Song Ho Jang, Yong Chan Kim, Jin Suk Song, Pilsung Jo, Ki Hwan Kim
  • Patent number: 11524482
    Abstract: A decoration element including a color developing layer including a light reflective layer, and a light absorbing layer provided on the light reflective layer; and an in-mold label layer provided on one surface of the color developing layer. The light absorbing layer includes a convex portion shape or concave portion shape having an asymmetric cross-section.
    Type: Grant
    Filed: December 12, 2018
    Date of Patent: December 13, 2022
    Assignee: LG CHEM, LTD.
    Inventors: Yong Chan Kim, Ki Hwan Kim, Nansra Heo, Jeong Woo Shon, Pilsung Jo
  • Patent number: 11524483
    Abstract: A decoration member including: a color developing layer including a light reflective layer and a light absorbing layer provided on the light reflective layer; and a substrate provided on one surface of the color developing layer. The light absorbing layer includes a copper oxynitride (CuaObNc).
    Type: Grant
    Filed: December 14, 2018
    Date of Patent: December 13, 2022
    Assignee: LG CHEM, LTD.
    Inventors: Yong Chan Kim, Ki Hwan Kim, Nansra Heo, Jeong Woo Shon, Jin Suk Song, Pilsung Jo
  • Publication number: 20220325243
    Abstract: The present disclosure provides a method for producing a population of regulatory T cells comprising culturing an initial population of regulatory T cells obtained from umbilical cord blood in a media comprising an oligonucleotide having the sequence of AATCGTAACCGTCGTATCGGCGAT (SEQ ID NO: 1) to expand the initial population of regulatory T cells, and a method of treating an autoimmune disease comprising administering to a subject in need thereof an effective amount of a composition comprising the regulatory T cells prepared by the above method.
    Type: Application
    Filed: March 31, 2022
    Publication date: October 13, 2022
    Applicant: TERAIMMUNE, INC.
    Inventors: Yong Chan KIM, Nari BYUN, Jeong Heon YOON
  • Patent number: 11465389
    Abstract: A decorative member including: a color developing layer including a light reflective layer and a light absorbing layer provided on the light reflective layer; and a substrate provided on a surface of the color developing layer. The substrate comprises a pattern layer, and the light absorbing layer comprises silicon (Si).
    Type: Grant
    Filed: December 14, 2018
    Date of Patent: October 11, 2022
    Assignee: LG CHEM, LTD.
    Inventors: Yong Chan Kim, Ki Hwan Kim, Nansra Heo, Jeong Woo Shon, Jin Suk Song, Pilsung Jo
  • Patent number: 11467460
    Abstract: An electrochromic film and an electrochromic device including the electrochromic film are disclosed. The electrochromic film includes an electrochromic layer and a passivation layer on one side of the electrochromic layer. The coloration level of the electrochromic film is different from the coloration level of the passivation layer. The film may change optical properties as a result of electrochromism according to an electrochemical reaction. The electrochromic film and the electrochromic device have improved electrochromism, excellent durability, excellent color-switching speed, and stepwise control of optical properties.
    Type: Grant
    Filed: April 23, 2018
    Date of Patent: October 11, 2022
    Assignee: LG CHEM, LTD.
    Inventors: Yong Chan Kim, Ki Hwan Kim
  • Patent number: 11448800
    Abstract: The present disclosure relates to a decoration element comprising a light reflective layer; and a light absorbing layer provided on the light reflective layer, wherein the light reflective layer is a discontinuous film.
    Type: Grant
    Filed: June 27, 2018
    Date of Patent: September 20, 2022
    Assignee: LG CHEM, LTD.
    Inventors: Yong Chan Kim, Jeong Woo Shon, Pilsung Jo, Ki Hwan Kim, Song Ho Jang
  • Patent number: 11415857
    Abstract: An electrochromic film, which is a reflective electrochromic film, which includes an electrode layer, a light absorbing layer and an electrochromic layer. The film can improve an electrochromism rate and realize various colors or esthetic senses.
    Type: Grant
    Filed: April 23, 2018
    Date of Patent: August 16, 2022
    Assignee: LG CHEM, LTD.
    Inventors: Yong Chan Kim, Song Ho Jang, Ki Hwan Kim, Pil Sung Jo
  • Patent number: 11409178
    Abstract: A light-transmitting film and a device including the light-transmitting film are disclosed. The light-transmitting film includes an oxynitride containing two or more metals selected from Ti, Nb, Mo, Ta and W, and having light transmittance of 60% or more. The oxynitride may be represented by Formula 1, which is MoaTibOxNy where a>0, b>0, x>0, y>0, 0.5<a/b<4.0, and 0.005<y/x<0.02. The film has a light transmission characteristic, is capable of reversible color-switching depending on the applied voltage, and has excellent durability within a driving voltage range in which the film changes its color.
    Type: Grant
    Filed: April 23, 2018
    Date of Patent: August 9, 2022
    Assignee: LG CHEM, LTD.
    Inventors: Yong Chan Kim, Ki Hwan Kim
  • Patent number: 11390113
    Abstract: The disclosed relates to a decoration element and a method for preparing the decoration element. The decoration element has dichroism expressing different colors depending on a viewing direction, and has improved visibility of the dichroism.
    Type: Grant
    Filed: March 6, 2018
    Date of Patent: July 19, 2022
    Assignee: LG Chem, Ltd.
    Inventors: Eun Byurl Cho, Yong Chan Kim, Ki Hwan Kim, Jeong Woo Shon, Jin Suk Song, Song Ho Jang, Pilsung Jo, Sangcholl Han, Nansra Heo