Recombinant Newcastle disease viruses useful as vaccines or vaccine vectors

Abstract

The present invention concerns an antigenomic RNA of Newcastle Disease virus (NDV) carrying one or more foreign genes inserted before NP gene, between P and M genes, and/or between HN and L genes. The invention is also directed toward a cDNA encoding a recombinant antigenomic RNA having one or more foreign genes inserted according to the invention, a cell containing the cDNA, a plasmid comprising the cDNA, a cell containing the plasmid, a cell containing the recombinant antigenomic RNA, and a recombinant NDV containing the recombinant antigenomic RNA of the invention, such as a recombinant NDV carrying one or more foreign genes recovered from transcription of the cDNA or the plasmid in a competent cell. The recombinant NDV carrying the one or more foreign genes can be used as a vaccine or vaccine vector.

Description

[0001] The present patent application is a continuation-in-part application of pending U.S. patent application Ser. No. 09/926,431 filed on Mar. 6, 2002, which is a U.S. national phase entry application under 35 U.S.C. §371 based on PCT/US00/06700 filed on May 5, 2000. The present patent application also claims the benefit of U.S. Provisional Patent Application No. 60/381,462 filed on May 17, 2002. The disclosures of application Ser. No. 09/926,431 and 60/381,462 are hereby incorporated by reference.

[0002] The present application relates to recombinant Newcastle disease viruses carrying one or more foreign genes, i.e. genes not found naturally in the Newcastle disease virus, which are useful as vaccines or vaccine vectors.

BACKGROUND OF THE INVENTION

[0003] Newcastle disease is a highly contagious viral disease affecting all species of birds. The disease can vary from an asymptomatic infection to a highly fatal disease, depending on the virus strain and the host species. Newcastle disease has a worldwide distribution and is a major threat to the poultry industries of all countries. Based on the severity of the disease produced in chickens, Newcastle disease virus (NDV) strains are grouped into three main pathotypes: lentogenic (strains that do not usually cause disease in adult chickens), mesogenic (strains of intermediate virulence) and velogenic (strains that cause high mortality).

[0004] NDV is a member of the genus Rubulavirus in the family Paramyxoviridae. The genome of NDV is a non-segmented, single-stranded, negative-sense RNA of 15186 nucleotides (Krishnamurthy & Samal, 1998; Phillips et el., 1998; de Leeuw & Peeters, 1999). The genomic RNA contains six genes that encode the following proteins in the order of: the nucleocapsid protein (NP), phosphoprotein (P), matrix protein (M), fusion protein (F), haemagglutinin-neuramimidase (HN) and large polymerase protein (L). Two additional proteins, V and W, of unknown function are produced by RNA editing during P gene transcription (Steward et al., 1993). A schematic diagram of the genetic map of NDV genomic RNA is shown in FIG. 1.

[0005] Three proteins, i.e. NP, P and L proteins, constitute the nucleocapsid. The genomic RNA is tightly bound by the NP protein and together with the P and L proteins form the functional nucleocapsid within which resides the viral transcriptive and replicative activities. The F and HN proteins form the external envelope spikes, where the HN glycoprotein is responsible for attachment of the virus to host cell receptors and the F glycoprotein mediates fusion of the viral envelope with the host cell plasma membrane thereby enabling penetration of the viral genome into the cytoplasm of the host cell. The HN and F proteins are the main targets for the immune response. The M protein forms the inner layer of the virion.

[0006] NDV follows the general scheme of transcription and replication of other non-segmented negative-strand RNA viruses. The polymerase enters the genome at a promoter in the 3′ extragenic leader region and proceeds along the entire length by a sequential stop-start mechanism during which the polymerase remains template bound and is guided by short consensus gene start (GS) and gene end (GE) signals. This generates a free leader RNA and six non-overlapping subgenomic mRNAs. The abundance of the various mRNAs decreases with increasing gene distance from the promoter. The genes are separated by short intergenic regions (1-47 nucleotides) which are not copied into the individual mRNAs. RNA replication occurs when the polymerase somehow switches to a read-through mode in which the transcription signals are ignored. This produces a complete encapsulated positive-sense replicative intermediate which serves as the template for progeny genomes.

[0007] Reverse-genetic techniques have been reported to recover negative-sense viruses from cloned cDNA (Conzelmann, 1996). For NDV, reverse-genetic technology is currently available for avirulent strain LaSota (Romer-Oberdorfer et al., 1999; Peeters et al., 1999).

SUMMARY OF THE INVENTION

[0008] Reverse-genetic techniques were used in making the recombinant NDV of the present invention from cloned cDNA. This approach involves co-expression of the cloned cDNA of full length NDV genome and nucleocapsid proteins (the NP, P and L proteins) from transfected plasmids using the vaccinia virus/T7 RNA polymerase expression system.

[0009] Within the scope of the present invention, recombinant NDV can be recovered from cDNA and the genome of NDV can be manipulated at the cDNA level. The production of infectious NDV from cloned cDNA can be used to engineer NDV carrying foreign genes. With the manipulation of the genome of NDV, one can insert foreign sequences into the NDV genome for co-expression. For example, the gene for protective antigen of another avian pathogen or the genes for avian cytokines can be inserted into the NDV genome for co-expression. Thus, the present invention includes multivalent genetically engineered NDV vaccines carrying genes encoding immunogens (e.g. immunogenic proteins) for influenza virus, infectious bursal disease virus, rotavirus, infectious bronchitis virus, infectious laryngotracheitis virus, chicken anemia virus, Marek's disease virus, avian Leukosis virus, avian adenovirus and avian pneumovirus.

[0010] The present invention also is directed toward a genetically engineered NDV carrying avian cytokine genes. A NDV carrying at least one gene encoding an avian cytokine, e.g. an interleukin such as IL-2 and IL-4, can be used as a vaccine.

[0011] The recombinant NDV prepared by insertion of foreign genes into the NDV genome can express the foreign genes in cells infected by the recombinant NDV. As a result, the recombinant NDV can be used to express proteins of non-avian pathogens or other avian pathogens. Therefore, the recombinant NDV can be used as a vaccine vector.

[0012] One of the objects of the present invention is a recombinant antigenomic RNA of Newcastle disease virus, comprising NP gene, P gene, M gene, F gene, HN gene and L gene in this order from a 5′ to 3′ direction, said antigenomic RNA further comprising n foreign nucleotide complexes inserted (a) before the NP gene, (b) between the P and M genes, and/or (c) between the HN and L genes, wherein n is 1, 2, 3 or 4;

[0013] each of the foreign nucleotide complexes comprising a Newcastle disease virus gene start sequence, an open reading frame of a foreign gene and a Newcastle disease virus gene end sequence in this order from the 5′ to 3′ direction, wherein the foreign gene is a gene not found naturally in the Newcastle disease virus;

[0014] wherein when n is 2, 3 or 4, the foreign nucleotide complexes are the same or different; and

[0015] wherein when 2, 3 or 4 foreign nucleotide complexes are inserted together before the NP gene, between the P and M genes, or between the HN and L genes, the foreign nucleotide complexes are sequentially linked directly or indirectly.

[0016] Since each foreign nucleotide complex has a NDV gene start signal, i.e. GS sequence motif, upstream of the open reading frame (ORF) of the foreign gene and a NDV gene end signal, i.e. GE sequence motif, downstream of the ORF of the foreign gene, each foreign nucleotide complex forms a transcriptional unit.

[0017] The recombinant antigenomic RNA of NDV of the present invention preferably further comprises NP-P intergenic region between the NP gene and P gene, P-M intergenic region between the P gene and M gene, M-F intergenic region between the M gene and F gene, F-HN intergenic region between the F gene and HN gene, and/or HN-L intergenic region between the HN gene and L gene. More preferably, the recombinant antigenomic RNA of NDV of the present invention further comprises NP-P intergenic region between the NP gene and P gene, P-M intergenic region between the P gene and M gene, M-F intergenic region between the M gene and F gene, F-HN intergenic region between the F gene and HN gene, and HN-L intergenic region between the HN gene and L gene. When one or more of the foreign nucleotide complexes are inserted between the P and M genes, the foreign nucleotide complexes can be inserted into the P-M intergenic region if present. Similarly, when one or more of the foreign nucleotide complexes are inserted between the HN and L genes, the foreign nucleotide complexes can be inserted into the HN-L intergenic region. Optionally, one or more of the NP-P intergenic region, P-M intergenic region, M-F intergenic region, F-HN intergenic region, and HN-L intergenic region are replaced with a single nucleotide, dinucleotide or an oligonucleotide of 3-80 nucleotides (preferably 4-60 nucleotides) in length, wherein the oligonucleotide optionally contains one or more restriction sites.

[0018] When one or more of the foreign nucleotide complexes are inserted before the NP gene, the foreign nucleotide complexes preferably are inserted into a non-coding region immediately before the ORF of the NP gene, so that the ORF of the foreign gene in each of the foreign nucleotide complexes is flanked by NDV gene start and gene end signals and the ORF of the NP gene is preceded by a NDV gene start signal, with the GS-foreign gene ORF-GE structure preceding the GS signal for the NP ORF.

[0019] Within the scope of the invention is a recombinant antigenomic RNA of NDV having one or more foreign nucleotide complexes inserted between P and M genes. The antigenomic RNA can be made by inserting the one or more foreign nucleotide complexes into the noncoding region of P gene after the stop codon, but before the NDV gene end signal of the P gene. When only one foreign nucleotide complex is inserted into the noncoding region of P gene after the stop codon, the ORF of the foreign gene is preceded by a NDV gene end and NDV gene start signals, resulting in the ORF of the P gene being preceded by a NDV gene end signal, which is followed by a NDV gene start signal, the ORF of the foreign gene, and a NDV gene end signal in that order (the ORF of the following M gene is preceded by a NDV gene start signal). More foreign gene complexes can be inserted after this foreign gene complex. Similarly, the recombinant antigenomic RNA of NDV having one or more foreign nucleotide complexes inserted between P and M genes can be made by inserting the one or more foreign nucleotide complexes into the noncoding region of M gene before the ORF of the M gene.

[0020] The present invention is also directed toward a process of preparing the recombinant antigenomic RNA of the invention, comprising the following steps:

[0021] (i) providing a cDNA comprising NP gene, P gene, M gene, F gene, HN gene and L gene in this order, said cDNA further comprising n foreign nucleotide complexes inserted (a) before the NP gene, (b) between the P and M genes, and/or (c) between the HN and L genes, wherein n is 1, 2, 3 or 4;

[0022] each of the foreign nucleotide complexes comprising a Newcastle disease virus gene start sequence, an open reading frame of a foreign gene and a Newcastle disease virus gene end sequence in this order from the 5′ to 3′ direction, wherein the foreign gene is a gene not found naturally in the Newcastle disease virus;

[0023] wherein when n is 2, 3 or 4, the foreign nucleotide complexes are the same or different; and

[0024] wherein when 2, 3 or 4 foreign nucleotide complexes are inserted together before the NP gene, between the P and M genes, or between the HN and L genes, the foreign nucleotide complexes are sequentially linked directly or indirectly;

[0025] (ii) transcribing the antigenomic cDNA to form a mixture containing an antigenomic RNA; and thereafter

[0026] (iii) isolating the antigenomic RNA.

[0027] In some embodiments of the process of preparing the recombinant antigenomic RNA of the invention, the cDNA used in step (i), comprising NP gene, P gene, M gene, F gene, HN gene and L gene having the n foreign nucleotide complexes inserted, is prepared by (I) constructing a cDNA comprising the NP gene, P gene, M gene, F gene, HN gene and L gene in this order; and thereafter (II) inserting the n foreign nucleotide complexes (a) before the NP gene, (b) between the P and M genes, and/or (c) between the HN and L genes. Preferably, the cDNA constructed in step (I) and/or the cDNA constructed in step (II) are in a plasmid, such as pBR322 or pGEM-7Z. In step (ii), the cDNA preferably is transcribed in cells expressing a RNA polymerase, such as T7 RNA polymerase.

[0028] The present invention is also directed toward a recombinant NDV comprising a recombinant antigenomic RNA carrying one or more foreign genes of the present invention. The recombinant NDV can be produced by a process comprising the following steps:

[0029] (i) providing cells capable of synthesizing T7 RNA polymerase;

[0030] (ii) transfecting the cells with a plasmid comprising the cDNA encoding the antigenomic RNA having one or more foreign genes inserted according to the invention, a plasmid encoding NP protein, a plasmid encoding P protein, and a plasmid encoding L protein to obtain transfected cells in a medium; and thereafter

[0031] (iii) isolating Newcastle disease virus from a supernatant of the medium of step (ii) to obtain the recombinant Newcastle disease virus.

[0032] The cells capable of synthesizing T7 RNA polymerase provided in step (i) can be animal cells of an avian or mammalian species, plant cells, or cells from a cell line expressing T7 RNA polymerase.

[0033] Within the scope of the present invention are a cDNA encoding a recombinant antigenomic RNA having one or more foreign genes inserted according to the invention, a cell containing the cDNA, a plasmid comprising the cDNA, a cell containing the plasmid, a cell containing the recombinant antigenomic RNA, and a recombinant NDV containing the recombinant antigenomic RNA of the invention, e.g. a recombinant NDV carrying one or more foreign genes recovered from transcription of the cDNA or the plasmid in a competent cell. The recombinant NDV containing the recombinant antigenomic RNA of the invention is preferably substantially purified. Also preferred is a substantially purified recombinant antigenomic RNA of NDV carrying one or more foreign genes prepared according to the invention.

[0034] The present invention also includes a method of vaccinating an avian animal against Newcastle disease, wherein the avian animal is in need of the vaccination, comprising administering an effective amount of the recombinant NDV carrying one or more foreign genes according to the invention to the avian animal.

[0035] One of the objects of the inventions is a method of treating an avian animal with an avian cytokine, wherein the avian animal is in need of the treatment, said method comprising administering an effective amount of the recombinant NDV of the invention carrying one or more foreign genes encoding one or more avian cytokines, such as avian interleukins (preferably IL-2 and/or IL-4) to the avian animal.

[0036] Another aspect of the invention is a method of immunizing an avian animal against an avian pathogen selected from the group consisting of influenza virus, infectious bursal disease virus, rotavirus, infectious bronchitis virus, infectious laryngotracheitis virus, chicken anemia virus, Marek's disease virus, avian Leukosis virus, avian adenovirus and avian pneumovirus, wherein the avian animal is in need of the immunization, said method comprising administering an effective amount of the recombinant NDV of the invention to the avian animal, wherein the recombinant NDV carries one or more foreign genes encoding one or more immunogenic proteins of the avian pathogen against which the avian animal is immunized.

[0037] Also within the scope of the invention is a method of immunizing a mammal against a non-avian pathogen, wherein the mammal is in need of the immunization, said method comprising administering an effective amount of the recombinant NDV of the invention to the mammal, wherein the recombinant NDV carries one or more foreign genes encoding one or more immunogenic proteins of the non-avian pathogen, e.g. influenza virus, SARS-causing virus, human respiratory syncytial virus, human immunodeficiency virus, hepatitis A virus, hepatitis B virus, hepatitis C virus, poliovirus, rabies virus, Hendra virus, Nipah virus, human parainfluenza 3 virus, measles virus, mumps virus, Ebola virus, Marburg virus, West Nile virus, Japanese encephalitis virus, Dengue virus, Hantavirus, Rift Valley fever virus, Lassa fever virus, herpes simplex virus and yellow fever virus, against which the mammal is immunized.

BRIEF DESCRIPTION OF THE DRAWINGS

[0038] FIG. 1 is a schematic of the genetic map of NDV genomic RNA.

[0039] FIG. 2 is a map of the genome of NDV strain Beaudette C, wherein the nucleotide sequence of the NP region is available from the GenBank database with the accession number AF064091. In FIG. 2, the last nucleotide of the gene end, the first nucleotide of the gene start and the first and last nucleotides of the leader and trailer are numbered. The gene start and gene end sequences were derived from published sources of the NDV.

[0040] FIG. 3 shows the assembly of full-length cDNA of NDV strain LaSota. Seven subgenomic cDNA fragments generated by high-fidelity RT-PCR were assembled in pBR322/dr (not to scale). The numbers above the cDNA in FIG. 3 are the first nucleotide positions of various restriction sites. Plasmid pBR322 was modified to include a 72 nt oligonucleotide linker between the EcoRI and PstI sites, an 84 nt hepatitis delta virus (HDV) antigenome ribozyme sequence and a T7 RNA polymerase transcription-termination signal. Transcription of the plasmid pLaSota by T7 RNA polymerase resulted in NDV antigenomic RNA with three non-viral G residues at the 5′ terminus.

[0041] FIG. 4 shows the construction of pLaSota/CAT. An 18 nt fragment containing a PmeI site was inserted into the non-coding region immediately before the NP ORF. The ORF of the CAT gene was amplified by PCR with PmeI-tagged primers, digested with PmeI and introduced into the newly created PmeI site of the NP gene. A set of NDV gene-end (GE) and gene-start (GS) signals normally connected to the NP-P intergenic sequence was placed at the end of the CAT gene. The resulting plasmid pLaSota/CAT gave rise to an antigenomic RNA of 15900 nt, which is a multiple of six.

[0042] FIG. 5 shows plaques produced by rLaSota and rLaSota/CAT on DF1 cells. Infected cells overlaid with 1% methylcellulose were incubated for a period of 4 days. Plaques were visualized by immunostaining using a monoclonal antibody against the NDV HN protein.

[0043] FIG. 6 shows the identification of genetic markers in the genome of rLaSota and confirmation of the presence of the CAT gene in the genome of rLaSota/CAT. RT-PCR was performed from genomic RNA extracted from purified viruses. (a) Identification of genetic markers in the genome of rLaSota. Primers spanning the corresponding regions were used for PCR and the products were subjected to restriction enzyme digestion. Wild-type LaSota was used as control. (b) Confirmation of the presence of the CAT gene in the recovered rLaSota/CAT by PCR with specific primers. The larger RT-PCR product (23 kb) from rLaSota/CAT confirmed the presence of the CAT gene compared with the smaller RT-PCR product (16 kb) from rLaSota.

[0044] FIG. 7 shows a comparison of CAT expression by a recombinant virus (rBC/CAT) recovered from a cDNA encoding a recombinant antigenomic RNA of NDV Beaudefte C having a CAT gene inserted between HN and L genes as prepared in Example 2 and a recombinant virus (rLaSota/CAT) recovered from a cDNA encoding a recombinant antigenomic RNA of NDV LaSota having a CAT gene inserted before NP gene as prepared in Example 1 at passage 6. The CAT gene was expressed from the sixth position in rBC/CAT while it was expressed from the first position in rLaSota/CAT. Equal cell equivalents of lysates were analysed for acetylation of [14C]chloramphenicol as visualized by thin-layer chromatography. Relative CAT activity was quantified by densitometry.

[0045] FIG. 8 shows results of Northern blot hybridization blot hybridization of intracellular mRNAs encoded by rLaSota and rLaSota/CAT. Poly(A)+ mRNAs were isolated from total intracellular RNA by oligo(dT) chromatography and were electrophoresed on formaldehyde-agarose gels. The gels were transferred to nitrocellulose membrane and probed with the negative-sense riboprobes.

[0046] FIG. 9 shows multi-step growth curves for wt LaSota (&Circlesolid;), rLaSota (▪) and rLaSota/CAT (▴) in DF1 cells. Cell monolayers in 25 cm2 flasks were infected with 0·005 p.f.u. per cell with three replicate flasks per virus. Samples were taken every 8 h for 56 h. The virus in the supernatant was titrated by plaque assay. The log titer was derived from the mean virus titer and error bars indicate standard deviations.

[0047] FIG. 10 shows the construction of a full-length cDNA to the genome of NDV strain Beaudette C in a plasmid.

[0048] FIG. 11 shows a full-length NDV cDNA assembled in pBR322/dr from subgenomic cDNA fragments (I to VIII) that were generated by high-fidelity RT-PCR (not to scale). The blocked arrows indicate the primers used in RT-PCR. The numbers shown above the primers represent the position in the genome of the first nucleotide of the primer, represented 5′ to 3′. Plasmid pBR322/dr is the modified form of plasmid pBR322, designed to include a 72-nucleotide oligonucleotide linker between the EcoRI and PstI sites, an 84-nucleotide hepatitis delta virus (HDV) antigenome ribozyme sequence and a T7 RNA polymerase transcription termination signal. Transcription by the T7 RNA polymerase of the plasmid pNDVf1 resulted in the NDV antigenomic RNA with 3 nonviral G residues at the 5′ terminus.

[0049] FIG. 12 shows the construction of a recombinant NDV cDNA that contains a foreign gene inserted into the intergenic region between the HN and L genes, wherein the foreign gene means a gene foreign to NDV and in this case the foreign gene is a gene encoding chloramphenical acetyltransferase (CAT).

[0050] FIG. 13 shows the construction of pNDVf1/CAT by insertion of the CAT gene cDNA into HN and L intergenic region of the plasmid pNDVf1. The nucleotide sequences represent the oligonucleotide primer used for amplifying the CAT ORF. The resulting PCR product with the AgeI overhang on either end contained the gene start (GS) signal, noncoding (NC) sequence, and gene end (GE) signal. The nucleotide length of the construct was maintained as a multiple of six. The RNA encoded by pNDVf1/CAT included the three 5′-terminal nonviral G residues contributed by the T7 promoter.

[0051] FIG. 14 shows a recombinant vaccinia virus-based transfection system used to recover infectious NDV from a plasmid containing a recombinant cDNA to the genome of NDV.

[0052] FIG. 15 shows the detection of CAT expression after one passage of infectious recombinant NDV carrying the CAT gene recovered from the recombinant vaccinia virus-based transfection system of FIG. 14, wherein the recombinant NDV resulted from transcription of the recombinant NDV cDNA constructed in FIG. 12.

[0053] FIG. 16 depicts schematically the construction of a recombinant cDNA encoding an antigenome of NDV strain Beaudette C having a foreign gene, a gene encoding GFP, inserted into the noncoding region of P gene by creating a XbaI site via mutation of a TCTCGC segment (nucleotide positions 3182-3187) forming a TCTAGA segment in the P gene noncoding region after a stop codon. TTAGAAAAAA represents a cDNA fragment for a NDV gene end signal and ACGGGTAGMAA represents a cDNA fragment for a NDV gene start signal.

DETAILED DESCRIPTION OF THE INVENTION

[0054] In some embodiments of the recombinant antigenomic RNA of the present invention, n is 2, 3 or 4 (preferably 2 or 3, and more preferably 2) and the foreign nucleotide complexes are different. In some embodiments of the recombinant antigenomic RNA, n is 2, 3 or 4 (preferably 2 or 3, and more preferably 2) and the foreign nucleotide complexes are the same. In still some embodiments of the recombinant antigenomic RNA, n is 1 or 2.

[0055] In some of the recombinant antigenomic RNAs of the invention, the ORF of each of the foreign genes in inserted the foreign nucleotide complexes is no more than about 3000 nucleotides, no more than about 2000 nucleotides, no more than about 1500 nucleotides, no more than about 1000 nucleotides, no more than about 800 nucleotides, no more than about 500 nucleotides, or no more than about 300 nucleotides in length.

[0056] In some of the embodiments of the recombinant antigenomic RNA of the present invention, where 2, 3 or 4 foreign nucleotide complexes are inserted together before the NP gene, between the P and M genes, or between the HN and L genes, the foreign nucleotide complexes are sequentially linked directly or indirectly, and the foreign nucleotide complexes have a combined length of no more than about 5000 nucleotides, no more than about 4000 nucleotides, no more than about 3000 nucleotides, no more than about 2000 nucleotides, no more than about 1000 nucleotides, or no more than about 800.

[0057] The foreign gene inserted in the recombinant antigenomic RNA of the invention preferably encode a substance selected from the group consisting of chloramphenical acetyltransferase, GFP, an avian cytokine, and an immunogenic protein of influenza virus, infectious bursal disease virus, rotavirus, infectious bronchitis virus, infectious laryngotracheitis virus, chicken anemia virus, Marek's disease virus, avian leukosis virus, avian adenovirus, or avian pneumovirus. The foreign gene may encode an immunogenic protein of a non-avian pathogen, e.g. influenza virus, SARS-causing virus, human respiratory syncytial virus, human immunodeficiency virus, hepatitis A virus, hepatitis B virus, hepatitis C virus, poliovirus, rabies virus, Hendra virus, Nipah virus, human parainfluenza 3 virus, measles virus, mumps virus, Ebola virus, Marburg virus, West Nile disease virus, Japanese encephalitis virus, Dengue virus, Hantavirus, Rift Valley fever virus, Lassa fever virus, herpes simplex virus and yellow fever virus.

[0058] When more than one foreign gene encoding the avian cytokine is inserted, the foreign genes may encode the same or different avian cytokines, such as avian interleukins, e.g. IL-2 and IL-4.

[0059] Examples of the foreign gene encoding an immunogenic protein of an avian pathogen are HA or NA gene of influenza virus, VP2 or polyprotein gene of infectious bursal disease virus, S or S1 gene of infectious bronchitis virus, glycoprotein gene of infectious laryngotracheitis virus, the complete genome of chicken anemia virus, glycoprotein gene of Marek's disease virus, envelope gene of avian leukosis virus, avian adenovirus, and G or F gene of avian pneumovirus.

[0060] Examples of the foreign gene encoding an immunogenic protein of a non-avian pathogen are HA or NA gene of influenza virus, S or S1 gene of SARS-causing virus, G or F gene of human respiratory syncytial virus, gp60, gp120 or gp4l gene of human immunodeficiency virus, surface antigen gene of hepatitis A virus, surface antigen gene of hepatitis B virus, surface antigen of hepatitis C virus, capsid proteins gene of poliovirus, G protein gene of rabies virus, G or F protein gene of Hendra virus, G or F protein gene of Nipah virus, HN or F protein gene of human parainfluenza 3 virus, H or F protein gene of measles virus, HN or F protein gene of mumps virus, G protein gene of Ebola virus, G protein gene of Marburg virus, envelope protein gene of West Nile disease virus, envelope protein gene of Japanese encephalitis virus, envelope protein gene of Dengue virus, glycoprotein gene of Hantavirus, glycoprotein gene of Rift Valley fever virus, G1 or G2 protein gene of Lassa fever virus, glycoprotein genes of herpes simplex virus, and glycoprotein gene of yellow fever virus.

[0061] The present invention is also directed toward an antigenomic RNA of NDV carrying one or more foreign genes inserted before the NP gene, between the P and M genes, and/or between the HN and L genes, wherein at least one of the foreign genes encodes a tumor antigen, such as pg100, MAGE1, MAGE3 and CDK4.

[0062] In the recombinant antigenomic RNA of the invention, the foreign nucleotide complexes preferably are inserted before the NP gene, and/or between the P and M genes. More preferably, at least one of the foreign nucleotide complexes is inserted before the NP gene. In some embodiments of the recombinant antigenomic RNA, at least one of the foreign nucleotide complexes is inserted before the NP gene and at least one of the foreign nucleotide complexes is inserted between the P and M genes. In some embodiments, at least one of the foreign nucleotide complexes is inserted before the NP gene and at least one of the foreign nucleotide complexes is inserted between the HN and L genes. In still some embodiments, at least one of the foreign nucleotide complexes is inserted before the NP gene, at least one of the foreign nucleotide complexes is inserted between the P and M genes, and at least one of the foreign nucleotide complexes is inserted between the HN and L genes. In yet some embodiments, at least one of the foreign nucleotide complexes is inserted between the P and M genes. Most preferably, the foreign nucleotide complexes are inserted only before the NP gene.

[0063] NDV grows to very high titers (<109 PFU/ml) in many cell lines and eggs and elicits strong humoral and cellular immune responses in vivo. NDV naturally infects via respiratory and alimentary tract mucosal surfaces. NDV replicates in the cytoplasm of infected cells and does not undergo genetic recombination, making vaccine vectors based on the recombinant NDV carrying foreign genes stable and safe. Due to these characteristics of NDV described herein, recombinant NDVs that can express foreign genes carried in the recombinant NDVs are good vaccines, wherein the foreign genes encode immunogenic proteins of pathogens.

[0064] The recombinant NDV on the invention carrying one or more inserted foreign genes show robust expression of the foreign genes. Moreover, the recombinant NDV expressing one or more of the foreign gene can replicate in cell culture and in vivo. Avirulent NDV recombinants expressing heterologous proteins could be used as multivalent vaccines.

[0065] The recombinant NDV generated from the recombinant antigenomic RNA carrying one or more foreign genes inserted according to the invention can also be used as an inactivated vaccine.

[0066] The vaccine or vaccine vector based on the recombinant NDV generated from the recombinant antigenomic RNA carrying one or more foreign genes inserted according to the invention can be administered topically, via the respiratory route, orally or via an injection. The dose of the vaccine or vaccine vector to be used can be readily determined by a person skilled in the art based on the disease, the host subject species, and the age, sex and/or health condition of the host subject involved.

EXAMPLE 1

[0067] In this working example, an embodiment of the invention in which the recombinant NDV containing CAT as the foreign gene inserted before the NP gene was prepared.

[0068] A. Assembly of a Full-Length Clone of NDV Strain LaSota and Recovery of NDV LaSota from a Plasmid

[0069] NDV lentogenic strain LaSota was grown in 10-day-old embryonated, specific-pathogen-free (SPF) eggs. The virus was purified from allantoic fluid as described previously (Kingsbury, 1966). Viral RNA was extracted from the purified virus by using TRIzol according to the manufacturer's protocol (Life Technologies). The extracted RNA was subjected to RT-PCR with virus-specific primer pairs (Table 1) to generate seven overlapping PCR fragments of the entire viral genome with high-fidelity Pfx DNA polymerase (Life Technologies). In Table 1, the cDNA fragments correspond to the fragments shown in FIG. 3, wherein the T7 promoter sequence is in italics, virus sequences are underlined, restriction sites are in bold, and the partial HDV ribozyme sequence (24 nt) overhang is shown in lower case. A low-copy-number plasmid, pBR322, was modified as pBR322/dr to contain a 72 nt linker between the EcoRI and PstI sites for subsequent assembly of full-length NDV strain LaSota. The LaSota strain cDNA was placed in the antigenomic orientation between the T7 promoter and a self-cleaving hepatitis delta virus (HDV) antigenome ribozyme, followed by a T7 RNA polymerase terminator (FIG. 3). Two genetic markers were introduced into the full-length cDNA for the purpose of identifying the recovered virus. An MluI site was created in the F-HN intergenic region and a SnaBI site was created in the HN-L intergenic region. For the construction of NP, P and L expression plasmids, the open reading frame (ORF) of each gene was amplified from the above full-length clone by PCR. The NP gene was cloned in the plasmid PGEM-7Z (Promega) between EcoRI and BamHI sites. The P and L genes were cloned in an expression plasmid thathas an encephalomyocarditis virus internal ribosome entry site (IRES) downstream of the T7 RNA polymerase promoter, and they make use of the translation start codon contained in the NcoI site of the IRES. The assembled full-length cDNA clone and the support plasmids encoding LaSota NP, P and L proteins were sequenced in their entirety. The resulting full-length clone and support plasmids were designated pLaSota, pNP, pP and pL, respectively.

[0070] A cDNA clone encoding NDV strain LaSota antigenomic RNA was assembled from seven cDNA fragments, as shown in FIG. 3. This plasmid, termed pLaSota, positioned the NDV cDNA between the T7 promoter and the HDV ribozyme sequence. During its construction, the antigenomic cDNA was modified to generate two new restriction sites as markers. A genetic marker was introduced into the intergenic region between the F and HN genes by changing two nucleotides to mutate the original AgeI site to a unique MluI site (positions 6292-6297 in the full-length cDNA clone). Similarly, a unique SnaBI site was generated in the HN and L intergenic region by changing four nucleotides (positions 8352-8357). To facilitate transcription by T7 RNA polymerase, three G residues were included before the NDV leader sequence.

[0071] In order to recover NDV from the cloned cDNA to the antigenome of NDV LaSota, transfection was carried out as described here (based on a general procedure schematically shown in FIG. 14). HEp-2 cells (6-well plates) were infected at 1 p.f.u. per cell with modified vaccinia virus (MVA/T7) expressing T7 RNA polymerase. A mixture of a plasmid containing NP gene ORF, a plasmid containing P gene ORF, and a plasmid containing L gene ORF all under the control of the T7 promoter (25, 15 and 0.5 pg per well, respectively) and a fourth plasmid encoding the NDV (5 pg) was transfected with LipofectAMINE Plus (Life Technologies). Four hours after transfection, cells were washed and the medium was replaced with 2 ml fresh medium (DMEM with 0% foetal calf serum and 1 pg/ml acetyltrypsin). Three days post-transfection, the supernatant was harvested, clarified and used to infect fresh HEp-2 cells. Three days later, 100 pl supernatant was taken to inoculate into the allantoic cavity of 10-day-old embryonated SPF eggs. After 96 h, allantoic fluid was harvested and tested for haemagglutinating (HA) activity. After two passages in eggs, the virus was plaque-purified to eliminate vaccinia virus. The plaques produced by the virus were stained with monoclonal antibodies specific to the NDV HN protein to confirm the specificity of the recovered virus (FIG. 5). The recovered viruses were designated rLaSota. To identify the recovered virus, two genetic markers (MluI and SnaBI) were introduced in the full-length cDNA clone. In order to verify the presence of these markers, RNA from recovered virus was subjected to RT-PCR. DNA fragments encompassing the regions containing the MluI and SnaBI sites were subjected to restriction enzyme digestion with the respective enzymes. Analysis of the restriction enzyme patterns revealed the presence of both genetic markers in rLaSota, as calculated from the sizes of the bands, while RT-PCR products from wild-type LaSota were not digested by the enzymes (FIG. 6a).

[0072] Nucleotide sequence analysis of RT-PCR products also confirmed the presence of the genetic markers. The procedures for RT-PCR and demonstration of genetic marker are described herein. RNA was isolated from recovered virus by using TRIzol reagent. RT-PCR was performed with primers P1 (5′ TCCCCTGGTATTTATTCCTGC, positions 5609-5629) and P1 R (5′ GTTGGCCACCCAGTCCCCGA, negative sense, positions 7286-7305) to amplify a fragment including the introduced Mlul site in the intergenic region between the F and HN genes. Similarly, a fragment containing the SnaBI site within the HN-L intergenic region was amplified with primers P2 (5′ CGCATACAGCAGGCTATCTTATC, positions 7513-7535) and P2R (5′GGGTCATATTCTATACATGGC, negative sense, positions 9739-9759). The RT-PCR products were then subjected to restriction enzyme digestion, the first product with MluI, the second with SnaBI. The restriction patterns were analysed by agarose gel electrophoresis. RT-PCR was also performed to demonstrate the location of the CAT gene insert in the recombinant NDV expressing the CAT gene.

[0073] B. Construction of a Full-Length Plasmid Containing the Chloramphenicol Acetyltransferase (CAT) Gene

[0074] For the convenience of inserting CAT into the most 3′-proximal locus, an AscI-SacIl fragment of the full-length cDNA clone was subcloned into plasmid pGEM-7Z between the XbaI and HindIII sites by using a specific primer pair with XbaI and HindIII site overhangs. An 18 nt insert with a unique PmeI site was then introduced just before the NP ORF by the method described previously (Byrappa et al., 1995). To insert the CAT gene into the PmeI site, the CAT gene ORF was amplified by primers (5′ gctagtttaaacATGGAGAAAAAAATCACTGGATATACC 3′, positive sense, and 5′ gctagtttaaacttctacccgtgttttttctaatctgcagTTACGCCCCGCCCTGCCACTCAT CGC 3′, negative sense; PmeI site and NDV gene start and gene end signal in lower case, CAT-specific sequence in capitals), digested with PmeI and placed into the NP non-coding region in pGEM-7Z (FIG. 4). Clones with the CAT gene in the correct orientation were chosen for sequencing. The AscI-SaclI fragment containing the CAT gene was used to replace the corresponding fragment in pLaSota. Thus, an additional transcriptional unit, the CAT ORF flanked by NDV gene start and gene end signals, was inserted into pLaSota. The total number of nucleotides was adjusted by inserting nucleotides after the CAT gene stop codon to maintain the ‘rule of six’. The resulting clone was designated pLaSota/CAT.

[0075] The CAT gene ORF, flanked by NDV gene start and gene end sequences, was inserted into the non-coding region of the NP gene immediately before the NP ORF (FIG. 4). The resulting plasmid would encode an antigenome of 15900 nt, obeying the ‘rule of six’ (Peeters et al., 2000). In the recovered virus, the inserted CAT gene would be expressed as a monocistronic mRNA under the control of the NDV transcription system. The method for recovery of recombinant NDV was the same as described above. Plaques produced by rLaSota/CAT were immunostained with HN-specific monoclonal antibody and were of a size and morphology similar to those produced by rLaSota. The presence of the CAT gene in the genome of recovered virus was verified by RT-PCR with oligonucleotide primers spanning the CAT gene. The size of the RT-PCR product from recovered rLaSota was 16 kb, while that from rLaSota/CAT was 23 kb (FIG. 6b). Direct PCR from extracted RNA without RT did not yield any product. Nucleotide sequence analysis of the RT-PCR product confirmed the presence of the CAT gene in the genome of the recovered virus rLaSota/CAT.

[0076] To examine the expression of the CAT protein from rLaSota/CAT, cell lysates from 12 passages, beginning with the third, were tested for CAT activity. For rLaSota/CAT, all passages showed similar CAT enzyme activity by CAT assay (procedure described below, but data not shown). These results showed that the inserted CAT gene was stable, at least up to passage 12. In Example 2 described below, an NDV-CAT chimeric transcription cassette was inserted between the HN and L genes of the full-length cDNA of virulent NDV strain Beaudette C and infectious CAT-expressing recombinant NDV (rBC/CAT) was recovered. In order to compare the level of expression of the CAT genes from rLaSota/CAT and rBC/CAT, replicate monolayers of DF1 cells were infected with each virus separately at an m.o.i. of 0.1. Four days after infection, CAT enzyme activities in the cell lysates were examined (FIG. 7). The results showed that the CAT enzyme activity was about 11-fold higher in cells infected with rLaSota/CAT than in cells infected with rBC/CAT.

[0077] The activity of CAT was assayed as described below for analysis of the stability of CAT expression. Chicken embryo fibroblast DF1 cell pellets were lysed by three freeze-thaw cycles and 1% of the lysed pellet from a 25 cm2 flask was analysed by TLC for the ability to acetylate [14C]chloramphenicol (Amersham Pharmacia). To study the stability of CAT expression by the recombinant virus, a total of 12 serial passages were performed at a passage interval of 4 days. At each passage, 100 &mgr;l of the medium supernatant was used for passing to fresh DF1 cells in a 25 cm2 flask. Acetyltrypsin (1 &mgr;g/ml) was included in the medium of DF1 cells for cleavage of the F protein of rLaSota and rLaSota/CAT.

[0078] To examine the presence of CAT mRNA and the level of synthesis of the immediate downstream NP mRNA, Northern blot hybridization was performed with poly(A)+ RNA from cells infected with rLaSota or rLaSota/CAT, each at passage 6. Northern blot hybridization was carried out as described herein. RNA was isolated from cells infected with either rLaSota or rLaSota/CAT at an m.o.i. of 1. Total RNA was extracted with TRIzol reagent and poly(A)+ mRNA was selected by using an mRNA isolation kit (Promega). mRNA samples were subjected to electrophoresis on 1-5% agarose gels containing 044 M formaldehyde, transferred to nitrocellulose membrane and used for hybridization with [32P]CTP-labelled riboprobes. The negative-sense CAT and NP probes where synthesized by in vitro transcription of linearized plasmids containing these genes. Hybridization of the mRNA extracted from rLaSota/CAT-infected cells with a negative-sense CAT-specific riboprobe detected a single major band of the size predicted for CAT mRNA (FIG. 8). Hybridization with a negative-sense riboprobe specific for the NP gene showed a single major band at the size predicted for NP mRNA in both rLaSota and rLaSota/CAT blots. Densitometry scanning did not show a significant difference in the level of NP mRNA synthesis between rLaSota and rLaSota/CAT. This result indicated that insertion of the CAT gene at the most 3′-proximal locus did not affect mRNA synthesis of the immediate downstream NP gene significantly.

EXAMPLE 2

[0079] In this working example, an embodiment of the invention in which the recombinant NDV containing a gene encoding CAT as the foreign gene inserted between the HN and L genes was prepared.

[0080] A. Construction of a Full-Length NDV cDNA Clone

[0081] A cDNA clone encoding the entire 15,186-nt antigenome of NDV strain Beaudette C was constructed from 8 cDNA segments that were synthesized by RT-PCR from NDV Beaudette C derived genomic RNA (FIG. 10; FIG. 11). The oligonucleotide primers used during full-length antigenomic cDNA synthesis and RT-PCR are shown in Table 2, in which the cDNA fragments correspond to the DNA fragments in FIG. 11. In Table 2, T7 promoter sequences are marked in italic type, the virus-specific sequences are underlined, and restriction sites are marked in bold type; the partial HDV ribozyme sequence (24-nt) overhang is shown in lowercase; and orientation of the primer sequence is shown for sense (+) and antisense (−). Each cDNA fragment was completely sequenced before assembly into the full-length cDNA clone. The leader end was constructed to join a promoter for T7 RNA polymerase. To generate a nearly exact 3′ end, the trailer end was constructed to join hepatitis delta virus (HDV) antigenome ribozyme sequence followed by tandem terminators of T7 transcription. Two restriction site markers were introduced into the antigenomic cDNA by incorporating the changes into the oligonucleotide primers used in RT-PCR in order to identify the recombinant virus. An Mlu I site was created in the F-HN intergenic region and the other unique Age I site was created in the HN-L intergenic region. Cloning of these cDNA fragments positioned the NDV cDNA between the T7 promoter and the hepatitis delta virus ribozyme sequence. The resulting recombinant pBR322 plasmid contained the full-length cDNA encoding the antigenome of NDV Beaudettel C. To facilitate transcription of the cDNA in the plasmid by T7 RNA polymerase later, three G resides were included before the NDV leader sequence.

[0082] To recover recombinant NDV from the cDNA located in the plasmid, the strategy shown in FIG. 14 was used. HEp2 cells were infected with recombinant vaccinia virus (MVA/T7) capable of synthesizing T7 RNA polymerase. The HEp2 cells were simultaneously transfected with (1) the recombinant plasmid pBR322 containing the cDNA encoding the antigenomic RNA of NDV Beaudette C, (2) a plasmid containing the NP gene under the control of the T7 promoter, (3) a plasmid containing the P gene under the control of the T7 promoter, and (4) a plasmid containing the L gene under the control of the T7 promoter. Three or four days after the transfection, infectious recombinant NDV was isolated from the supernatant by one of two ways. The supernatant was either injected into the allantoic cavities of 9-day-old embryonated eggs or amplified further in HEp-2 cells and DF1 cells (chicken embryo fibroblast cell line). An antigenomic (+)-sense RNA transcript was produced by transcription of the NDV full-length antigenomic cDNA.

[0083] B. Construction of Recombinant NDV Having a Foreign Gene Inserted Between the HN and L Genes

[0084] The recombinant pBR322 plasmid containing the cDNA clone encoding the entire 15,186-nt antigenome of NDV strain Beaudette C prepared in Part A of Working Example 2 above was used to construct the recombinant NDV having a foreign gene inserted. The gene encoding chloramphenicol acetyltransferase (CAT) was the foreign gene in this example. The sequence in the NH-L intergenic region of the full-length antigenome cDNA clone of NDV strain Beaudette C was modified to contain a unique Sna B I restriction site downstream of the Age I restriction site. The open reading frame (ORF) encoding the CAT protein was engineered to be flanked by the NDV GS and GE signals. This transcription cassette was inserted into the HN-L intergenic region of NDV full-length antigenomic cDNA to prepare a recombinant pBR322 containing the full-length antigenomic cDNA containing the CAT gene inserted between the HN and L genes (see FIG. 12; with a more detailed version shown in FIG. 13). In this construct, care was taken over the genome length preference called the “rule of six”, i.e. NDV having a preference, but not an absolute requirement, that the number of nucleotides in the genome is a multiple of six.

[0085] To recover the recombinant NDV containing the CAT gene, the strategy shown in FIG. 14 was used. The recombinant NDV recovery procedures described in Part B of this working example were used except that the HEp2 cells were simultaneously transfected with (1) the recombinant plasmid pBR322 containing NDV antigenomic cDNA having the CAT gene inserted, (2) a plasmid containing the NP gene, (3) a plasmid containing the P gene, and (4) a plasmid containing the L gene.

[0086] RT-PCR of the genomic RNA isolated from the recovered virus showed the presence of the inserted CAT gene. The recovered virus expressed abundant levels of CAT enzyme. In FIG. 15, lane 1 shows data from laboratory Beaudette C strain, and lane 2 shows data from recombinant Beaudette C strain containing the CAT gene. Analysis of mRNAs by Northern blot hybridization showed that the CAT gene was expressed as an additional, separate, poly(A) mRNA. CAT expression was stable for at least 8 passages, indicating that the activity of the CAT protein encoded by NDV remained unimpaired by mutation. There was no appreciable difference either in plaque phenotype or in growth kinetics between the virus recovered from the recombinant NDV and wild-type laboratory NDV strain.

EXAMPLE 3

[0087] Some of the characteristics of the recombinant viruses, rLaSota and rLaSota/CAT, were determined using the recombinant viruses recovered from transcription of the recombinant cDNA of NDV carrying the CAT gene inserted before the NP gene or between the HN and L genes as obtained in Examples 1 and 2.

[0088] A. Nucleotide Sequences

[0089] The nucleotide sequence of the recombinant cDNA for NDV LaSota expressing the CAT gene inserted in front of the NP gene as prepared in Example 1 is shown in Table 3, Parts a-d (labeled as LASO_CAT.TXT). The nucleotide sequence of the recombinant cDNA for NDV Beaudette C expressing the CAT gene inserted between the HN and L genes as prepared in Example 2 is shown in Table 4, Parts a-d (labeled as BC_CAT_.TXT).

[0090] B. Growth Characteristics of the Recombinant Viruses

[0091] The efficiency of replication in tissue culture of rLaSota, rLaSota/CAT and wild-type NDV LaSota was compared in a multiple-step growth cycle. Triplicate monolayers of DF1 cells were infected with each virus at an m.o.i. of 0·005 and samples were collected at 8 h intervals. The virus titers of these samples were quantified by plaque assay (FIG. 9). Both the kinetics and the magnitude of replication of the three viruses were very similar. However, the production of rLaSota/CAT was delayed slightly compared with rLaSota and wild-type NDV strain LaSota.

[0092] C. Determination of the Intracerebral Pathogenicity Index (ICPI) in 1-Day-Old Chicks

[0093] ICPI was used to determine the virulence of wild-type and recombinant NDVs in 1-day-old chicks. For each ICPI test, 151-day-old SPF chicks were used (ten birds for test and five birds for control). The inoculum consisted of fresh, infective allantoic fluid with an HA titer >24 (1:16) for the test birds and allantoic fluid from uninfected embryonated chicken eggs for control birds. Both inocula were diluted 1:10 in sterile PBS. Each bird was inoculated intracerebrally with 005 ml inoculum. The birds were observed for clinical signs and mortality every 24 h for a period of 8 days. The scoring and determination of ICPI were done according to the method described by Alexander (1997).

[0094] In order to compare the pathogenicity of rLaSota, rLaSota/CAT and wild-type NDV strain LaSota, ICPI tests in 1-day-old chicks were performed by scoring clinical signs and mortality. The most virulent NDV strains give indices close to 2.0, while avirulent viruses give values close to 0. In our experiment, the results of ICPI were 027 for wild-type NDV LaSota, 029 for rLaSota and 024 for rLaSota/CAT. These results show that the recombinant viruses were similar in virulence to wild-type NDV strain LaSota.

[0095] The results described here show that attenuated NDV can be used as a vaccine vector to express a foreign gene. Development of recombinant NDV as a vaccine vector has several applications. Several foreign genes can be inserted and expressed in the same virus to obtain simultaneous immune responses to the expressed antigens in inoculated animals. For example, a single recombinant NDV could be generated that expressed the immunogenic proteins of multiple avian pathogens. Alternatively, several NDVs, each expressing various heterologous antigens, could be administered as a multivalent vaccine. A further extension would be to use NDV vectors in non-avian species, where NDV is capable of undergoing incomplete replication to the extent necessary to express inserted genes. Thus, development of NDV as a vector should prove to be useful against avian and non-avian diseases for which suitable vaccines are not currently available.

EXAMPLE 4

[0096] A recombinant cDNA to the genome of NDV strain Beaudette C having a foreign gene, a gene encoding green fluorescent protein (GFP), inserted between P and M genes was prepared by inserting the GFP gene into the noncoding region of P gene after the P gene ORF and stop codon, but before the P gene GE signal (see FIG. 16). To allow the ORF of the GFP gene to be inserted into the noncoding region of the P gene, a XbaI site was created via mutation of a TCTCGC segment (nucleotide positions 3182-3187) in the P gene noncoding region after a stop codon forming a TCTAGA segment. The ORF of the GFP gene was preceded by a cDNA segment, TTAGAAAAAA, for a NDV gene end signal followed by a cDNA segment, ACGGGTAGM, for a NDV gene start signal. Transcription of a plasmid containing the recombinant cDNA to the NDV Beaudette C genome carrying the GFP gene inserted into the noncoding region of the P gene resulted in a recombinant NDV which was found to be able to express GFP.

REFERENCES

[0097] Alexander, D. J. (1997). Newcastle disease and other avian Paramyxoviridae infections. In Diseases of Poultry, 10th edition, pp. 541-569. Edited by B. W. Calnek, Iowa State University Press, Ames, Iowa.

[0098] Byrappa, S., Gavin, D. K. & Gupta, K. C. (1995). A highly efficient procedure for site-specific mutagenesis of full-length plasmids using Vent DNA polymerase. Genome Research 5, 404-407.

[0099] Conzelmann, K.-K. (1996). Genetic manipulation of non-segmented negative-strand RNA viruses. Journal of General Virology 77, 381-389.

[0100] de Leeuw, O. & Peeters, B. (1999). Complete nucleotide sequence of Newcastle disease virus: evidence for the existence of a new genus within the subfamily Paramyxovirinae. Journal of General Virology 80, 131-136.

[0101] Kingsbury, D. W. (1966). Newcastle disease virus. I. Isolation and preliminary characterization of RNA from virus particles. Journal of Molecular Biology 18, 195-203.

[0102] Krishnamurthy, S. & Samal, S. K. (1998). Nucleotide sequences of the trailer, nucleocapsid protein gene and intergenic regions of Newcastle disease virus strain Beaudette C and completion of the entire genome sequence. Journal of General Virology 79, 2419-2424.

[0103] Peeters, B. P., de Leeuw, O. S., Koch, G. & Gielkens, A. L. (1999). Rescue of Newcastle disease virus from cloned cDNA: evidence that cleavability of the fusion protein is a major determinant for virulence. Journal of Virology 73, 5001-5009.

[0104] Phillips, R. J., Samson, A. R. & Emmerson, P. T. (1998). Nucleotide sequence of the 5′-terminus of Newcastle disease virus and assembly of the complete genomic sequence: agreement with the ‘rule of six’. Archives of Virology 143, 1993-2002.

[0105] Römer-Oberdorfer, A., Mundt, E., Mebatsion, T., Buchholz, U. J. & Mettenleiter, T. C. (1999). Generation of recombinant lentogenic Newcastle disease virus from cDNA. Journal of General Virology 80, 2987-2995.

[0106] Steward, M., Vipond, I. B., Millar, N. S. & Emmerson, P. T. (1993). RNA editing in Newcastle disease virus. Journal of General Virology 74, 2539-2547. 1 TABLE 1 Oligonucleotide primers used for RT-PCR and assembly of full-length cDNA cDNA Primer Order of fragment Sense Antisense cloning I 5′ CTGAGGCGCGCCTAATACGACTCACTATAGG 5′ GTTTCCGCGGCTGGGTTGACTCCCCT 3′ 4 ACCAAACAGAGAATCCGTGAGTTAG 3′ II 5′ GGTGCCGCGGAAACAGCCAGG 3′ 5′ GAGCTGCGGCCGCTGTTATTTG 3′ 6 III 5′ AACAGCGGCCGCAGCTCTGAT 3′ 5′ TACAACGCGTAGTTTTTTCTTAACTC 3′ 7 IV 5′ AACTACGCGTTGTAGATGACCAAAG 3′ 5′ GCACTACGTATTTTGCCTTGTATCTC 3′ 5 V 5′ CAAAATACGTAATCGTAAATAATACGGGT 5′ TTCAGCTTAGCGAAGATCCGTCCATTAACT 3′ 3 AGGACATG 3′ VI 5′ TTCAGCTAAGCTGACAAAGAAGTTAAGG 5′ GTCTAGGCCTCTTACTCTCAGGTAATAG 3′ 1 AACTG 3′ VII 5′ TCAGAGGCCTAGACAATATTGTCT 3′ 5′ GATCCGGACCGcgaggaggtggagatgccatgccg 2 ACCAAACAAAGATTTGGTGAATGACGAG 3′

[0107] 2 TABLE 2 Oligonucleotide Primers Used during Full-Length cDNA Synthesis and RT-PCR cDNA Order of fragments Primers cloning I + 5′ACTGGGGCGCGCTAATACGACTCACTATAGGACCAAACAGAGAATCCGTAAGTTAG3′ 8 − 5′AGACCCGCGGCTGGGTTGACTTCCCTG3′ II + 5′AGACCCGCGGAAACAGCCAGG3′ 7 − 5′GCAGGGGCCCATCTTGCACCTAGAA3′ III + 5′ACAGGGGCCCCAGACCTTCTACCAA3′ 6 − 5′ATCGACGCGTAGTTTTTTCTAAACTCTC3′ IV + 5′ATCGACGCGTTGTAGATGACCAAAG3′ 5 − 5′GCACACCGGTAGCTGTTTTGCCTTGTATC3′ V + 5′GCACACCGGTAAATAGTACGGGTAGGACATG3′ 2 − 5′TTCAGCTTAGCGAAGATCCGTCCATTAAGT3′ VI + 5′TTCAGCTAAGCTGACAAAGAAGTTAAGGAACTG3′ 4 − 5′AAGCCTTAAGAACAATGTTTGGGCTTGCAAC3′ VII + 5′AAGCCTTAAGAAACATACGCAAAGAGTCCT3′ 3 − 5′TCAGAGGCCTTCTTACTCTCAGATAATAGAG3′ VIII − 5′TCAGAGGCCTTCTTACTCTCAGATAATAGAG3′ 1   5′ATGCCGGACCGcgaggaggtggagatgccatgccgACCCACCAAACAAAGATTTGGTGAATAACAAG3′

[0108] 3 TABLE 3 LASO_CAT.TXT (Part a) ACCAAACAGAGAATCCGTGAGTTACGATAAAAGGCGAAAGAGCAATTGAAGTCGCACGGGTAGAAGGTGTGAATCTCGAGTGCG AGCCCGAAGCACAAACTCGAGAAAGCCTTCTGCCAACGTTTAAACATGGAGAAAAAAATCACTGGATATACCACCGTTGATATA TCCCAATGGCATCGTAAAGAACATTTTGAGGCATTTCAGTCAGTTGCTCAATGTACCTATAACCAGACCGTTCAGCTGGATATT ACGGCCTTTTTAAAGACCGTAAAGAAAAATAAGCACAAGTTTTATCCGGCCTTTATTCACATTCTTGCCCGCCTGATGAATGCT CATCCGGAATTCCGTATGGCAATGAAAGACGGTGAGCTGGTGATATGGGATAGTGTTCACCCTTGTTACACCGTTTTCCATGAG CAAACTGAAACGTTTTCATCGCTCTGGAGTGAATACCACGACGATTTCCGGCAGTTTCTACACATATATTCGCAAGATGTGGCG TGTTACGGTGAAAACCTGGCCTATTTCCCTAAAGGGTTTATTGAGAATATGTTTTTCGTCTCAGCCAATCCCTGGGTGAGTTTC ACCAGTTTTGATTTAAACGTGGCCAATATGGACAACTTCTTCGCCCCCGTTTTCACCATGGGCAAATACTATACGCAAGGCGAC AAGGTGCTGATGCCGCTGGCGATTCAGGTTCATCATGCCGTTTGTGATGGCTTCCATGTCGGCAGAATGCTTAATGAATTACAA CAGTACTGCGATGAGTGGCAGGGCGGGGCGTAACTGCAGATTAGAAAAAACACGGGTAGAAGTTTAAACTAGGTGCAAGATGTC TTCCGTATTTGATGAGTACGAACAGCTCCTCGCGGCTCAGACTCGCCCCAATGGAGCTCATGGAGGGGGAGAAAAAGGGAGTAC CTTAAAAGTAGACGTCCCGGTATTCACTCTTAACAGTGATGACCCAGAAGATAGATGGAGCTTTGTGGTATTCTGCCTCCGGAT TGCTGTTAGCGAAGATGCCAACAAACCACTCAGGCAAGGTGCTCTCATATCTCTTTTATGCTCCCACTCACAGGTAATGAGGAA CCATGTTGCCCTTGCAGGGAAACAGAATGAAGCCACATTGGCCGTGCTTGAGATTGATGGCTTTGCCAACGGCACGCCCCAGTT CAACAATAGGAGTGGAGTGTCTGAAGAGAGAGCACAGAGATTTGCGATGATAGCAGGATCTCTCCCTCGGGCATGCAGCAACGG AACCCCGTTCGTCACAGCCGGGGCCGAAGATGATGCACCAGAAGACATCACCGATACCCTGGAGAGGATCCTCTCTATCCAGGC TCAAGTATGGGTCACAGTAGCAAAAGCCATGACTGCGTATGAGACTGCAGATGAGTCGGAAACAAGGCGAATCAATAAGTATAT GCAGCAAGGCAGGGTCCAAAAGAAATACATCCTCTACCCCGTATGCAGGAGCACAATCCAACTCACGATCAGACAGTCTCTTGC AGTCCGCATCTTTTTGGTTAGCGAGCTCAAGAGAGGCCGCAACACGGCAGGTGGTACCTCTACTTATTATAACCTGGTAGGGGA CGTAGACTCATACATCAGGAATACCGGGCTTACTGCATTCTTCTTGACACTCAAGTACGGAATCAACACCAAGACATCAGCCCT TGCACTTAGTAGCCTCTCAGGCGACATCCAGAAGATGAAGCAGCTCATGCGTTTGTATCGGATGAAAGGAGATAATGCGCCGTA CATGACATTACTTGGTGATAGTGACCAGATGAGCTTTGCGCCTGCCGAGTATGCACAACTTTACTCCCTTGCCATGGGTATGGC ATCAGTCCTAGATAAAGGTACTGGGAAATACCAATTTGCCAGGGACTTTATGAGCACATCATTCTGGAGACTTGGAGTAGAGTA CGCTCAGGCTCAGGGAAGTAGCATTAACGAGGATATGGCTGCCGAGCTAAAGCTAACCCCAGCAGCAAGGAGGGGCCTGGCAGC TGCTGCCCAACGGGTCTCCGAGGAGACCAGCAGCATAGACATGCCTACTCAACAAGTCGGAGTCCTCACTGGGCTTAGCGAGGG GGGGTCCCAAGCTCTACAAGGCGGATCGAATAGATCGCAAGGGCAACCAGAAGCCGGGGATGGGGAGACCCAATTCCTGGATCT GATGAGAGCGGTAGCAAATAGCATGAGGGAGGCGCCAAACTCTGCACAGGGCACTCCCCAATCGGGGCCTCCCCCAACTCCTGG GCCATCCCAAGATAACGACACCGACTGGGGGTATTGATGGACAAAACCCAGCCTGCTTCCACAAAAACATCCCAATGCCCTCAC CCGTAGTCGACCCCTCGATTTGCGGCTCTATATGACCACACCCTCAAACAAACATCCCCCTCTTTCCTCCCTCCCCCTGCTGTA CAACTCCGCACGCCCTAGATACCACAGGCACAATGCGGCTCACTAACAATCAAAACAGAGCCGAGGGAATTAGAAAAAAGTACG GGTAGAAGAGGGATATTCAGAGATCAGGGCAAGTCTCCCGAGTCTCTGCTCTCTCCTCTACCTGATAGACCAGGACAAACATGG CCACCTTTACAGATGCAGAGATCGACGAGCTATTTGAGACAAGTGGAACTGTCATTGACAACATAATTACAGCCCAGGGTAAAC CAGCAGAGACTGTTGGAAGGAGTGCAATCCCACAAGGCAAGACCAAGGTGCTGAGCGCAGCATGGGAGAAGCATGGGAGCATCC AGCCACCGGCCAGTCAAGACAACCCCGATCGACAGGACAGATCTGACAAACAACCATCCACACCCGAGCAAACGACCCCGCATG ACAGCCCGCCGGCCACATCCGCCGACCAGCCCCCCACCCAGGCCACAGACGAAGCCGTCGACACACAGCTCAGGACCGGAGCAA GCAACTCTCTGCTGTTGATGCTTGACAAGCTCAGCAATAAATCGTCCAATGCTAAAAAGGGCCCATGGTCGAGCCCCCAAGAGG GGAATCACCAACGTCCGACTCAACAGCAGGGGAGTCAACCCAGCCGCGGAAACAGTCAGGAAAGACCGCAGAACCAAGTCAAGG CCGCCCCTGGAAACCAGGGCACAGACGTGAACACAGCATATCATGGACAATGGGAGGAGTCACAACTATCAGCTGGTGCAACCC CTCATGCTCTCCGATCAAGGCAGAGCCAAGACAATACCCTTGTATCTGCGGATCATGTCCAGCCACCTGTAGACTTTGTGCAAG CGATGATGTCTATGATGGAGGCGATATCACAGAGAGTAAGTAAGGTCGACTATCAGCTAGATCTTGTCTTGAAACAGACATCCT CCATCCCTATGATGCGGTCCGAAATCCAACAGCTGAAAACATCTGTTGCAGTCATGGAAGCCAACTTGGGAATGATGAAGATTC TGGATCCCGGTTGTGCCAACATTTCATCTCTGAGTGATCTACGGGCAGTTGCCCGATCTCACCCGGTTTTAGTTTCAGGCCCTG GAGACCCCTCTCCCTATGTGACACAAGGAGGCGAAATGGCACTTAATAAACTTTCGCAACCAGTGCCACATCCATCTGAATTGA TTAAACCCGCCACTGCATGCGGGCCTGATATAGGAGTGGAAAAGGACACTGTCCGTGCATTGATCATGTCACGCCCAATGCACC CGAGTTCTTCAGCCAAGCTCCTAAGCAAGTTAGATGCAGCCGGGTCGATCGAGGAAATCAGGAAAATCAAGCGCCTTGCTCTAA ATGGCTAATTACTACTGCCACACGTAGCGGGTCCCTGTCCACTCGGCATCACACGGAATCTGCACCGAGTTCCCCCCCGCAGAC CCAAGGTCCAACTCTCCAAGCGGCAATCCTCTCTCGCTTCCTCAGCCCCACTGAATGGTCGCGTAACCGTAATTAATCTAGCTA CATTTAAGATTAAGAAAAAATACGGGTAGAATTGGAGTGCCCCAATTGTGCCAAGATGGACTCATCTAGGACAATTGGGCTGTA CTTTGATTCTGCCCATTCTTCTAGCAACCTGTTAGCATTTCCGATCGTCCTACAAGGCACAGGAGATGGGAAGAAGCAAATCGC CCCGCAATATAGGATCCAGCGCCTTGACTTGTGGACTGATAGTAAGGAGGACTCAGTATTCATCACCACCTATGGATTCATCTT TCAAGTTGGGAATGAAGAAGCCACTGTCGGCATGATCGATGATAAACCCAAGCGCGAGTTACTTTCCGCTGCGATGCTCTGCCT AGGAAGCGTCCCAAATACCGGAGACCTTATTGAGCTGGCAAGGGCCTGTCTCACTATGATAGTCACATGCAAGAAGAGTGCAAC TAATACTGAGAGAATGGTTTTCTCAGTAGTGCAGGCACCCCAAGTGCTGCAAAGCTGTAGGGTTGTGGCAAACAAATACTCATC AGTGAATGCAGTCAAGCACGTGAAAGCGCCAGAGAAGATTCCCGGGAGTGGAACCCTAGAATACAAGGTGAACTTTGTCTCCTT GACTGTGGTACCGAAGAAGGATGTCTACAAGATCCCTGCTGCAGTATTGAAGGTTTCTGGCTCGAGTCTGTACAATCTTGCGCT CAATGTCACTATTAATGTGGAGGTAGACCCGAGGAGTCCTTTGGTTAAATCTCTGTCTAAGTCTGACAGCGGATACTATGCTAA CCTCTTCTTGCATATTGGACTTATGACCACCGTAGATAGGAAGGGGAAGAAAGTGACATTTGACAAGCTGGAAAAGAAAATAAG GAGCCTTGATCTATCTGTCGGGCTCAGTGATGTGCTCGGGCCTTCCGTGTTGGTAAAAGCAAGAGGTGCACGGACTAAGCTTTT GGCACCTTTCTTCTCTAGCAGTGGGACAGCCTGCTATCCCATAGCAAATGCTTCTCCTCAGGTGGCCAAGATACTCTGGAGTCA AACCGCGTGCCTGCGGAGCGTTAAAATCATTATCCAAGCAGGTACCCAACGCGCTGTCGCAGTGACCGCCGACCACGAGGTTAC CTCTACTAAGCTGGAGAAGGGGCACACCCTTGCCAAATACAATCCTTTTAAGAAATAAGCTGCGTCTCTGAGATTGCGCTCCGC CCACTCACCCAGATCATCATGACACAAAAAACTAATCTGTCTTGATTATTTACAGTTAGTTTACCTGTCTATCAAGTTAGAAAA AACACGGGTAGAAGATTCTGGATCCCGGTTGGCGCCCTCCAGGTGCAAGATGGGCTCCAGACCTTCTACCAAGAACCCAGCACC (Part b) TATGATGCTGACTATCCGGGTTGCGCTGGTACTGAGTTGCATCTGTCCGGCAAACTCCATTGATGGCAGGCCTCTTGCAGCTGC AGGAATTGTGGTTACAGGAGACAAAGCCGTCAACATATACACCTCATCCCAGACAGGATCAATCATAGTTAAGCTCCTCCCGAA TCTGCCCAAGGATAAGGAGGCATGTGCGAAAGCCCCCTTGGATGCATACAACAGGACATTGACCACTTTGCTCACCCCCCTTGG TGACTCTATCCGTAGGATACAAGAGTCTGTGACTACATCTGGAGGGGGGAGACAGGGGCGCCTTATAGGCGCCATTATTGGCGG TGTGGCTCTTGGGGTTGCAACTGCCGCACAAATAACAGCGGCCGCAGCTCTGATACAAGCCAAACAAAATGCTGCCAACATCCT CCGACTTAAAGAGAGCATTGCCGCAACCAATGAGGCTGTGCATGAGGTCACTGACGGATTATCGCAACTAGCAGTGGCAGTTGG GAAGATGCAGCAGTTTGTTAATGACCAATTTAATAAAACAGCTCAGGAATTAGACTGCATCAAAATTGCACAGCAAGTTGGTGT AGAGCTCAACCTGTACCTAACCGAATTGACTACAGTATTCGGACCACAAATCACTTCACCTGCTTTAAACAAGCTGACTATTCA GGCACTTTACAATCTAGCTGGTGGAAATATGGATTACTTATTGACTAAGTTAGGTGTAGGGAACAATCAACTCAGCTCATTAAT CGGTAGCGGCTTAATCACCGGTAACCCTATTCTATACGACTCACAGACTCAACTCTTGGGTATACAGGTAACTCTACCTTCAGT CGGGAACCTAAATAATATGCGTGCCACCTACTTGGAAACCTTATCCGTAAGCACAACCAGGGGATTTGCCTCGGCACTTGTCCC AAAAGTGGTGACACAGGTCGGTTCTGTGATAGAAGAACTTGACACCTCATACTGTATAGAAACTGACTTAGATTTATATTGTAC AAGAATAGTAACGTTCCCTATGTCCCCTGGTATTTATTCCTGCTTGAGCGGCAATACGTCGGCCTGTATGTACTCAAAGACCGA AGGCGCACTTACTACACCATACATGACTATCAAAGGTTCAGTCATCGCCAACTGCAAGATGACAACATGTAGATGTGTAAACCC CCCGGGTATCATATCGCAAAACTATGGAGAAGCCGTGTCTCTAATAGATAAACAATCATGCAATGTTTTATCCTTAGGCGGGAT AACTTTAAGGCTCAGTGGGGAATTCGATGTAACTTATCAGAAGAATATCTCAATACAAGATTCTCAAGTAATAATAACAGGCAA TCTTGATATCTCAACTGAGCTTGGGAATGTCAACAACTCGATCAGTAATGCTTTGAATAAGTTAGAGGAAAGCAACAGAAAACT AGACAAAGTCAATGTCAAACTGACCAGCACATCTGCTCTCATTACCTATATCGTTTTGACTATCATATCTCTTGTTTTTGGTAT ACTTAGCCTGATTCTAGCATGCTACCTAATGTACAAGCAAAAGGCGCAACAAAAGACCTTATTATGGCTTGGGAATAATACCCT AGATCAGATGAGAGCCACTACAAAAATGTGAACACAGATGAGGAACGAAGGTTTCCCTAATAGTAATTTGTGTGAAAGTTCTGG TAGTCTGTCAGTTCAGAGAGTTAAGAAAAAACTACGCGTTGTAGATGACCAAAGGACGATATACGGGTAGAACGGTAAGAGAGG CCGCCCCTCAATTGCGAGCCAGGCTTCACAACCTCCGTTCTACCGCTTCACCGACAACAGTCCTCAATCATGGACCGCGCCGTT AGCCAAGTTGCGTTAGAGAATGATGAAAGAGAGGCAAAAAATACATGGCGCTTGATATTCCGGATTGCAATCTTATTCTTAACA GTAGTGACCTTGGCTATATCTGTAGCCTCCCTTTTATATAGCATGGGGGCTAGCACACCTAGCGATCTTGTAGGCATACCGACT AGGATTTCCAGGGCAGAAGAAAAGATTACATCTACACTTGGTTCCAATCAAGATGTAGTAGATAGGATATATAAGCAAGTGGCC CTTGAGTCTCCGTTGGCATTGTTAAAAACTGAGACCACAATTATGAACGCAATAACATCTCTCTCTTATCAGATTAATGGAGCT GCAAACAACAGTGGGTGGGGGGCACCTATCCATGACCCAGATTATATAGGGGGGATAGGCAAAGAACTCATTGTAGATGATGCT AGTGATGTCACATCATTCTATCCCTCTGCATTTCAAGAACATCTGAATTTTATCCCGGCGCCTACTACAGGATCAGGTTGCACT CGAATACCCTCATTTGACATGAGTGCTACCCATTACTGCTACACCCATAATGTAATATTGTCTGGATGCAGAGATCACTCACAT TCATATCAGTATTTAGCACTTGGTGTGCTCCGGACATCTGCAACAGGGAGGGTATTCTTTTCTACTCTGCGTTCCATCAACCTG GACGACACCCAAAATCGGAAGTCTTGCAGTGTGAGTGCAACTCCCCT6GGTTGTGATATGCTGTGCTCGAAAGTCACGGAGACA GAGGAAGAAGATTATAACTCAGCTGTCCCTACGCGGATGGTACATGGGAGGTTAGGGTTCGACGGCCAGTACCACGAAAAGGAC CTAGATGTCACAACATTATTCGGGGACTGGGTGGCCAACTACCCAGGAGTAGGGGGTGGATCTTTTATTGACAGCCGCGTATGG TTCTCAGTCTACGGAGGGTTAAAACCCAATTCACCCAGTGACACTGTACAGGAAGGGAAATATGTGATATACAAGCGATACAAT GACACATGCCCAGATGAGCAAGACTACCAGATTCGAATGGCCAAGTCTTCGTATAAGCCTGGACGGTTTGGTGGGAAACGCATA CAGCAGGCTATCTTATCTATCAAGGTGTCAACATCCTTAGGCGAAGACCCGGTACTGACTGTACCGCCCAACACAGTCAVACTC ATGGGGGCCGAAGGCAGAATTCTCACAGTAGGGACATCTCATTTCTTGTATCAACGAGGGTCATCATACTTCTCTCCCGCGTTA TTATATCCTATGACAGTCAGCAACAAAACAGCCACTCTTCATAGTCCTTATACATTCAATGCCTTCACTCGGCCAGGTAGTATC CCTTGCCAGGCTTCAGCAAGATGCCCCAACTCGTGTGTTACTGGAGTCTATACAGATCCATATCCCCTAATCTTCTATAGAAAC CACACCTTGCGAGGGGTATTCGGGACAATGCTTGATGGTGTACAAGCAAGACTTAACCCTGCGTCTGCAGTATTCGATAGCACA TCCCGCAGTCGCATTACTCGAGTGAGTTCAAGCAGTACCAAAGCAGCATACACAACATCAACTTGTTTTAAAGTGGTCAAGACT AATAAGACCTATTGTCTCAGCATTGCTGAAATATCTAATACTCTCTTCGGAGAATTCAGAATCGTCCCGTTACTAGTTGAGATC CTCAAAGATGACGGGGTTAGAGAAGCCAGGTCTGGCTAGTTGAGTCAATTATAAAGGAGTTGGAAAGATGGCATTGTATCACCT ATCTTCTGCGACATCAAGAATCAAACCGAATGCCGGCGCGTGCTCGAATTCCATGTTGCCAGTTGACCACAATCAGCCAGTGCT CATGCGATCAGATTAAGCCTTGTCATTAATCTCTTGATTAAGAAAAAATGTAAGTGGCAATGAGATACAAGGCAAAATACGTAC CGGTAAATAATACGGGTAGGACATGGCGAGCTCCGGTCCTGAAAGGGCAGAGCATCAGATTATCCTACCAGAGCCACACCTGTC TTCACCATTGGTCAAGCACAAACTACTCTATTACTGGAAATTAACTGGGCTACCGCTTCCTGATGAATGTGACTTCGACCACCT CATTCTCAGCCGACAATGGAAAAAAATACTTGAATCGGCCTCTCCTGATACTGAGAGAATGATAAAACTCGGAAGGGCAGTACA CCAAACTCTTAACCACAATTCCAGAATAACCGGAGTGCTCCACCCCAGGTGTTTAGAACAACTGGCTAATATTGAGGTCCCAGA TTCAACCAACAAATTTCGGAAGATTGAGAAGAAGATCCAAATTCACAACACGAGATATGGAGAACTGTTCACAAGGCTGTGTAC GCATATAGAGAAGAAACTGCTGGGGTCATCTTGGTCTAACAATGTCCCCCGGTCAGAGGAGTTCAGCAGCATTCGTACGGATCC GGCATTCTGGTTTCACTCAAAATGGTCCACAGCCAAGTTTGCATGGCTCCATATAAAACAGATCCAGAGGCATCTGATGGTGGC AGCTAAGACAAGGTCTGCGGCCAACAAATTGGTGATGCTAACCCATAAGGTAGGCCAAGTCTTTGTCACTCCTGAACTTGTCGT TGTGACGCATACGAATGAGAACAAGTTCACATGTCTTACCCAGGAACTTGTATTGATGTATGCAGATATGATGGAGGGCAGAGA TATGGTCAACATAATATCAACCACGGCGGTGCATCTCAGAAGCTTATCAGAGAAAATTGATGACATTTTGCGGTTAATAGACGC TCTGGCAAAAGACTTGGGTAATCAAGTCTACGATGTTGTATCACTAATGGAGGGATTTGCATACGGAGCTGTCCAGCTACTCGA GCCGTCAGGTACATTTGCAGGAGATTTCTTCGCATTCAACCTGCAGGAGCTTAAAGACATTCTAATTGGCCTCCTCCCCAATGA TATAGCAGAATCCGTGACTCATGCAATCGCTACTGTATTCTCTGGTTTAGAACAGAATCAAGCAGCTGAGATGTTGTGTCTGTT GCGTCTGTGGGGTCACCCACTGCTTGAGTCCCGTATTGCAGCAAAGGCAGTCAGGAGCCAAATGTGCGCACCGAAAATGGTAGA CTTTGATATGATCCTTCAGGTACTGTCTTTCTTCAAGGGAACAATCATCAACGGGTACAGAAAGAAGAATGCAGGTGTGTGGCC GCGAGTCAAAGTGGATACAATATATGGGAAGGTCATTGGGCAACTACATGCAGATTCAGCAGAGATTTCACACGATATCATGTT GAGAGAGTATAAGAGTTTATCTGCACTTGAATTTGAGCCATGTATAGAATATGACCCTGTCACCAACCTGAGCATGTTCCTAAA AGACAAGGCAATCGCACACCCCAACGATAATTGGCTTGCCTCGTTTAGGCGGAACCTTCTCTCCGAAGACCAGAAGAAACATGT (Part c) AAAAGAAGCAACTTCGACTAATCGCCTCTTGATAGAGTTTTTAGAGTCAAATGATTTTGATCCATATAAAGAGATGGAATATCT GACGACCCTTGAGTACCTTAGAGATGACAATGTGGCAGTATCATACTCGCTCAAGGAGAAGGAAGTGAAAGTTAATGGACGGAT CTTCGCTAAGCTGACAAAGAAGTTAAGGAACTGTCAGGTGATGGCGGAAGGGATCCTAGCCGATCAGATTGCACCTTTCTTTCA GGGAAATGGAGTCATTCAGGATAGCATATCCTTGACCAAGAGTATGCTAGCGATGAGTCAACTGTCITTTAACAGCAATAAGAA ACGTATCACTGACTGTAAAGAAAGAGTATCTTCAAACCGCAATCATGATCCGAAAAGCAAGAACCGTCGGAGAGTTGCAACCTT CATAACAACTGACCTGCAAAAGTACTGTCTTAATTGGAGATATCAGACAATCAAATTGTTCGCTCATGCCATCAATCACTTGAT GGGCCTACCTCACTTCTTCGAATGGATTCACCTAAGACTGATGGACACTACGATGTTCGTAGGAGACCCTTTCAATCCTCCAAG TGACCCTACTGACTGTGACCTCTCAAGAGTCCCTAATGATGACATATATATTGTCAGTGCCAGAGGGGGTATCGAAGGATTATG CCAGAAGCTATGGACAATGATCTCAATTGCTGCAATCCAACTTGCTGCAGCTAGATCGCATTGTCGTGTTGCCTGTATGGTACA GGGTGATAATCAAGTAAIAGCAGTAACGAGAGAGGTAAGATCAGACGACTCTCCGGAGATGGTGTTGACACAGTTGCATCAAGC CAGTGATAATTTCTTCAAGGAATTAATTCATGTCAATCATTTGATTGGCCATAATTTGAAGGATCGTGAAACCATCAGGTCAGA CACATTCTTCATATACAGCAAACGAATCTTCAAAGATGGAGCAATCCTCAGTCAAGTCCTCAAAAATTCATCTAAATTAGTGCT AGTGTCAGGTGATCTCAGTGAAAACACCGTAATGTCCTGTGCCAACATTGCCTCTACTGTAGCACGGCTATGCGAGAACGGGCT TCCCAAAGACTTCTGTTACTATTTAAACTATATAATGAGTTGTGTGCAGACATACTTTGACTCTGAGTTCTCCATCACCAACAA TTCGCACCCCGATCTTAATCAGTCGTGGATTGAGGACATCTCTTTTGTGCACTCATATGTTCTGACICCTGCCCAATTAGGGGG ACTGAGTAACCTTCAATACTCAAGGCTCTACACTAGAAATATCGGTGACCCGGGGACTACTGCTTTTGCAGAGATCAAGCGACT AGAAGCAGTGGGATTACTGAGTCCTAACATTATGACTAATATCTTAACTAGGCCGCCTGGGAATGGAGATTGGGCCAGTCTGTG CAACGACCCATACTCTTTCAATTTTGAGACTGTTGCAAGCCCAAATATTGTTCTTAAGAAACATACGCAAAGAGTCCTATTTGA AACTTGTTCAAATCCCTTATTGTCTGGAGTGCACACAGAGGATAATGAGGCAGAAGAGAAGGCATTGGCTGAATTCTTGCTTAA TCAAGAGGTGATTCATCCCCGCGTTGCGCATGCCATCATGGAGGCAAGCTCTGTAGGTAGGAGAAAGCAAATTCAAGGGCTTGT TGACACAACAAACACCGTAATTAAGATTGCGCTTACTAGGAGGCCATTAGGCATCAAGAGGCTGATGCGGATAGTCAATTATTC TAGCATGCATGCAATGCTGTTTAGAGACGATGTTTTTTCCTCCAGTAGATCCAACCACCCCTTAGTCTCTTCTAATATGTGTTC TCTGACACTGGCAGACTATGCACGGAATAGAAGCTGGTCACCTTTGACGGGAGGCAGGAAAATACTGGGTGTATCTAATCCTGA TACGATAGAACTCGTAGAGGGTGAGATTCTTAGTGTAAGCGGAGGGTGTACAAGATGTGACAGCGGAGATGAACAATTTACTTG GTTCCATCTTCCAAGCAATATAGAATTGACCGATGACACCAGCAAGAATCCTCCGATGAGGGTACCATATCTCGGGTCAAAGAC ACAGGAGAGGAGAGCTGCCTCACTTGCAAAAATAGCTCATATGTCGCCACATGTAAAGGCTGCCCTAAGGGCATCATCCGTGTT GATCTGGGCTTATGGGGATAATGAAGTAAATTGGACTGCTGCTCTTACGATTGCAAAATCTCGGTGTAATGTAAACTTAGAGTA TCTTCGGTTACTGTCCCCTTTACCCACGGCTGGGAATCTTCAACATAGACTAGATGATGGTATAACTCAGATGACATTCACCCC TGCATCTCTCTACAGGTGTCACCTTACATTCACATATCCAATGATTCTCAAAGGCTGTTCACTGAAGAAGGAGTCAAAGAGGGG AATGTGGTTTACCAACAGAGTCATGCTCTTGGGTTTATCTCTAATCGAATCGATCITTCCAATGACAACAACCAGGACATATGA TGAGATCACACTGCACCTACATAGTAAATTTAGTTGCTGTATCAGAGAAGCACCTGTTGCGGTTCCTTTCGAGCTACTTGGGGT GGTACCGGAACTGAGGACAGTGACCTCAAATAAGTTTATGTAIGATCCTAGCCCTGTATCGGAGGGAGACTTTGCGAGACTTGA CTTAGCTATCTTCAAGAGTTATGAGCTTAATCTGGAGTCATATCCCACGATAGAGCTAATGAACATTCTTTCAATATCCAGCGG GAAGTTGATTGGCCAGTCTGTGGTTTCTTATGATGAAGATACCTCCATAAAGAATGACGCCATAATAGTGTATGACAATACCCG AAATTGGATCAGTGAAGCTCAGAATTCAGATGTGGTCCGCCTATTTGAATATGCAGCACTTGAAGTGCTCCTCGACTGTTCTTA CCAACTCTATTACCTGAGAGTAAGAGGCCTAGACAATATTGTCTTATATATGGGTGATTTATACAAGAATATGCCAGGAATTCT ACTTTCCAACATTGCAGCTACAATATCTCATCCCGTCATTCATTCAAGGTTACATGCAGTGGGCCTGGTCAACCATGACGGATC ACACCAACTTGCAGATACGGATTTTATCGAAATGTCTGCAAAACTATTAGTATCTTGCACCCGACGTGTGATCTCCGGCTTATA TTCAGGAAATAAGTATGATCTGCTGTTCCCATCTGTCTTAGATGATAACCTGAATGAGAAGATGCTTCAGCTGATATCCCGGTT ATGCTGTCTGTACACGGTACTCTTTGCTACAACAAGAGAAATCCCGAAAATAAGAGGCTTAACTGCAGAAGAGAAATGTTCAAT ACTCACTGAGTATTTACTGTCGGATGCTGTGAAACCATTACTTAGCCCCGATCAAGTGAGCTCTATCATGTCTCCTAACATAAT TACATTCCCAGCTAATCTGTACTACATGTCTCGGAAGAGCCTCAATTTGATCAGGGAAAGGGAGGACAGGGATACTATCCTGGC GTTGTTGTTCCCCCAAGAGCCATTATTAGAGTTCCCTTCTGTGCAAGATATTGGTGCTCGAGTGAAAGATCCATTCACCCGACA ACCTGCGGCATTTTTGCAAGAGTTAGATTTGAGTGCTCCAGCAAGGTATGACGCATTCACACTTAGTCAGATTCATCCTGAACT CACATCTCCAAATCCGGAGGAAGACTACTTAGTACGATACTTGTTCAGAGGGATAGGGACTGCATCTTCCTCTTGGTATAAGGC ATCTCATCTCCTTTCTGTACCCGAGGTAAGATGTGCAAGACACGGGAACTCCTTATACTTAGCTGAAGGGAGCGGAGCCATCAT GAGTCTTCTCGAACTGCATGTACCACATGAAACTATCTATTACAATACGCTCTTTTCAAATGAGATGAACCCCCCGCAACGACA TTTCGGGCCGACCCCAACTCAGTTTTTGAATTCGGTTGTTTATAGGAATCTACAGGCGGAGGTAACATGCAAAGATGGATTTGT CCAAGAGTTCCGTCCATTATGGAGAGAAAATACAGAGGAAAGTGACCTGACCTCAGATAAAGCAGTGGGGTATATTACATCTGC AGTGCCCTACAGATCTGTATCATTGCTGCATTGTGACATTGAAATTCCTCCAGGGTCCAATCAAAGCTTACTAGATCAACTAGC TATCAATTTATCTCTGATTGCCATGCATTCTGTAAGGGAGGGCGGGGTAGTAATCATCAAAGTGTTGTATGCAATGGGATACTA CTTTCATCTACTCATGAACTTGTTTGCTCCGTGTTCCACAAAAGGATATATTCTCTCTAATGGTTATGCATGTCGAGGAGATAT GGAGTGTTACCTGGTATTTGTCATGGGTTACCTGGGCGGGCCTACATTTGTACATGAGGTGGTGAGGATGGCAAAAACTCTGGT GCAGCGGCACGGTACGCTCTTGTCTAAATCAGATGAGATCACACTGACCAGGTTATTCACCTCACAGCGGCAGCGTGTGACAGA CATCCTATCCAGTCCTTTACCAAGATTAATAAAGTACTTGAGGAAGAATATTGACACTGCGCTGATTGAAGCCGGGGGACAGCC CGTCCGTCCATTCTGTGCGGAGAGTCTGGTGAGCACGCTAGCGAACATAACTCAGATAACCCAGATTATCGCTAGTCACATTGA CACAGTTATCCGGTCTGTGATATATATGGAAGCTGAGGGTGATCTCGCTGACACAGTATTTCTATTTACCCCTTACAATCTCTC TACTGACGGGAAAAAGAGGACATCACTTATACAGTGCACGAGACAGATCCTAGAGGTTACAATACTAGGTCTTAGAGTCGAAAA TCTCAATAAAATAGGCGATATAATCAGCCTAGTGCTTAAAGGCATGATCTCCATGGAGGACCTTATCCCACTAAGGACATACTT GAAGCATAGTACCTGCCCTAAATATTTGAAGGCTGTCCTAGGTATTACCAAACTCAAAGAAATGTTTACAGACACTTCTGTATT GTACTTGACTCGTGCTCAACAAAAATTCTACATGAAAACTATAGGCAATGCAGTCAAAGGATATTACAGTAACTGTGACTCTTA ACGAAAATCACATATTAATAGGCTCCTTTTTTGGCCAATTGTATTCTTGTTGATTTAATCATATTATGTTAGAAAAAAGTTGAA CCCTGACTCCTTAGGACTCGAATTCGAACTCAAATAAATGTCTTAAAAAAAGGTTGCGCACAATTATTCTTGAGTGTAGTCTCG (Part d) TCATTCACCAAATCTTTGTTTGGT

[0109] 4 TABLE 4 BC_CAT_.TXT (Part a) ACCAAACAGAGAATCCGTAAGTTACGATAAAAGGCGAAGGAGCAATTGAAGTTGCACGGGTAGAAGGTGTGAATCTCGAGTGCG AGCCCGAAGCACAAACTCGAGAAAGCCTTCTGCCAACATGTCTTCCGTATTTGACGAGTACGAACAGCTCCTCGCGGCTCAGAC TCGCCCCAATGGAGCTCATGGAGGAGGGGAAAAGGGGAGTACCTTAAAAGTAGACGTCCCGGTATTCACTCTTAACAGTGATGA CCCAGAAGATAGGTGGAACTTTGCGGTATTCTGCCTCCGGATTGCTGTTAGCGAAGATGCCAACAAACCACTCAGGCAAGGTGC TCTCATATCTCTTTTATGCTCCCACTCACAAGTGATGAGGAACCATGTTGCCCTTGCAGGGAAACAGAATGAAGCCACATTGGC CGTGCTTGAGATTGATGGCTTTGCCAACGGTATGCCCCAGTTCAACAATAGGAGTGGAGTGTCTGAAGAGAGAGCACAGAGATT CGCGATGATAGCAGGGTCTCTCCCTCGGGCATGCAGTAATGGCACCCCGTTCGTCACAGCCGGGGCCGAAGATGATGCACCAGA AGATATCACCGATACCCTGGAGAGGATCCTCTCTATCCAGGCCCAAGTATGGGTCACAGTAGCAAAAGCCATGACTGCGTATGA GACTGCAGATGAGTCTGAAACAAGACGAATCAGTAAGTATATGCAGCAAGGCAGGGTCCAAAAGAAATACATCCTCTACCCCGT ATGCAGGAGCACAATCCAACTCACGATCAGACAGTCTCTTGCAGTCCGCATCTTTTTGGTTAGCGAGCTCAAGAGAGGCCGCAA CACGGCAGGTGGTACCTCTACTTATTATAACCTAGTAGGGGACGTAGACTCATATATCAGGAATACCGGGCTTACTGCATTCTT CTTGACACTCAAGTACGGAATTAACACCAAGACATCAGCCCTTGCACTTAGTAGCCTCTCAGGCGACATCCAGAAAATGAAGCA GCTCATGCGTTTATATCGGATGAAAGGAGATAATGCGCCGTACATGACATTGCTTGGTGATAGTGACCAGATGAGCTTTGCGCC TGCCGAGTATGCACAACTTTACTCCTTCGCCATGGGTATGGCATCAGTCCTAGATAAAGGTACTGGGAAATACCAATTTGCCAG GGACTTTATGAGCACATCATTCTGGAGACTTGGAGTAGAGTACGCTCAGGCTCAGGGAAGTAGCATTAACGAGGATATGGCTGC CGAGCTAAAGTTAACCCCAGCAGCAAGGAGAGGCCTGGCAGCTGCTGCCCAACGAGTCTCTGAGGAGACCAGCAGCATAGACAT GCCTACTCAACAAGTCGGAGTCCTCACTGGGCTCAGCGAGGGGGGGTCCCAAGCCCTACAAGGCGGATCGAATAGATCGCAAGG GCAACCAGAAGCCGGGGATGGGGAGACCCAATTCCTGGATCTGATGAGAGCGGTAGCAAATAGCATGAGGGAAGCGCCAAACTC TGCACAGGGCACTCCCCAATCGGGGCCTCCCCCAACTCCTGGGCCATCTCAAGATAACGACACCGACTGGGGGTATTGATTGAC AAAACCCAGCTTGCTTCCACAAAATCATCCCAATATCCTCACCCGTAGTCGACCCCTCGATTTGCGGCCCTATATGACCACACC CACAAACAAACATCCCCCTCTTTCCTCCCTCCCCCTGCTGTACAACTCCGCACGCCCTAGGTACCACAGGCACAATGCGGCTCA CTAACAATCAAAACAGAGCCGAGGAAATTAGAAAAAAATACGGGTAGAAGAGGGATATTCAGAGACCAGGGCAAGTCACCCGAG TCTCTGCTCTCTCCTCTACCTGATAGATTAGGACAAATATGGCCACCTTTACAGATGCGGAGATCGACGAGCTATTTGAGACAA GTGGAACTGTGATTGACAACATAATTACAGCCCAGGGTAAATCAGCAGAGACTGTTGGAAGGAGTGCAATCCCACATGGCAAAA CCAAGGCGCTGAGCGCAGCATGGGAGAAGCATGGGAGCATCCAGCCACCGGCCAGTCAAGACACCCCTGATCGACAGGACAGAT CTGACAAACAACCATCCACACCCGAGCAAGCGACCCCGCATGACAGCCCGCCGGCCACATCCGCCGACCAGCCCCCCACCCAGG CCACAGACGAAGCCGTCGACACACAGCTCAGGACCGGAGCAAGCAACTCTCTGCTGTTGATGCTTGACAAGCTCAGCAATAAAT CGTCCAATGCTAAAAAGGGCCTATGGTCGAGCCCCCAAGAGGGGAACCACCAACGTCCGACTCAACAGCAGGGAAGTCAACCCA GCCGCGGAAACAGCCAGGAAAGACCGCAGAACCAAGTCAAGGCCGCCCCTGGAAACCAGGGCACAGACGCGAACACAGCATATC ATGGACAATGGGAGGAGTCACAACTATCAGCTGGTGCAACCCCTCATGCTCTCCGATCAAGGCAGAGCCAAGACAATACCCTTG TATCTGCGGATCATGTCCAGCCACCTGTAGACTTTGTGCAAGCGATGATGTCTATGATGGAGGCAATATCACAGAGAGTAAGTA AGGTTGACTATCAGCTAGATCTTGTCTTGAAACAGACATCCTCCATCCCTATGATGCGGTCCGAAATCCAACAGCTGAAAACAT CTGTTGCAGTCATGGAAGCCAATTTGGGAATGATGAAGATTCTGGATCCCGGTTGTGCCAACGTTTCATCTCTGAGTGATCTAC GGGCAGTTGCCCGATCTCACCCGGTTTTAGTTTCAGGCCCTGGAGACCCATCTCCCTATGTGACTCAAGGAGGCGAAATGGCAC TTAATAAACTTTCGCAACCAGTGCCACATCCATCTGAATTGATTAAATCCGCCACTGCATGCGGGCCTGATATAGGAGTGGAAA AGGACACTGTCCGTGCATTGATCATGTCACGCCCAATGCACCCGAGTTCTTCAGCCAAGCTCCTAAGCAAGCTAGATGCAGCCG GGTCGATCGAGGAAATCAGGAAAATCAAGCGCCTTGCACTAAATGGCTAATTACTACTGCCACACGTAGCGGGTCCCCGTCCAC TCGGCATCACACGGAATCTGCACCGAGTCCCCCCCCGCAGACCTAAGGTCCAACTCTCCAAGTGGCAATCCTCTCTCGCTTCCT CAGCCCCACTGAATGATCGCGCAACCGTAATTAATCTAGCTACATTAAGGATTAAGAAAAAATACGGGTAGAATTGGAGTGCCC CAATTGTGCCAAGATGGACTCATCTAGGACAATTGGGCTGTACTTTGATTCTGCCCATTCTTCTAGCAACCTGTTAGCATTTCC GATCGTCCTACAAGACACAGGAGATGGGAAGAAGCAAATCGCCCCGCAATATAGGATCCAGCGCCTAGACTCGTGGACTGATAG TAAAGAAGACTCAGTATTCATCACCACCTATGGATTCATCTTTCAGGTTGGGAATGAAGAAGCCACTGTCGGCATGATCAATGA TAATCCCAAGCGCGAGTTACTTTCTGCTGCGATGCTCTGCCTAGGAAGCGTCCCAAATACCGGAGACCTTGTTGAGCTGGCAAG GGCCTGTCTCACTATGGTAGTCACATGCAAGAAGAGTGCAACTAATACTGAGAGAATGGTTTTCTCAGTAGTGCAGGCACCCCA AGTGCTGCAAAGCTGTAGGGTTGTGGCAAACAAATACTCATCAGTGAATGCAGTCAAGCACGTGAAAGCGCCAGAGAAGATCCC CGGGAGTGGAACCCTAGAAIACAAGGTGAACTTTGTCTCCTTGACTGTGGTACCGAAGAAGGATGTCTACAAGATCCCAACTGC AGTATTGAAGGTTTCTGGCTCGAGTCTGTACAATCTTGCGCTCAATGTCACTATTAATGTGGAGGTAGACTCGAGGAGTCCTTT GGTTAAATCTCTGTCTAAGTCTGACAGCGGAIACTATGCTAACCTCTTCTTGCATATTGGACTTATGACCACCGTAGATAGGAG GGGGAAGAAAGTGACTTTTGACAAGCTAGAAAAGAAGATAAGGAGCCTTGATCTATCTGTCGGGCTCAGTGATGTGCTCGGACC TTCCGTGCTGGTAAAAGCAAGAGGTGCACGGACCAAGCTTTTGGCACCTTTCTTCTCTAGCAGTGGGACAGCCTGCTATCCCAT AGCAAATGCCTCTCCTCAGGTGGCCAAGATACTCTGGAGTCAAACCGCGTGCCTGCGGAGCGTTAAAATCATTATCCAAGCAGG TACCCAACGCACCGTCGCAGTGACCGCTGACCACGAGGTTACCTCTACTAAGCTGGAGAAGGGGCACACCCTTGCCAAATACAA TCCTTTTAAGAAATAAGCTGCGTCTCTGAGATTGCGCTCCGCCCACTCACCCAGAGCATCATGACACCAAAAACTAATCTGTCT TGATTATTTACAGTTAGTTTACCTGTCTATCAAATTAGAAAAAACACGGGTAGAAGATTCTGGATCCCGGTTGGCGCCTTCTAG GTGCAAGATGGGCCCCAGACCTTCTACCAAGAACCCAGTACCTATGATGCTGACTGTCCGAGTCGCGCTGGTACTGAGTTGCAT CTGTCCGGCAAACTCCATTGATGGCAGGCCTCTTGCGGCTGCAGGAATTGTGGTAACAGGAGACAAAGCAGTCAACATATACAC CTCATCCCAGACAGGATCAATCATAGTTAAGCTCCTCCCAAACCTGCCCAAGGATAAGGAGGCATGTGCGAAAGCCCCCTTGGA TGCATACAACAGGACATTGACCACTTTGCTCACCCCCCTTGGTGACTCTATCCGTAGGATACAAGAGTCTGTAACTACATCTGG AGGGAGGAGACAGAAACGCTTTATAGGCGCCATTATTGGCGGTGTGGCTCTTGGGGTTGCAACTGCTGCACAAATAACAGCGGC CGCAGCTCTGATACAAGCCAAACAAAATGCTGCCAACATCCTCCGACTTAAAGAGAGCATTGCCGCAACCAATGAGGCCGTGCA TGAGGTCACTGACGGATTATCGCAACTAGCAGTGGCAGTTGGGAAGATGCAGCAGTTTGTTAATGACCAATTTAATAAAACAGC TCAGGAATTAGGCTGCATCAGAATTGCACAGCAAGTTGGTGTAGAGCTCAACCTGTACCTAACCGAATTGACTACAGTATTCGG ACCACAAATCACTTCACCTGCCTTAAACAAGCTGACTATTCAGGCACTTTACAATCTAGCTGGTGGGAATATGGATTACTTGTT (Part b) GACTAAGTTAGGTGTAGGGAACAATCAACTCAGCTCATTAATCGGTAGCGGCTTAATCACCGGCAACCCTATTCTGTACGACTC ACAGACTCAACTCTTGGGTATACAGGTAACTCTACCTTCAGTCGGGAACCTAAATAATATGCGTGCCACCTACTTGGAAACCTT ATCCGTAAGCACAACCAGGGGATTTGCCTCGGCACTTGTCCCAAAAGTGGTGACACAGGTCGGTTCTGTGATAGAAGAACTTGA CACCTCATATTGTATAGAAACCGACTTGGATTTATATTGTACAAGAATAGTAACATTCCCTATGTCCCCTGGTATTTATTCCTG CTTGAGCGGCAATACATCGGCCTGTATGTACTCAAAGACCGAAGGCGCACTCACTACGCCATACATGACTATCAAAGGCTCAGT CATCGCTAACTGCAAGATGACAACAIGTAGATGTGTAAACCCCCCGGGTATCATATCGCAAAACTATGGAGAAGCCGTGTCTCT AATAGATAAGCAATCATGCAATGTTTTATCCTTAGACGGGATAACTTTAAGGCTCAGTGGGGAATTCGATGCAACTTATCAGAA GAATATCTCAATACAAGATTCTCAAGTAATAATAACAGGCAATCTTGATATCTCAACTGAGCTTGGGAATGTCAACAACTCGAT CAGTAATGCTTTGAATAAGTTAGAGGAAAGCAACAGCAAACTAGACAAAGTCAATGTCAAACTGACCAGCACATCTGCTCTCAT TACCTATATCGTTTTGACTATCATATCTCTTGTTTTTGGTATACTTAGCCTGGTTCTAGCATGCTACCTAATGTATAAGCAAAA GGCGCAACAAAAGACCTTATTATGGCTTGGGAATAATACCCTAGATCAGATGAGAGCCACTACAAAAATGTGAACACAGATGAG GAACGAAGGTATCCCIAATAGTAATTTGTGIGAAAGTTCTGGTAGTCTGTCAATTCGGAGAGTTTAGAAAAAACTACGCGTTGT AGATGACCAAAGGACGATATACGGGTAGAACGGTAAGAGAGGCCGCCCCTCAATTGCGAGCCGGGCTTCACAACCTCCGTTCTA CCGCTTCACCGACAGCAGTCCTCAGTCATGGACCGCGCAGTTAGCCAAGTTGCGTTAGAGAATGATGAAAGAGAGGCAAAAAAT ACATGGCGCTTGATATTCCGGATTGCAATCTTACTCTTAACAGTAGTGACCTTAGCTACATCTGTAGCCTCCCTTGTATATAGC ATGGGGGCTAGCACACCTAGCGACCTTGTAGGCATACCGACCAGGATTTCTAGGGCAGAAGAAAAGATTACATCTGCACTTGGT TCCAATCAAGATGTAGTAGATAGGATATATAAGCAAGTGGCCCTTGAGTCTCCGTTGGCATTGTTAAACACTGAGACCACAATT ATGAACGCAATAACATCTCTCTCTTATCAGATTAATGGAGCTGCGAACAACAGCGGGTGGGGGGCACCTATCCATGACCCAGAT TTTATCGGGGGGATAGGCAAAGAACTCATTGTAGATGATGCTAGTGATGTCACATCATTCTATCCCTCTGCATTTCAAGAACAT CTGAATTTTATCCCGGCGCCTACTACAGGATCAGGTTGCACTCGGATACCTTCATTTGACATGAGTGCTACCCATTACTGCTAC ACTCATAATGTAATATTGTCTGGATGCAGAGATCACTCACACTCACATCAGTATTTAGCACTTGGTGTGCTCCGGACAACTGCA ACAGGGAGGATATTCTTTTCTACTCTGCGTTCCATCAGTCTGGATGACACCCAAAATCGGAAGTCTTGCAGTGTGAGTGCAACT CCCTTAGGTTGTGATATGCTGTGCTCGAAAGTCACGGAGACAGAGGAAGAAGATTATAACTCAGCTGTCCCTACGCTGATGGCA CATGGGAGGTTAGGGTTCGACGGCCAATACCACGAAAAGGACCTAGACGTCACAACATTATTTGAGGACTGGGTGGCCAACTAC CCAGGAGTAGGGGGTGGATCTTTTATTGACGGCCGCGTATGGTTCTCAGTCTACGGAGGGCTGAAACCCAATTCACCCAGTGAC ACTGTACAGGAAGGGAAATATGTAATATACAAGCGATACAATGACACATGCCCAGATGAGCAAGACTACCAGATCCGAATGGCC AAGTCTTCGTATAAGCCCGGGCGGTTTGGTGGGAAACGCATACAGCAGGCTATCTTATCTATCAAGGTGTCAACATCTTTGGGC GAAGACCCAGTACTGACTGTACCGCCCAACACAGTCACACTCATGGGGGCCGAAGGCAGAATTCTCACAGTAGGGACATCTCAT TTCTTGTATCAGCGAGGGTCATCATACTTCTCTCCCGCGTTATTATATCCTATGACAGTCAGCAACAAAACAGCCACTCTTCAT AGTCCCTATACATTCAATGCCTTCACTCGGCCAGGTAGTATCCCTTGCCAGGCTTCAGCAAGATGCCCCAACTCGTGTGTTACT GGAGTCTATACAGATCCATATCCCCTAATCTTCTATAGGAACCACACCTTGCGAGGGGTATTCGGGACAATGCTTGATAGTGAA CAAGCAAGACTTAATCCTGCGTCTGCAGTATTCGATAGCACATCCCGCAGTCGCATAACTCGAGTGAGTTCAAGCAGCACCAAA GCAGCATACACAACATCAACTTGTTTTAAAGTTGTCAAGACCAATAAGACCTATTGTCTCAGCATTGCTGAAATATCTAATACT CTCTTCGGAGAATTCAGAATCGTCCCGTTACTAGTTGAGATCCTCAAAAATGATGGGG1TAGAGAAGCCAGGTCTGGTTAGTTG AGTCAACTATGAAAGAGCTGGGAAGATGGCATTGTATCACCTATCTTCCGCGACACCAAGAATCAAACTGAATGCCGGTGCGAG CTCGAATTCCATGTCGCCAGTTGACCACAATCAGCCAGTGCTCATGCGATCAGATCAAGTCTTGTCAATAGTCCCTCGATTAAG AAAAAATGTAAGTGGCAATGAGATACAAGGCAAAACAGCTACCGGTACGGGTAGAACGCCACCATGGAGAAAAAAATCACTGGA TATACCACCGTTGATATATCCCAATGGCATCGTAAAGAACATTTTGAGGCATTTCAGTCAGTTGCTCAATGTACCTATAACCAG ACCGTTCAGCTGGATATTACGGCCTTTTTAAAGACCGTAAAGAAAAATAAGCACAAGTTTTATCCGGCCTTTATTCACATTCTT GCCCGCCTGATGAATGCTCATCCGGAATTCCGTATGGCAATGAAAGACGGTGAGCTGGTGATATGGGATAGTGTTCACCCTTGT TACACCGTTTTCCATGAGCAAACTGAAACGTTTTCATCGCTCTGGAGTGAATACCACGACGATTTCCGGCAGTTTCTACACATA TATTCGCAAGATGTGGCGTGTTACGGTGAAAACCTGGCCTATTTCCCTAAAGGGTTTATTGAGAATATGTTTTTCGTCTCAGCC AATCCCTGGGTGAGTTTCACCAGTTTTGATTTAAACGTGGCCAATATGGACAACTTCTTCGCCCCCGTTTTCACCATGGGCAAA TACTATACGCAAGGCGACAAGGTGCTGATGCCGCTGGCGATTCAGGTTCATCATGCCGTTTGTGATGGCTTCCATGTCGGCAGA ATGCTTAATGAATTACAACAGTACTGCGATGAGTGGCAGGGCGGGGCGTAATGATTAGAAAAAAACCGGTAAATAGTACGGGTA GGACATGGCGAGCTCCGGTCCTGAAAGGGCAGAGCATCAGATTATCCTACCAGAGTCACACCTGTCTTCACCATTGGTCAAGCA CAAACTACTTTATTACTGGAAATTAACTGGGCTACCGCTTCCTGATGAATGTGACTTCGACCACCTCATTCTCAGCAGACAATG GAAAAAAATACTTGAATCGGCCTCTCCTGATACTGAGAGAATGATAAAACTCGGAAGGGCAGTACACCAAACTCTCAACCACAA TTCTAGAATAACCGGAGTACTCCACCCCAGGTGTTTAGAAGAACTGGCTAGTATTGAGGTCCCTGATTCAACCAACAAATTTCG GAAGATTGAGAAGAAGATCCAAATTCACAACACGAGATATGGAGAACTGTTCACAAGGCTGTGTACGCATATAGAGMGAAACT GCTGGGGTCATCCTGGTCTAACAATGTCCCCCGGTCAGAGGAGTTCAACAGCATCCGTACGGATCCGGCATTCTGGTTTCACTC AAAATGGTCCACAGCCAAGTTTGCATGGCTCCATATAAAACAGATCCAGAGGCATCTGATTGTGGCAGCTAGGACAAGGTCTGC GGCCAACAAATTGGTGATGCTAACCCATAAGGTAGGCCAAGTCTTTGTCACTCCTGAACTTGTCATTGTGACGCATACGAATGA GAACAAGTTCACATGTCTTACCCAGGAACTTGTATTGATGTATGCAGATATGATGGAGGGCAGAGATATGGTCAACATAATATC AACCACGGCGGTGCATCTCAGAAGCTTATCAGAGAAAATTGATGACATTTTGCAGTTAATAGACGCTCTGGCAAAAGACTTGGG CAATCAAGTCTACGATGTTGTATCACTAATGGAGGGATTTGCATACGGAGCTGTCCAGCTGCTCGAGCCGTCAGGTAGATTTGC AGGACATTTCTTCGCATTCAACCTGCAGGAGCTTAAAGACATTCTAATCGGCCTCCTCCCCAATGATATAGCAGAATCCGTGAC TCATGCAATAGCTACTGTATTCTCTGGTTTAGAACAGAATCAAGCAGCTGAGATGTTGTGCCTGTTGCGTCTGTGGGGTCACCC ACTGCTTGAGTCCCGTATTGCAGCAAAGGCAGTCAGGAGCCAAATGTGCGCACCGAAAATGGTGGAC1TTGATATGATCCTTCA GGTACTGTCTTTCTTCAAGGGAACAATCATCAACGGATACAGAAAGAAGAATGCAGGTGTGTGGCCGCGAGTCAAAGTGGATAC AATATATGGGAAGATCATTGGGCAACTACATGCAGATTCAGCAGAGATTTCACACGATATCATGTTGAGAGAGTATAAGAGTTT ATCTGCACTTGAATTTGAGCCATGTATAGAATACGACCCTGTCACTAACCTGAGCATGTTCCTAAAAGACAAGGCAATCGCACA CCCTAACGATAATTGGCTTGCCTCGTTTAGGCGGAACCTTCTCTCCGAAGACCAGAAGAAACATGTAAAAGAAGCAACTTCGAC (Part c) TAATCGCCTCTTGATAGAGTTTTTAGAGTCAAATGATTTTGATCCATATAAAGAGATGGAATATCTGACGACCCTIGAGTACCT TAGAGATGACGATGTGGCAGTATCATACTCGCTCAAAGAGAAGGAAGTGAAAGTTAATGGACGGATCTTCGCTAAGCTGACAAA GAAGTTAAGGAACTGTCAGGTGATGGCGGAAGGGATCCTAGCCGACCAGATTGCACCTTTCTTTCAGGGAAATGGAGTCATTCA GGATAGCATATCGTTGACCAAGAGTATGCTAGCGATGAGTCAACTGTCTTTTAACAGCAATAAGAAACGTATCACTGACTGTAA AGAAAGAGTATCTTCAAACCGCAATCATGATCCGAAGAGCAAGAACCGTCGGAGAGTTGCAACCTTCATAACAACTGACCTGCA AAAGTACTGTCTTAATTGGAGATATCAGACAATCAAACTGTTCGCTCATGCCATCAATCAGTTGATGGGCCTACCTCACTTCTT TGAGTGGATTCACCTAAGACTGATGGACACTACAATGTTCGTAGGAGACCCTTTCAATCCTCCAAGTGACCCTACTGACTGTGA CCTCTCAAGAGTCCCTAATGATGACATATATATTGTCAGTGCCAGAGGGGGTATCGAAGGATTATGTCAGAAGCTATGGACAAT GATCTCTATTGCTGCAATCCAACTTGCTGCAGCTAGATCGCATTGTCGCGTTGCCTGTATGGTACAGGGTGATAATCAAGTAAT AGCAGTAACGAGAGAGGTAAGATCAGACGACTCTCCGGAGATGGTGTTGACACAGTTGCATCAAGCCAGTGATAATTTCTTCAA GGAATTAATTCATGTCAATCATTTGATTGGCCATAATTTGAAGGACCGTGAAACCATCAGGTCAGACACATTCTTCATATACAG CAAACGAATCTTCAAAGATGGAGCAATCCTCAGTCAAGTCCTCAAAAATTCATCTAAATTAGTACTGGTGTCAGGTGATCTCAG TGAAAACACCGTAATGTCCTGTGCCAACATTGCCTCTACTGTAGCACGGCTATGCGAGAACGGGCTTCCCAAGGACTTCTGTTA CTATTTAAACTATATAATGAGTTGCGTGCAGACATACTTTGACTCTGAGTTCTCCTACAACAACAATTCGCACCCCGATCTTAA CCAGTCGTGGATTGAGGACATCTCTTTTGTGCACTCATATGTTCTGACTCCTGCCCAATTAGGGGGACTTAGTAACCTTCAATA CTCAAGGCTCTACACTAGAAATATCGGTGACCCGGGGACTACTGCTTTTGCAGAGATCAAGCGACTAGAAGCAGTGGGATTACT GAGTCCTAACATTATGACTAATATCTTAACTAGGCCGCCTGGGAATGGAGATTGGGCCAGTCTTTGCAACGACCCATACTCTTT CAATTTTGAGACTGTTGCAAGCCCAAACATTGTTCTTAAGAAACATACGCAAAGAGTCCTATTTGAAACTTGTTCAAATCCCTT ATTGTCTGGAGTGCACACAGAGGATAATGAGGCAGAAGAGAAGGCATTGGCTGAATTCTTGCTTAATCAAGAGGTGATTCATCC CCGCGTTGCGCATGCTATCATGGAGGCAAGCTCTGTAGGTAGGAGAAAGCAAATTCAAGGGCTTGTTGACACAACAAACACCGT AATTAAGATTGCACTTACTAGGAGGCCACTAGGCATCAAGAGGCTGATGCGGATAGTCAATTATTCTAGCATGCATGCAATGCT GTTTAGAGACGATGTTTTTTCCTCCAATAGAICCAACCACCCCTTAGTCTCTTCTAATATGTGTTCTCTGACACTGGCAGACTA TGCACGGAATAGAAGCTGGTCACCTTTGACGGGAGGCAGGAAAATACTGGGTGTATCTAATCCTGATACGATAGAACTCGTAGA GGGTGAGATTCTTAGTGTAAGCGGAGGGTGCACAAGATGCGACAGCGGAGATGAACAGTTTACTTGGTTCCATCTTCCAAGCAA TATAGAATTGACCGATGACACCAGCAAGAATCCTCCGATGAGAGTACCATATCTCGGGTCAAAGACACAGGAGAGGAGAGCTGC CTCACTTGCGAAAATAGCTCATATGTCGCCACATGTGAAGGCTGCCCTAAGGGCATCATCCGTGTTGATCTGGGCTTATGGGGA TAATGAAGTAAATTGGACTGCTGCTCTTACGATTGCAAAATCTCGATGTAATATAAACTTAGAGTATCTTCGGTTATTGTCCCC TTTACCCACGGCTGGGAATCTTCAACATAGACTAGATGATGGTATAACTCAGATGACATTCACCCCTGCATCICTCTACAGGGT GTCACCTTACATTCACATATCCAATGATTCTCAAAGGCTATTCACTGAAGAAGGAGTCAAAGAGGGGAATGTGGTTTATCAACA GATCATGCTCTTGGGTTTATCTCTAATCGAATCGATCTTTCCAATGACGACAACCAGGACATATGATGAGATCACATTGCATCT ACATAGTAAATTTAGTTGCTGTATCAGGGAAGCACCTGTTGCGGTTCCTTTCGAGCTACTTGGGGTGGCACCGGAGCTAAGGAC AGTGACCTCAAACAAGTTTATGTATGATCCTAGCCCTGTATCGGAGGGAGACTTTGCGAGACTTGACTTAGCTATCTTCAAGAG TTATGAGCTTAATCTGGAGTCATATCCCACGATAGAGCTAATGAACATTCTTTCAATATCCAGCGGGAAGTTGATTGGCCAGTC TGTGGTTTCTTATGATGAAGATACCTCCATAAAGAATGACGCCATAATAGTGTATGACAATACCCGAAATTGGATCAGTGAAGC TCAGAATTCAGATGTGGTCCGCTTATTTGAATATGCAGCACTTGAAGTGCTCCTCGACTGTTCTTACCAACTCTATTATCTGAG AGTAAGAGGCCTAGACAATATTGTCTTATATATGGGTGATTTATACAAGAATATGCCAGGAATTCTACTTTCCAACATTGCAGC TACAATATCTCATCCCGTCATTCATTCAAGGTTACATGCAGTGGGCCTGGTCAACCATAACGGATCACACCAACTTGCAGATAC GGATTTTATCGAAATGTCTGCAAAACTGTTAGTATCTTGCACTCGACGTGTGATCTCCGGCTTATATTCAGGGAATAAGTATGA TCTGCTGTTCCCATCTGTCTTAGATGATAACCTGAATGAGAAGATGCTTCAGCTGATATCCCGGTTATGCTGTCTGTACACGGT ACTCTTTGCTACAACAAGAGAAATCCCGAAAATAAGAGGCTTATCTGCAGAAGAGAAATGTTCAGTACTTACTGAGTATCTACT GTCGGATGCTGTGAAACCATTACTTAGCCCTGATCAGGTGAGCTCTATCATGTCTCCTAACATAATTACATTCCCAGCTAATCT GTACTACATGTCTCGGAAGAGCCTCAATTTGATCAGGGAAAGGGAGGACAAGGATTCTATCCTGGCGTTGTTGTTCCCCCAAGA GCCATTATTAGAGTTCCCTTCTGTGCAAGATATTGGTGCTCGAGTGAAAGATCCATTCACCCGACAACCTGCGGCATTTTTGCA AGAGTTAGATTTGAGTGCTCCAGCAAGGTATGACGCATTCACACTTAGTCAGATTCATCCTGAGCTCACATCACCAAATCCGGA GGAAGACTACTTAGTACGATACTTGTTCAGAGGAATAGGGACTGCATCCTCCTCTTGGTATAAGGCATCCCATCTCCTTTCTGT ACCCGAGGTAAGATGTGCAAGACACGGGAACTCCTTATACTTAGCTGAAGGAAGCGGAGCCATCATGAGTCTTCTCGAACTGCA TGTACCACATGAAACTATCTATTACAATACGCTCTTTTCAAATGAGATGAACCCCCCGCAGCGACATTTCGGGCCGACCCCAAC CCAGTTTTTGAATTCGGTTGTTTATAGGAACCTACAGGCGGAGGTAACATGCAAGGATGGATTTGTCCAAGAGTTCCGTCCACT ATGGAGAGAAAATACAGAGGAAAGCGACCTGACCTCAGATAAAGCAGTGGGGTATATTACATCTGCAGTGCCCTACAGATCTGT ATCATTGCTGCATTGTGACATTGAAATCCCTCCAGGGTCCAATCAAAGCTTACTAGATCAATTAGCTATCAATTTATCTCTGAT TGCCATGCATTCCGTAAGGGAGGGCGGGGTAGTGATCATCAAAGTGTTGTATGCAATGGGATACTACTTTCATCTACTCATGAA CTTGTTCGCTCCGTGTTCCACAAAAGGATACATTCTCTCTAATGGTTATGCATGTAGAGGGGATATGGAGTGTTACCTGGTATT TGTCATGGGTTACCTGGGCGGGCCTACATTTGTACACGAGGTGGTGAGGATGGCAAAAACTCTGGTGCAGCGGCACGGTACGCT TTTGTCCAAATCAGATGAGATCACACTGACCAGGTTATTCACCTCACAGCGGCAGCGTGTGACAGACATCCTATCCAGTCCTTT ACCAAGATTAATAAAGTACTTGAGAAAGAATATTGACACTGCGCTGATTGAAGCTGGGGGACAGCCCGTCCGTCCATTCTGTGC AGAGAGTTTGGTGAGCACGCTGGCGGACATAACTCAGATAACCCAGATCATTGCTAGTCACATTGACACAGTCATCCGGTCTGT GATATATATGGAAGCTGAGGGTGATCTCGCTGACACAGTATTTCTATTTACCCCTTACAATCTCTCTACTGACGGGAAAAAGAG AACATCACTTAAACAGTGCACGAGACAGATCCTAGAGGTTACAATATTGGGTCTTAGAGTCGAAGATCTCAATAAAATAGGCGA TGTAATCAGCCTAGTGCTTAAAGGCATGATCTCCATGGAGGACCTTATCCCACTAAGGACATACTTGAAGCATAGTACCTGCCC TAAATATTTGAAGGCTGTCCTAGGTATTACCAAACTCAAAGAAATGTTTACAGACACCTCTGTATTGTACTTGACTCGTGCTCA ACAAAAATTCTACATGAAAACTATAGGCAATGCAGTCAAAGGATATTACAGTAACTGTGACTCTTAACGAAAATCACATATTAA TAGGCTCCTTTTCTGGCCAATTGTATCCTTGGTGATTTAATTATACTATGTTAGAAAAAAATTGAACTCCGACTCCTTAGATCT CGAATTCGAACTCAAATAAATGTCTTAAAAAAAGGTTGCGCACAATTATTCTTGAGTGTAGTCTTGTTATTCACCAAATCTTTG (Part d) TTTGGT

Claims

1. An antigenomic RNA of Newcastle disease virus, comprising NP gene, P gene, M gene, F gene, HN gene and L gene in this order from a 5′ to 3′ direction, said antigenomic RNA further comprising n foreign nucleotide complexes inserted (a) before the NP gene, (b) between the P and M genes, and/or (c) between the HN and L genes, wherein n is 1, 2, 3 or 4;

each of the foreign nucleotide complexes comprising a Newcastle disease virus gene start sequence, an open reading frame of a foreign gene and a Newcastle disease virus gene end sequence in this order from the 5′ to 3′ direction, wherein the foreign gene is a gene not found naturally in the Newcastle disease virus; and

wherein when 2, 3 or 4 foreign nucleotide complexes are inserted together before the NP gene, between the P and M genes, or between the HN and L genes, the foreign nucleotide complexes are sequentially linked directly or indirectly.

2. The antigenome RNA of claim 1, wherein n is 2, 3 or 4 and the foreign nucleotide complexes are different.

3. The antigenome RNA of claim 1, wherein n is 2, 3 or 4 and the foreign nucleotide complexes are the same.

4. The antigenome RNA of claim 1, wherein n is 1 or 2.

5. The antigenome RNA of claim 4, wherein n is 2 and the foreign nucleotide complexes are different.

6. The antigenome RNA of claim 4, wherein n is 2 and the foreign nucleotide complexes are the same.

7. The antigenome RNA of claim 1, wherein the length of the open reading frame of the foreign gene is no more than about 3000 nucleotides.

8. The antigenome RNA of claim 7, wherein the length of the open reading frame of the foreign gene is no more than about 1500 nucleotides.

9. The antigenome RNA of claim 8, wherein the length of the open reading frame of the foreign gene is no more than about 1000 nucleotides.

10. The antigenome RNA of claim 9, wherein the length of the open reading frame of the foreign gene is no more than about 800 nucleotides.

11. The antigenome RNA of claim 10, wherein the length of the open reading frame of the foreign gene is no more than about 500 nucleotides.

12. The antigenome RNA of claim 11, wherein the length of the open reading frame of the foreign gene is no more than about 300 nucleotides.

13. The antigenome RNA of claim 1, wherein 2, 3 or 4 foreign nucleotide complexes are inserted together before the NP gene, between the P and M genes, or between the HN and L genes, the sequentially linked foreign nucleotide complexes having a combined length of no more than about 5000 nucleotides.

14. The antigenomic RNA of claim 13, wherein the sequentially linked foreign nucleotide complexes have a combined length of no more than about 2000 nucleotides.

15. The antigenomic RNA of claim 14, wherein the sequentially linked foreign nucleotide complexes have a combined length of no more than about 1000 nucleotides.

16. The antigenomic RNA of claim 15, wherein the sequentially linked foreign nucleotide complexes have a combined length of no more than about 800 nucleotides.

17. The antigenomic RNA of claim 1, wherein the foreign genes of the foreign nucleotide complexes are selected from the group consisting of genes encoding chloramphenical acetyltransferase, green fluorescent protein, an avian cytokine, and an immunogenic protein of a virus selected from the group consisting of influenza virus, infectious bursal disease virus, rotavirus, infectious bronchitis virus, infectious laryngotracheitis virus, chicken anemia virus, Marek's disease virus, avian leukosis virus, avian adenovirus, and avian pneumovirus.

18. The antigenomic RNA of claim 1, wherein the foreign genes of the foreign nucleotide complexes encode chloramphenical acetyltransferase.

19. The antigenomic RNA of claim 1, wherein the foreign genes of the foreign nucleotide complexes encode the same or different avian cytokines.

20. The antigenomic RNA of claim 19, wherein the avian cytokines are avian interleukins.

21. The antigenomic RNA of claim 20, wherein the avian cytokines are avian IL-2 and/or IL-4.

22. The antigenomic RNA of claim 1, wherein the foreign genes of the foreign nucleotide complexes encode an immunogenic protein of the same or different viruses selected from the group consisting of influenza virus, infectious bursal disease virus, rotavirus, infectious bronchitis virus, infectious laryngotracheitis virus, chicken anemia virus, Marek's disease virus, avian leukosis virus, avian adenovirus and avian pneumovirus.

23. The antigenomic RNA of claim 1, wherein the n foreign nucleotide complexes are inserted (a) before the NP gene, and/or (b) between the P and M genes.

24. The antigenomic RNA of claim 23, wherein the n foreign nucleotide complexes are inserted before the NP gene.

25. The antigenome RNA of claim 24, wherein 2, 3 or 4 foreign nucleotide complexes are inserted together before the NP gene, the sequentially linked foreign nucleotide complexes having a combined length of no more than about 4000 nucleotides.

26. The antigenomic RNA of claim 25, wherein the sequentially linked foreign nucleotide complexes have a combined length of no more than about 2000 nucleotides.

27. The antigenomic RNA of claim 26, wherein the sequentially linked foreign nucleotide complexes have a combined length of no more than about 1000 nucleotides.

28. The antigenomic RNA of claim 27, wherein the sequentially linked foreign nucleotide complexes have a combined length of no more than about 800 nucleotides.

29. The antigenomic RNA of claim 23, wherein the n foreign nucleotide complexes are inserted between the P and M genes.

30. The antigenomic RNA of claim 29, wherein the sequentially linked foreign nucleotide complexes have a combined length of no more than about 4000 nucleotides.

31. The antigenomic RNA of claim 30, wherein the sequentially linked foreign nucleotide complexes have a combined length of no more than about 2000 nucleotides.

32. The antigenomic RNA of claim 31, wherein the sequentially linked foreign nucleotide complexes have a combined length of no more than about 1000 nucleotides.

33. The antigenomic RNA of claim 32, wherein the sequentially linked foreign nucleotide complexes have a combined length of no more than about 800 nucleotides.

34. The antigenomic RNA of claim 18, wherein n is 1.

35. The antigenomic RNA of claim 19, wherein n is 1.

36. The antigenomic RNA of claim 22, wherein n is 1.

37. The antigenomic RNA of claim 24, wherein n is 1.

38. The antigenomic RNA of claim 37, wherein the open reading frame of the foreign gene encodes chloramphenicol acetyltransferase.

39. The antigenomic RNA of claim 37, wherein the open reading frame of the foreign gene encodes an avian cytokine.

40. The antigenomic RNA of claim 39, wherein the avian cytokine is an avian interleukin.

41. The antigenomic RNA of claim 40, wherein the avian interleukin is IL-2 or IL-4.

42. The antigenomic RNA of claim 1, having a length of m nucleotides, wherein m is a multiple of 6.

43. The antigenomic RNA of claim 1, wherein at least one of the foreign nucleotide complexes contain foreign gene encoding an immunogenic protein of a non-avian pathogen.

44. The antigenomic RNA of claim 43, wherein the non-avian pathogen is a virus selected from the group consisting of influenza virus, SARS-causing virus, human respiratory syncytial virus, human immunodeficiency virus, hepatitis A virus, hepatitis B virus, hepatitis C virus, poliovirus, rabies virus, Hendra virus, Nipah virus, human parainfluenza 3 virus, measles virus, mumps virus, Ebola virus, Marburg virus, West Nile virus, Japanese encephalitis virus, Dengue virus, Hantavirus, Rift Valley fever virus, Lassa fever virus, herpes simplex virus and yellow fever virus.

45. A cDNA encoding the antigenomic RNA of claim 1.

46. A plasmid comprising the cDNA of claim 45.

47. A cell comprising the cDNA of claim 45.

48. A cell comprising the plasmid of claim 46.

49. A cell comprising the antigenomic RNA of claim 1.

50. A recombinant Newcastle disease virus produced by a process comprising the following steps:

(i) providing cells capable of synthesizing T7 RNA polymerase;

(ii) transfecting the cells with a plasmid comprising the cDNA encoding the antigenomic RNA of claim 1, a plasmid encoding NP protein, a plasmid encoding P protein, and a plasmid encoding L protein to obtain transfected cells in a medium; and thereafter

(iii) isolating Newcastle disease virus from a supernatant of the medium of step (ii) to obtain the recombinant Newcastle disease virus.

51. The recombinant Newcastle disease virus of claim 50, wherein the cells capable of synthesizing T7 RNA polymerase provided in step (i) are from a cell line expressing T7 RNA polymerase.

52. The recombinant Newcastle disease virus of claim 50, wherein the cells capable of synthesizing T7 RNA polymerase provided in step (i) are plant cells.

53. The recombinant Newcastle disease virus of claim 50, wherein the cells capable of synthesizing T7 RNA polymerase provided in step (i) are mammalian cells.

54. The recombinant Newcastle disease virus of claim 50, wherein the cells capable of synthesizing T7 RNA polymerase provided in step (i) are avian cells.

55. The recombinant Newcastle disease virus of claim 50, wherein the cells capable of synthesizing T7 RNA polymerase provided in step (i) are HEp-2 cells infected with a virus that can synthesize T7 RNA polymerase.

56. The recombinant Newcastle disease virus of claim 55, wherein the virus is a vaccinia virus.

57. A recombinant Newcastle disease virus produced by a process comprising the following steps:

(i) providing cells capable of synthesizing T7 RNA polymerase;

(ii) transfecting the cells with a plasmid comprising the cDNA encoding the antigenomic RNA of claim 18, a plasmid encoding NP protein, a plasmid encoding P protein, and a plasmid encoding L protein to obtain transfected cells in a medium; and thereafter

(iii) isolating Newcastle disease virus from a supernatant of the medium of step (ii) to obtain the recombinant Newcastle disease virus.

58. A recombinant Newcastle disease virus produced by a process comprising the following steps:

(i) providing cells capable of synthesizing T7 RNA polymerase;

(ii) transfecting the cells with a plasmid comprising the cDNA encoding the antigenomic RNA of claim 19, a plasmid encoding NP protein, a plasmid encoding P protein, and a plasmid encoding L protein to obtain transfected cells in a medium; and thereafter

(iii) isolating Newcastle disease virus from a supernatant of the medium of step (ii) to obtain the recombinant Newcastle disease virus.

59. A recombinant Newcastle disease virus produced by a process comprising the following steps:

(i) providing cells capable of synthesizing T7 RNA polymerase;

(ii) transfecting the cells with a plasmid comprising the cDNA encoding the antigenomic RNA of claim 22, a plasmid encoding NP protein, a plasmid encoding P protein, and a plasmid encoding L protein to obtain transfected cells in a medium; and thereafter

(iii) isolating Newcastle disease virus from a supernatant of the medium of step (ii) to obtain the recombinant Newcastle disease virus.

60. A recombinant Newcastle disease virus produced by a process comprising the following steps:

(i) providing cells capable of synthesizing T7 RNA polymerase;

(ii) transfecting the cells with a plasmid comprising the cDNA encoding the antigenomic RNA of claim 43, a plasmid encoding NP protein, a plasmid encoding P protein, and a plasmid encoding L protein to obtain transfected cells in a medium; and thereafter

(iii) isolating Newcastle disease virus from a supernatant of the medium of step (ii) to obtain the recombinant Newcastle disease virus.

61. A method of vaccinating an avian animal against Newcastle disease, wherein the avian animal is in need of the vaccination, comprising administering an effective amount of the recombinant Newcastle disease virus of claim 50 to the avian animal.

62. A method of vaccinating an avian animal against Newcastle disease, wherein the avian animal is in need of the vaccination, comprising administering an effective amount of the recombinant Newcastle disease virus of claim 57 to the avian animal.

63. A method of treating an avian animal with an avian cytokine, wherein the avian animal is in need of the treatment, said method comprising administering an effective amount of the recombinant Newcastle disease virus of claim 58 to the avian animal.

64. A method of immunizing an avian animal against an avian pathogen selected from the group consisting of influenza virus, infectious bursal disease virus, rotavirus, infectious bronchitis virus, infectious laryngotracheitis virus, chicken anemia virus, Marek's disease virus, avian Leukosis virus, avian adenovirus and avian pneumovirus, wherein the avian animal is in need of the immunization, said method comprising administering an effective amount of the recombinant Newcastle disease virus of claim 59 to the avian animal, wherein the open reading frame of the foreign gene encodes an immunogenic protein of the avian pathogen against which the avian animal is immunized.

65. A method of immunizing a mammal against a non-avian pathogen, wherein the mammal is in need of the immunization, said method comprising administering an effective amount of the recombinant Newcastle disease virus of claim 60 to the mammal, wherein the open reading frame of the foreign gene encodes an immunogenic protein of the non-avian pathogen against which the mammal is immunized.

66. The method of claim 65, wherein the non-avian pathogen is selected from the group consisting of influenza virus, SARS-causing virus, human respiratory syncytial virus, human immunodeficiency virus, hepatitis A virus, hepatitis B virus, hepatitis C virus, poliovirus, rabies virus, Hendra virus, Nipah virus, human parainfluenza 3 virus, measles virus, mumps virus, Ebola virus, Marburg virus, West Nile virus, Japanese encephalitis virus, Dengue virus, Hantavirus, Rift Valley fever virus, Lassa fever virus, herpes simplex virus and yellow fever virus.

67. A process of making the antigenomic RNA of claim 1, comprising the following steps:

(i) providing a cDNA comprising NP gene, P gene, M gene, F gene, HN gene and L gene in this order, said cDNA further comprising n foreign nucleotide complexes inserted (a) before the NP gene, (b) between the P and M genes, and/or (c) between the HN and L genes, wherein n is 1, 2, 3 or 4;

each of the foreign nucleotide complexes comprising a Newcastle disease virus gene start sequence, an open reading frame of a foreign gene and a Newcastle disease virus gene end sequence in this order from the 5′ to 3′ direction, wherein the foreign gene is a gene not found naturally in the Newcastle disease virus;

wherein when n is 2, 3 or 4, the foreign nucleotide complexes are the same or different; and

wherein when 2, 3 or 4 foreign nucleotide complexes are inserted together before the NP gene, between the P and M genes, or between the HN and L genes, the foreign nucleotide complexes are sequentially linked directly or indirectly;

(ii) transcribing the cDNA to form a mixture containing an antigenomic RNA; and thereafter

(iii) isolating the antigenomic RNA.

68. The antigenomic RNA of claim 1, wherein at least one of the foreign nucleotide complexes is inserted before the NP gene.

69. The antigenomic RNA of claim 1, wherein at least one of the foreign nucleotide complexes is inserted before the NP gene and at least one of the foreign nucleotide complexes is inserted between the P and M genes.

70. The antigenomic RNA of claim 1, wherein at least one of the foreign nucleotide complexes is inserted before the NP gene and at least one of the foreign nucleotide complexes is inserted between the HN and L genes.

71. The antigenomic RNA of claim 1, wherein at least one of the foreign nucleotide complexes is inserted before the NP gene, at least one of the foreign nucleotide complexes is inserted between the P and M genes, and at least one of the foreign nucleotide complexes is inserted between the HN and L genes.

72. The antigenomic RNA of claim 1, wherein at least one of the foreign nucleotide complexes is inserted between the P and M genes.

73. The antigenomic RNA of claim 1, further comprising at least one intergenic region selected from the group consisting of a NP-P intergenic region between the NP and P genes, a P-M intergenic region between the P and M genes, a M-F intergenic region between the M and F genes, a F-HN intergenic region between the F and HN genes, and a HN-L intergenic region between the HN and L genes.

74. The antigenomic RNA of claim 1, further comprising a NP-P intergenic region between the NP and P genes, a P-M intergenic region between the P and M genes, a M-F intergenic region between the M and F genes, a F-HN intergenic region between the F and HN genes, and a HN-L intergenic region between the HN and L genes.

75. The antigenomic RNA of claim 1, wherein the foreign gene of at least one of the foreign nucleotide complexes encodes a tumor antigen.

76. The antigenomic RNA of claim 75, wherein the tumor antigen is selected from the group consisting of pg100, MAGE1, MAGE3 and CDK4.

77. A recombinant Newcastle disease virus comprising the antigenomic RNA of claim 1.

78. A recombinant Newcastle disease virus comprising the antigenomic RNA of claim 18.

79. A recombinant Newcastle disease virus comprising the antigenomic RNA of claim 19.

80. A recombinant Newcastle disease virus comprising the antigenomic RNA of claim 22.

81. A recombinant Newcastle disease virus comprising the antigenomic RNA of claim 43.

82. A method of vaccinating an avian animal against Newcastle disease, wherein the avian animal is in need of the vaccination, comprising administering an effective amount of the recombinant Newcastle disease virus of claim 77 to the avian animal.

83. A method of vaccinating an avian animal against Newcastle disease, wherein the avian animal is in need of the vaccination, comprising administering an effective amount of the recombinant Newcastle disease virus of claim 78 to the avian animal.

84. A method of treating an avian animal with an avian cytokine, wherein the avian animal is in need of the treatment, said method comprising administering an effective amount of the recombinant Newcastle disease virus of claim 79 to the avian animal.

85. A method of immunizing an avian animal against an avian pathogen selected from the group consisting of influenza virus, infectious bursal disease virus, rotavirus, infectious bronchitis virus, infectious laryngotracheitis virus, chicken anemia virus, Marek's disease virus, avian Leukosis virus, avian adenovirus and avian pneumovirus, wherein the avian animal is in need of the immunization, said method comprising administering an effective amount of the recombinant Newcastle disease virus of claim 80 to the avian animal, wherein the open reading frame of the foreign gene encodes an immunogenic protein of the avian pathogen against which the avian animal is immunized.

86. A method of immunizing a mammal against a non-avian pathogen, wherein the mammal is in need of the immunization, said method comprising administering an effective amount of the recombinant Newcastle disease virus of claim 81 to the mammal, wherein the open reading frame of the foreign gene encodes an immunogenic protein of the non-avian pathogen against which the mammal is immunized.

87. The antigenomic RNA of claim 1, wherein at least one foreign nucleotide complex is inserted between the P and M genes and at least one foreign nucleotide complex is inserted before the NP gene.

88. The antigenomic RNA of claim 1, wherein at least one foreign nucleotide complex is inserted between the P and M genes and at least one foreign nucleotide complex is inserted between the HN and L genes.