Novel modified nucleic acid sequences and methods for increasing mRNA levels and protein expression in cell systems
The invention provides modified recombinant nucleic acid sequences (preferably DNA) and methods for increasing the mRNA levels and protein expression of proteins which are known to be, or are likely to be, difficult to express in cell culture systems, mammalian cell culture systems, or in transgenic animals. The preferred “difficult” protein candidates for expression using the recombinant techniques of the invention are those proteins derived from heterologous cells preferably those of lower organisms such as parasites, bacteria, and virus, having DNA coding sequences comprising high overall AT content or AT rich regions and/or mRNA instability motifs and/or rare codons relative to the recombinant expression system to be used.
1. Field of the Invention
The invention relates to heterologous gene expression. More particularly, the invention relates to the expression of microbial or parasitic organism genes in higher eukaryote cell systems.
2. Summary of the Related Art
Recombinant production of certain heterologous gene products is often difficult in in vitro cell culture systems or in vivo recombinant production systems. For example, many researchers have found it difficult to express proteins derived from bacteria, parasites and virus in cell culture systems different from the cell from which the protein was originally derived, and particularly in mammalian cell culture systems. One example of a therapeutically important protein which has been difficult to produce by mammalian cells is the malaria merozoite surface protein (MSP-1).
Malaria is a serious heath problem in tropical countries. Resistance to existing drugs is fast developing and a vaccine is urgently needed. Of the number of antigens that get expressed during the life cycle of P. falciparum, MSP-1 is the most extensively studied and promises to be the most successful candidate for vaccination. Individuals exposed to P. falciparum develop antibodies against MSP-1, and studies have shown that there is a correlation between a naturally acquired immune response to MSP-1 and reduced malaria morbidity. In a number of studies, immunization with purified native MSP-1 or recombinant fragments of the protein has induced at least partial protection from the parasite (Diggs et al, (1993) Parasitol. Today, 9:300-302). Thus MSP-1 is an important target for the development of a vaccine against P. falciparum.
MSP-1 is a 190-220 kDA glycoprotein. The C-terminal region has been the focus of recombinant production for use as a vaccine. However, a major problem in developing MSP-1 as a vaccine is the difficulty in obtaining recombinant proteins in bacterial or yeast expression systems that are equivalent in immunological potency to the affinity purified native protein (Chang et al., (1992) J. Immunol. 148:548-555.) and in large enough quantities to make vaccine production feasible.
Improved procedures for enhancing expression of sufficient quantities of proteins derived from parasite, bacterial and viral organisms which have previously been difficult to produce recombinantly would be advantageous. In particular, a recombinant system capable of expressing MSP-1 in sufficient quantities would be particularly advantageous.
BRIEF SUMMARY OF THE INVENTIONThe present invention provides improved recombinant DNA compositions and procedures for increasing the mRNA levels and protein expression of proteins derived from heterologous cells, preferably those of lower organisms such as bacteria, virus, and parasite, which have previously been difficult to express in cell culture systems, mammalian cell culture systems, or in transgenic mammals. The preferred protein candidates for expression in an expression system in accordance with the invention are those proteins having DNA coding sequences comprising high overall AT content or AT rich regions, and/or mRNA instability motifs and/or rare codons relative to the recombinant expression systems.
In a first aspect, the invention features a modified known nucleic acid, preferably a gene from a bacterium, virus or parasite, capable of being expressed in a system, wherein the modification comprises a reduced AT content, relative to the unmodified sequence, and optionally further comprises elimination of at least one or all mRNA instability motifs present in the natural gene. In certain preferred embodiments the modification further comprises replacement of one or more codons of the natural gene with preferred codons of the cell system.
In a second aspect, the invention provides a process for preparing a modified nucleic acid of the invention comprising the steps of lowering the overall AT content of the natural gene encoding the protein, and/or eliminating at least one or all mRNA instability motifs and/or replacing one or more codons with a preferred codon of the cell system of choice, all by replacing one or more codons in the natural gene with codons recognizable to, and preferably with codons preferred by the cell system of choice and which code for the same amino acids as the replaced codon. This aspect of the invention further includes modified nucleic acids prepared according to the process of the invention.
In a third aspect, the invention also provides vectors comprising nucleic acids of the invention and promoters active in the cell line or organism of choice, and host cells transformed with nucleic acids of the invention.
In a fourth aspect, he invention provides transgenic expression vectors for the production of transgenic lactating animals comprising nucleic acids of the invention as well as transgenic non-human lactating animals whose germlines comprise a nucleic acid of the invention.
In a fifth aspect, he invention provides a transgenic expression vector for production of a transgenic lactating animal species comprising a nucleic acid of the invention, a promoter operatively coupled to the nucleic acid which directs mammary gland expression of the protein encoded by the nucleic acid into the milk of the transgenic animal.
In a sixth aspect, the invention provides a DNA vaccine comprising a modified nucleic acid according to the invention. A preferred embodiment of this aspect of the invention comprises a fragment of a modified MSP-1 gene according to the invention.
DESCRIPTION OF THE DRAWINGS
The patent and scientific literature referred to herein establishes the knowledge that is available to those with skill in the art. The issued US patents, allowed applications, published foreign applications, and references cited herein are hereby incorporated by reference. Any conflicts between these references and the present disclosure shall be resolved in favor of the present disclosure.
The invention provides modified recombinant nucleic acid sequences (preferably DNA) and methods for increasing the mRNA levels and protein expression of proteins which are known to be, or are likely to be, difficult to express in cell culture systems, mammalian cell culture systems, or in transgenic animals. The preferred “difficult” protein candidates for expression using the recombinant techniques of the invention are those proteins derived from heterologous cells preferably those of lower organisms such as parasites, bacteria, and virus, having DNA coding sequences comprising high overall AT content or AT rich regions and/or mRNA instability motifs and/or rare codons relative to the recombinant expression system to be used.
In a first aspect, the invention features a modified known nucleic acid, preferably a gene from a bacterium virus or parasite, capable of being expressed in a cell system, wherein the modification comprises a reduced AT content, relative to the unmodified sequence, and optionally further comprises elimination of at least one or all mRNA instability motifs present in the natural gene. A “cell system” includes cell culture systems, tissue culture systems, organ culture systems and tissues of living animals. In certain preferred embodiments the modification further comprises replacement of one or more codons of the natural gene with preferred codons of the cell system. Each of these features are achieved by replacing one or more codons of the natural gene with codons recognizable to, and preferably preferred by the cell system that encode the same amino acid as the codon which was replaced in the natural gene. In accordance with the invention, such “silent” nucleotide and codon substitutions should be sufficient to achieve the goal lowering AT content and/or of eliminating mRNA instability motifs, and/or reducing the number of rare codons, white maintaining, and preferably improving the ability of the cell system to produce mRNA and express the desired protein.
Also included in the invention are those sequences which are specifically homologous to the modified nucleic acids of the invention under suitable stringent conditions, specifically excluding the known nucleic acids from which the modified nucleic acids are derived. A sequence is “specifically homologous” to another sequence if it is sufficiently homologous to specifically hybridize to the exact complement of the sequence. A sequence “specifically hybridizes” to another sequence if it hybridizes to form Watson-Crick or Hoogsteen base pairs either in the body, or under conditions which approximate physiological conditions with respect to ionic strength, e.g., 140 mM NaCl, 5 mM MgCl2. Preferably, such specific hybridization is maintained under stringent conditions, e.g., 0.2×SSC at 68° C.
In preferred embodiments, the nucleic acid of the invention is capable of expressing the protein in mammalian cell culture, or in a transgenic animal at a level which is at least 25%, and preferably 50% and even more preferably at least 100% or more of that expressed by the natural gene in an in vitro cell culture system or in a transgenic animal under identical conditions (i.e. the same cell type, same culture conditions, same expression vector).
As used herein, the term “expression” is meant mRNA transcription resulting in protein expression. Expression may be measured by a number of techniques known in the art including using an antibody specific for the protein of interest. By “natural gene” or “native gene” is meant the gene sequence, or fragments thereof (including naturally occurring allelic variations), which encode the wild type form of the protein and from which the modified nucleic acid is derived. A “preferred codon” means a codon which is used more prevalently by the cell system of choice. Not all codon changes described herein are changes to a preferred codon, so long as the codon replacement is a codon which is at least recognized by the cell system. The term “reduced AT content” as used herein means having a lower overall percentage of nucleotides having A (adenine) or T (thymine) bases relative to the natural gene due to replacement of the A or T containing nucleotide positions or A and/or T containing codons with nucleotides or codons recognized by the cell system of choice and which do not change the amino acid sequence of the target protein. “Heterologous” is used herein to denote genetic material originating from a different species than that into which it has been introduced, or a protein produced from such genetic material.
Particularly preferred cell systems of the invention include mammalian cell culture systems such as COS cells and CHO cells, as well as transgenic animals, particularly the mammary tissue of transgenic animals. However, the invention also contemplates bacteria, yeast, E. coli, and viral expression systems such as baculovirus and even plant systems.
In a second aspect, the invention provides a process for preparing a modified nucleic acid of the invention comprising the steps of lowering the overall AT content of the natural gene encoding the protein, and/or eliminating at least one or all mRNA instability motifs and/or replacing one or more codons with a preferred codon of the cell system of choice, all by replacing one or more codons in the natural gene with codons recognizable to, and peferably with codons preferred by the cell system of choice and which code for the same amino acids as the replaced codon. Standard reference works describing the general principals of recombinant DNA technology include Watson, J. D. et al, Molecular Biology of the Gene, Volumes I and II the Benjamin/Cummings Publishing Company, Inc. publisher, Menlo Park, Calif. (1987) Darnell, J. E. et al., Molecular Cell Biology, Scientific American Books, Inc., Publisher, New York, N.Y. (1986); Old, R. W., et al., Principles of Gene Manipulation: An Introduction to Genetic Engineering, 2d edition, University of California Press, publisher, Berkeley Calif. (1981); Maniatis, T., et al., Molecular Cloning: A Laboratory Manual, 2nd ed. Cold Spring Harbor Laboratory, publisher, Cold Spring Harbor, N.Y. (1989) and Current Protocols in Molecular Biology, Ausubel et al., Wiley Press, New York, N.Y. (1992). This aspect of the invention further includes modified nucleic acids prepared according to the process of the invention.
Without being limited to any theory, previous research has indicated that a conserved AU sequence (AUUUA) from the 3′ untranslated region of GM-CSF mRNA mediates selective mRNA degradation (Shaw, G. and Kamen, R. Cell 46:659-667). The focus in the past has been on the presence of these instability motifs in the untranslated region of a gene. The instant invention is the first to recognize an advantage to eliminating the instability sequences in the coding region of a gene.
In a third aspect, the invention also provides vectors comprising nucleic acids of the invention and promoters active in the cell line or organism of choice, and host cells transformed with nucleic acids of the invention. Preferred vectors include an origin of replication and are thus replicatable in one or more cell type. Certain preferred vectors are expression vectors, and further comprise at least a promoter and passive terminator, thereby allowing transcription of the recombinant expression element in a bacterial, fungal, plant, insect or mammalian cell.
In a fourth aspect, he invention provides transgenic expression vectors for the production of transgenic lactating animals comprising nucleic acids of the invention as well as transgenic non-human lactating animals whose germlines comprise a nucleic acid of the invention. Such transgenic expression vectors comprise a promoter capable of being expressed as part of the genome of the host transgenic animal. General principals for producing transgenic animals are known in the art. See for example Hogan et al., Manipulating the Mouse Embryo: A Laboratory Manual, Cold Spring Harbor Laboratory, (1986); Simons et al, Bio/Technology 6:179-183, (1988); Wall et al., Biol. Reprod. 32:645-651, (1985); Buhler et al., Bio/Technology, 8:140-143 (1990); Ebert et al., Bio/Technology 9:835-838 (1991); Krimenfort et al., Bio/Technology 9:844-847 (1991); Wall et al., J. Cell. Biochem. 49:113-120 (1992). Techniques for introducing foreign DNA sequences into mammals and their germ cells were originally developed in the mouse. See e.g., Gordon et al., Proc. Natl. Acad. Sci. USA 77:7380-7384, (1980); Gordon and Ruddle, Science 214: 1244-1246 (1981); Palmiter and Brinster, Cell 41: 343-345, 1985; Brinster et al., Proc Natl. Acad. Sci., USA 82:4438-4442 (1985) and Hogan et al. (ibid.). These techniques were subsequently adapted for use with larger animals including cows and goats. Up until very recently, the most widely used procedure for the generation of transgenic mice or livestock, several hundred linear molecules of the DNA of interest in the form of a transgenic expression construct are injected into one of the pro-nuclei of a fertilized egg. Injection of DNA into the cytoplasm of a zygote is also widely used. Most recently cloning of an entire transgenic cell line capable of injection into an unfertilized egg has been achieved (KHS Campbell et al., Nature 380 64-66, (1996)).
In a fifth aspect; he invention provides a transgenic expression vector for production of a transgenic lactating animal species comprising a nucleic acid of the invention, a promoter operatively coupled to the nucleic acid which directs mammary gland expression of the protein encoded by the nucleic acid into the milk of the transgenic animal. The mammary gland expression system has the advantages of high expression levels, low cost, correct processing and accessibility. Known proteins, such as bovine and human alpha-lactalbumin have been produced in lactating transgenic animals by several researchers. (Wright et al, Bio/Technology 9:830-834 (1991); Vilotte et al, Eur. J. Biochem., 186:43-48 (1989); Hochi et al., Mol Reprod. And Devel. 33:160-164 (1992); Soulier et al., FEBS Letters 297(1,2):13-18 (1992)) and the system has been shown to produce high levels of protein.
Preferred promoters are active in the mammary tissue. Particularly useful are promoters that are specifically active in genes encoding milk specific proteins such as genes found in mammary tissue, i.e. are more active in mammary tissue than in other tissues under physiological conditions where milk is synthesized. Most preferred are promoters that are both specific to and efficient in mammary tissue. Among such promoters, the casein, lactalbumin and lactalglobulin promoters are preferred, including, but not limited to the alpha, beta and gamma casein promoters and the alpha lactalbumin and beta-lactalglobulin promoters. Preferred among the promoters are those from rodent, goats and cows. Other promoters include those that regulate a whey acidic protein (WAP) gene.
In a preferred embodiment of the invention, a modified nucleic acid encoding MSP-1 or fragments thereof capable of expression in a cell culture system, mammalian cell culture system or in the milk of a transgenic animal is provided. Nucleic acid sequences encoding the natural MSP-1 gene are modified in accordance with the invention. First the overall AT content is reduced by replacing codons of the natural gene with codons recognizable to, and preferably with codons preferred by the cell system of choice, that encode the same amino acid but are sufficient to lower the AT content of the modified nucleic acid as compared to the native MSP-1 gene or gene fragment. Second, mRNA instability motifs (AUUUA, Shaw and Kamen, supra) in the native gene or gene fragment are eliminated from the coding sequence of the gene by replacing codons of the natural gene with codons recognizable to, and preferably prefrred by the cell system of choice that encode the same amino acid but are sufficient to eliminate the mRNA instability motif. Optionally, any other codon of the native gene may be replaced with a preferred codon of the expression system of choice as described.
In a sixth aspect, the invention provides a DNA vaccine comprising a modified nucleic acid according to the invention. In certain preferred embodiments, the DNA vaccine comprises a vector according to the invention, The DNA vaccine according to the invention may be in the form of a “naked” or purified modified nucleic acid according to the invention, which may or may not be operatively associated with a promoter. A nucleic acid is operatively associated with a promoter if it is associated with the promoter in a manner which allows the nucleic acid sequence to be expressed. Such DNA vaccines may be delivered without encapsulation, or they may be delivered as part of a liposome, or as part of a viral genome. Generally, such vaccines are delivered in an amount sufficient to allow expression of the nucleic acid and elicit an antibody response in an animal, including a human, which receives the DNA vaccine. Subsequent deliveries, at least one week after the first delivery, may be used to enhance the antibody response. Preferred delivery routes include introduction via mucosal membranes, as well as parenteral administration.
A preferred embodiment of this aspect of the invention comprises a fragment of a modified MSP-1 gene according to the invention. Such fragment preferably includes from about 5% to about 100% of the overall gene sequence and comprises one or more modification according to the invention.
Examples of codon usage from E coli and human are shown in
The following examples illustrate certain preferred modes of making and practicing the present invention, but are not meant to limit the scope of the invention since alternative methods may be utilized to obtain similar results.
EXAMPLESCreation of Novel Modified MSP-142 Gene
In one embodiment, a novel modified nucleic acid encoding the C-terminal fragment of MSP-1 is provided. The novel, modified nucleic acid of the invention encoding a 42 kD C-terminal part of MSP-1 (MSP-142) capable of expression in mammalian cells of the invention is shown in
An expression vector was created using the modified MSP-142 gene by fusing the first 26 amino acids of goat beta-casein to the N-terminal of the modified MSP-142 gene and a SalI-Xho I fragment which carries the fusion gene was subcloned into the XhoI site of the expression vector pCDNA3. A His6 tag was fused to the 3′ end of the MSP-142 gene to allow the gene product to be affinity purified. This resulted in plasmid GTC627 (
To compare the natural MSP-142 gene construct to the modified MSP-142 nucleic acid of the invention, an expression vector was also created for the natural MSP-142 gene and the gene was added to mammalian cell culture and injected into mice to form transgenic mice as follows:
Construction of the Native MSP-142 Expression Vector
To secrete the truncated the merozoite surface protein-I (MSP-1) of Plasmodium falciparum, the wild type gene encoding the 42 KD C-terminal part of MSP-1 (MSP-142) was fused to either the DNA sequence that encodes the first 15 or the first 25 amino acids of the goat beta-casein. This is achieved by first PCR amplify the MSP-1 plasmid (received from Dr. David Kaslow, NIH) with primers MSP1 and MSP2 (
Native MSP-142 Gene is not Expressed in COS-7 Cells
Expression of the native MSP gene in cultured COS-7 cells was assayed by transient transfection assays. GTC479 and GTC564 plasmids DNA were introduced into COS-7 cells by lipofectamine (Gibco-BRL) according to manufacturer's protocols. Total cellular RNA was isolated from the COS cells two days post-transfection. The newly synthesized proteins were metabolically labeled for 10 hours by adding 35S methionine added to the culture media two days-post transfection.
To determine the MSP mRNA expression in the COS cells, a Northern blot was probed with a 32P labeled DNA fragment from GTC479. No MSP RNA was detected in GTC479 or GTC564 transfectants (data not shown). Prolonged exposure revealed residual levels of degraded MSP mRNA. The 35S labeled culture supernatants and the lysates were immunoprecipitated with a polyclonal antibody raised against MSP. Immunoprecipitation experiments showed that no expression from either the lysates or the supernatants of the GTC479 or GTC564 transfected cells (data not shown). These results showed that the native MSP-1 gene was not expressed in COS cells.
Native MSP-142 Gene is not Expressed in the Mammary Gland of Transgenic Mice
The SalI-XhoI fragment of GTC479, which encoded the 15 amino acids of goat beta-casein signal peptide, the first 11 amino acids of goat beta-casein, and the native MSP-142 gene, was cloned into the XhoI site of the beta-casein expressed in vector BC350. This yielded plasmid BC574 (
Expression of MSP in the Mammalian Cells
Transient transfection experiments were performed to evaluate the expression of the modified MSP-142 gene of the invention in COS cells. GTC627 and GTC479 DNA were introduced into the COS-7 cells. Total RNA was isolated 48 hours post-transfection for Northern analysis. The immobilized RNA was probed with 32P labeled SalI-XhoI fragment of GTC627. A dramatic difference was observed between GTC479 and GTC627. While no MSP-142 mRNA was detected in the GTC479 transfected cells as shown previously, abundant MSP-142 mRNA was expressed by GTC627 (
These results demonstrated that the modification of the parasitic MSP-142 gene lead to the expression of MSP mRNA in the COS cells. Consequently, the MSP-142 product was synthesized and secreted by mammalian cells.
Polyclonal antibodies used in this experiment may also be prepared by means well known in the art (Antibodies: A Laboratory Manual, Ed Harlow and David Lane, eds. Cold Spring Harbor Laboratory, publishers (1988)). Production of MSP serum antibodies is also described in Chang et al., Infection and Immunity (1996) 64:253-261 and Chang et al., (1992) Proc Natl. Acad. Sci. USA 86:6343-6347.
The results of this analysis indicate that the modified MSP-142 nucleic acid of the invention is expressed at a very high level compared to that of the natural protein which was not expressed at all. These results represent the first experimental evidence that reducing the AT % in a gene leads to expression of the MSP gene in heterologous systems and also the first evidence that removal of AUUUA mRNA instability motifs from the MSP coding region leads to the expression of MSP protein in COS cells.
Thus, the data presented here suggest that certain heterologous proteins that may be difficult to express in cell culture or transgenic systems because of high AT content and/or the presence of instability motifs, and or the usage of rare codons which are unrecognizable to the cell system of choice may be reengineered to enable expression in any given system with the aid of codon usage tables for that system. The present invention represents the first time that a DNA sequence has been modified with the goal of removing suspected sequences responsible for degradation resulting in low RNA levels or no RNA at all. The results shown in the
The following examples describe the expression of MSP1-42 as a native non-fusion (and non-glycosylated) protein in the milk of transgenic mice.
Construction of MSP Transgene
To fuse MSP1-42 to the 15 amino acid β-casein signal peptide, a pair of oligos, MSP203 and MSP204 (MS P203: ggccgctcgacgccaccatgaaggtcctcataattgcc tgtctggtggctctggccattgcagtcactccctccgtcat, MSP204: cgatgacggagggagtgacggctg caatggccagagccaccagacaggcattatgaggaccttcatggtggcgtcgagc), which encode the 15 amino acid—casein signal and the first 5 amino acid of the MSP1-42 ending at the Cla I site, was ligated with a Cla I-Xho I fragment of BC620 (Fit. 8) which encodes the rest of the MSP1-42 gene, into the Xho I site of the expression vector pCDNA3. A Xho I fragment of this plasmid (GTC669) was then cloned into the Xho I site of milk specific expression vector BC350 Lo generate B670 (
Expression of MSP1-42 in the Milk of Transgenic Mice
A Sal I-Not I fragment was prepared from plasmid BC670 and microinjected into the mouse embryo to generate transgenic mice. Transgenic mice was identified by extracting mouse DNA from tail biopsy followed by PCR analysis using oligos GTC17 and MSP101 (sequences of oligos: GTC17, GATTGACAAGTAATACGCTGTTTCCTC, Oligo MSP 101, GGATTCAATAGATACGG). Milk from the female founder transgenic mice was collected at day 7 and day 9 of lactation, and subjected to western analysis to determine the expression level of MSP-1-42 using an polyclonal anti-MSP antibody and monoclonal anti MSP antibody 5.2 (Dr. David Kaslow. NIH). Results indicated that the level of MSP-1-42 expression in the milk of transgenic mice was at 1-2 mg/ml (
Construction of MSP1-42 Glycosylation Sites Minus Mutants
Our analysis of the milk produced MSP revealed that the transgenic MSP protein was N-glycosylated. To eliminate the N-glycosylation sites in the MSP1-42 gene, Asn. (N) at positions 181 and 262 were substituted with Gln.(Q). The substitutions were introduced by designing DNA oligos that anneal to the corresponding region of MSP1 and carry the AAC to CAG mutations. These oligos were then used as PCR primers to produce DNA fragments that encode the N to Q substitutions.
To introduce N262-Q mutation, a pair of oligos, MSPGYLYCO-3 (CAGGGAATGCTGCAGATCAGC) AND MSP42-2 (AATTCTCGAGTTAGTG GTGGTGGTGGTGGTGATCGCAGAAAATACCATG,
To introduce N181-Q mutation, oligos MSPGLYCO-1 (CTCCTTGTTCAGG AACTTGTAGGG) and MSPGLCO-2 (GTCCTGCAGTACACATATGAG.
The MSP double glycosylation mutant was constructed by the following three steps: first, a Xho I-Bsm I fragment of BC670 and the Bsm I-Xho I fragment of GTC716 is ligated into the Xho I site of vector pCR2.1. This resulted a plasmid that contain the MSP-1-42 gene with N262-Q mutation. EcoN I-Nde I fragment of this plasmid was then replaced by the EcoN I-Nde I fragment from plasmid GTC716 to introduce the second mutation, N181-Q. A Xho I fragment of this plasmid was finally cloned into BC350 to generate BC718 (
Expression of Nonglycosylated MSP1 in Transgenic Animals
BC718 has the following characteristics: it carries the MSP 1-42 gene under the control of the β-casein promoter so it can be expressed in the mammary gland of the transgenic animal during lactation. Further, it encodes a 15 amino acid β-casein leader sequence fused directly to MSP 1-42, so that the MSP1-42, without any additional amino acid at its N-terminal, can be secreted into the milk. Finally, because the N-Q substitutions, the MSP produced in the milk of the transgenic animal by this construct will not be N-glycosylated. Taken together, the transgenic MSP produced in the milk by BC718 is the same as the parasitic MSP.
A SalI/XhoI fragment was prepared from plasmid BC718 and microinjected into mouse embryos to generate transgenic mice. Transgenic animals were identified as described previously. Milk from female founders was collected and analyzed by Western blotting with antibody 5.2. The results, shown in
Equivalents
Those skilled in the art will recognize, or be able to ascertain, using no more than routine experimentation, numerous equivalents are considered to be within the scope of this invention, and are covered by the following claims.
Claims
1-26. (Cancelled)
27. A method for producing a parasite protein or fragment thereof in milk of a non-human transgenic mammal, comprising:
- providing said non-human transgenic mammal whose genome comprises a modified nucleic acid sequence encoding said parasite protein or fragment thereof operably linked to a promoter which directs expression in a mammary gland, wherein said modified nucleic acid sequence has been modified by replacing one or more AT-containing codons of the nucleic acid sequence of said parasite protein or fragment thereof as it naturally occurs in a parasite with a codon or codons preferred by a mammalian cell for the purposes of expression and encoding the same parasite protein or fragment thereof as derived from said parasite; and allowing said non-human transgenic mammal to express said parasite protein or fragment thereof in its milk, to thereby produce said parasite protein or fragment thereof.
28. The method of claim 27, wherein all of the codons of the naturally occurring nucleic acid sequence have been replaced with a codon or codons preferred by a mammalian cell for the purposes of expression and encoding the same parasite protein or fragment thereof as found in the naturally occurring nucleic acid sequence.
29. The method of claim 27, wherein said parasite protein or fragment thereof is expressed in the milk of said non-human transgenic mammal at a level of at least 0.5 mg/ml.
30. The method of claim 27, wherein said parasite protein or fragment thereof is expressed in the milk of said non-human transgenic mammal at a level which is between 1.0 mg/ml and 2.0 mg/ml.
31. The method of claim 27, wherein said parasite protein or fragment thereof as expressed in said non-human transgenic mammal can be detectably expressed in the milk of said transgenic non-human mammal.
32. The method of claim 27, wherein all non-preferred codons are replaced with a codon or codons preferred by a mammalian cell for the purposes of expression.
33. The parasite protein or fragment thereof as produced by the method of claim 27.
34. The method of claim 27 wherein said parasite protein or fragment thereof is a protein, polypeptide or peptide derived from the Plasmodium falciparum protein MSP-1.
35. The method of claim 27 wherein said mammalian cell for the purposes of expression is a mammary epithelial cell.
36. The method of claim 27 wherein said promoter is selected from a group of promoters consisting of:
- a) beta-casein;
- b) bovine lactoglobulin;
- c) whey acid promoter;
- d) alpha-ovalbumin; and
- e) caprine casein.
37. The method of claim 27 wherein said non-human transgenic mammal is selected from a group of mammals consisting of:
- a) caprine;
- b) bovine;
- c) porcine;
- d) rodent; and
- e) ovine.
38. The method of claim 27 wherein said modified nucleic acid sequence is modified to provide for the expression of a modified amino acid sequence such at least one glycosylation site on said parasite protein or protein fragment thereof produced by said non-human transgenic mammal is eliminated.
39. A method for producing a parasite protein or fragment thereof in the milk of a non-human transgenic mammal, comprising:
- providing said non-human transgenic mammal whose genome comprises a modified nucleic acid sequence encoding said parasite protein or fragment thereof operably linked to a promoter which directs expression in a mammary gland, wherein said nucleic acid sequence of said parasite protein or fragment thereof has been modified by replacing at least a portion of an AUUUA mRNA instability motif in a coding sequence of said parasite protein or fragment thereof as it naturally occurs in a parasite with a codon or codons preferred by a mammalian cell for the purposes of expression so as to remove said AUUUA mRNA instability motif or prevent said AUUUA mRNA instability motif from destabilizing mRNAs encoding said parasite protein or fragment thereof while encoding an amino acid which is the same as the replaced portion of said AUUUA mRNA instability motif;
- allowing said non-human transgenic mammal to express said parasite protein or fragment thereof in its milk, to thereby produce said parasite protein or fragment thereof, and wherein the naturally occurring nucleic acid sequence encoding said parasite protein or fragment thereof contains at least one AUUUA instability motif; and,
40. The method of claim 39, wherein each of said AUUUA mRNA instability motifs present in the naturally occurring nucleic acid have been replaced by a codon or codons preferred by a mammalian cell for the purposes of expression so as to remove said AUUUA mRNA instability motif or prevent said AUUUA mRNA instability motif from destabilizing mRNAs encoding said parasite protein or fragment thereof.
41. The method of claim 39, wherein said modified nucleic acid sequence further comprises at least one additional codon other than a first codon replaced to lower AT content or a nucleic acid sequence modification made to eliminate said AUUUA mRNA instability motif which has been replaced with a codon or codons preferred by a mammalian cell for the purposes of expression and encoding the same parasite protein or fragment thereof as found in the naturally occurring nucleic acid sequence.
42. The method of claim 39 wherein said parasite protein or fragment thereof is a protein, polypeptide or peptide derived from the Plasmodium falciparum protein MSP-1.
43. The method of claim 39 wherein said mammalian cell for the purposes of expression is a mammary epithelial cell.
44. The method of claim 39 wherein said promoter is selected from a group of promoters consisting of:
- a) beta-casein;
- b) bovine lactoglobulin;
- c) whey acid promoter;
- d) alpha-ovalbumin; and
- e) caprine casein.
45. The method of claim 39 wherein said non-human transgenic mammal is selected from a group of mammals consisting of:
- a) caprine;
- b) bovine;
- c) porcine;
- d) rodent; and
- e) ovine.
46. A method for producing a parasite protein or fragment thereof in the milk of a non-human transgenic mammal, comprising:
- providing a non-human transgenic mammal whose genome comprises a modified nucleic acid sequence encoding said parasite protein or fragment thereof operably linked to a promoter which directs expression in a mammary gland, wherein said modified nucleic acid sequence has been modified by: a) replacing at least a portion of an AUUUA mRNA instability motif in the coding sequence of said parasite protein or fragment thereof as it naturally occurs in a parasite with a codon or codons preferred by a mammalian cell for the purposes of expression so as to remove said AUUUA mRNA instability motif or prevent said AUUUA mRNA instability motif from destabilizing mRNAs encoding said parasite protein or fragment thereof while encoding the same amino acid as the replaced portion of said AUUUA mRNA instability motif; b) replacing one or more AT-containing codons of said modified nucleic acid sequence as it naturally occurs in said parasite with a codon or codons preferred by a mammalian cell for the purposes of expression and encoding the same amino acid as the replaced codon; c) allowing said non-human transgenic mammal to express said parasite protein or fragment thereof in its milk, to thereby produce said parasite protein or fragment thereof and wherein the naturally occurring nucleic acid sequence encoding said parasite protein or fragment thereof contains at least one AUUUA instability motif; and,
47. The method of claim 46, wherein each of said AUUUA mRNA instability motifs present in the naturally occurring nucleic acid have been replaced by a codon or codons preferred by a mammalian cell for the purposes of expression so as to remove said AUUUA mRNA instability motif or prevent said AUUUA mRNA instability motif from destabilizing mRNAs encoding said parasite protein or fragment thereof.
48. The method of claim 46, wherein said modified nucleic acid sequence further comprises at least one additional codon other than a first codon replaced to lower AT content or a nucleic acid sequence modification made to eliminate said AUUUA mRNA instability motif which has been replaced with a codon or codons preferred by a mammalian cell for the purposes of expression and encoding the same parasite protein or fragment thereof as found in the naturally occurring nucleic acid sequence.
49. The method of claim 46, wherein all of the codons of the naturally occurring nucleic acid sequence have been replaced with a codon or codons preferred by a mammalian cell for the purposes of expression and encoding the same parasite protein or fragment thereof as found in the naturally occurring nucleic acid sequence.
50. The method of claim 46, wherein said parasite protein or fragment thereof is expressed in the milk of said non-human transgenic mammal at a level of at least 0.5 mg/ml.
51. The method of claim 46, wherein said parasite protein or fragment thereof is expressed in the milk of said non-human transgenic mammal at a level which is between 1.0 mg/ml and 2.0 mg/ml.
52. The method of claim 46, wherein said parasite protein or fragment thereof as expressed in said non-human transgenic mammal can be detectably expressed in the milk of said transgenic non-human mammal.
53. The method of claim 46, wherein all non-preferred codons are replaced with a codon or codons preferred by a mammalian cell for the purposes of expression.
54. The parasite protein or fragment thereof as produced by the method of claim 46.
55. The method of claim 46 wherein said parasite protein or fragment thereof is a protein, polypeptide or peptide derived from the Plasmodium falciparum protein MSP-1.
56. The method of claim 46 wherein said mammalian cell for the purposes of expression is a mammary epithelial cell.
57. The method of claim 46 wherein said promoter is selected from a group of promoters consisting of:
- a) beta-casein;
- b) bovine lactoglobulin;
- c) whey acid promoter;
- d) alpha-ovalbumin; and
- e) caprine casein.
58. The method of claim 46 wherein said non-human transgenic mammal is selected from a group of mammals consisting of:
- a) caprine;
- b) bovine;
- c) porcine;
- d) rodent; and
- e) ovine.
59. The method of claim 46 wherein said modified nucleic acid sequence is modified to provide for the expression of a modified amino acid sequence such at least one glycosylation site on said parasite protein or protein fragment thereof produced by said non-human transgenic mammal is eliminated.
60. A transgenic non-human mammal whose germline comprises a modified nucleic acid sequence encoding a parasite protein or fragment thereof operably linked to a promoter which directs expression in a mammary gland, wherein said modified nucleic acid sequence has been modified by replacing at least a portion of an AUUUA mRNA instability motif in a coding sequence as it naturally occurs in a parasite with a codon or codons preferred by a mammalian cell for the purposes of expression so as to remove said AUUUA mRNA instability motif or prevent said AUUUA mRNA instability motif from destabilizing mRNAs encoding said parasite protein or fragment thereof while encoding the same amino acid as the replaced portion of said AUUUA mRNA instability motif and by replacing one or more AT-containing codons of the nucleic acid sequence of said parasite protein or fragment thereof as it naturally occurs in the parasite with a codon or codons preferred by a mammalian cell for the purposes of expression and encoding the same amino acid as the replaced codon, wherein said non-human transgenic mammal expresses said parasite protein or fragment thereof in its milk and wherein the naturally occurring nucleic acid sequence encoding said parasite protein or fragment thereof contains at least one AUUUA instability motif; and,
61. The mammal of claim 60, wherein each of said AUUUA mRNA instability motifs present in the naturally occurring nucleic acid have been replaced by a codon or codons preferred by a mammalian cell for the purposes of expression so as to remove said AUUUA mRNA instability motif or prevent said AUUUA mRNA instability motif from destabilizing mRNAs encoding said parasite protein or fragment thereof.
62. The mammal of claim 60, wherein said modified nucleic acid sequence further comprises at least one additional codon other than a first codon replaced to lower AT content or a nucleic acid sequence modification made to eliminate said AUUUA mRNA instability motif which has been replaced with a codon or codons preferred by a mammalian cell for the purposes of expression and encoding the same parasite protein or fragment thereof as found in the naturally occurring nucleic acid sequence.
63. The mammal of claim 60, wherein all of the codons of the naturally occurring nucleic acid sequence have been replaced with a codon or codons preferred by a mammalian cell for the purposes of expression and encoding the same parasite protein or fragment thereof as found in the naturally occurring nucleic acid sequence.
64. The mammal of claim 60, wherein said parasite protein or fragment thereof is expressed in the milk of said non-human transgenic mammal at a level of at least 0.5 mg/ml.
65. The mammal of claim 60, wherein said parasite protein or fragment thereof is expressed in the milk of said non-human transgenic mammal at a level which is between 1.0 mg/ml and 2.0 mg/ml.
66. The mammal of claim 60, wherein said parasite protein or fragment thereof as expressed in said non-human transgenic mammal can be detectably expressed in the milk of said transgenic non-human mammal.
67. The mammal of claim 60, wherein all non-preferred codons are replaced with a codon or codons preferred by a mammalian cell for the purposes of expression.
68. The parasite protein or fragment thereof as produced by the mammal of claim 60.
69. The mammal of claim 60 wherein said parasite protein or fragment thereof is a protein, polypeptide or peptide derived from the Plasmodium falciparum protein MSP-1.
70. The mammal of claim 60 wherein said mammalian cell for the purposes of expression is a mammary epithelial cell.
71. The mammal of claim 60 wherein said promoter is selected from a group of promoters consisting of:
- a) beta-casein;
- b) bovine lactoglobulin;
- c) whey acid promoter;
- d) alpha-ovalbumin; and
- e) caprine casein.
72. The mammal of claim 60 wherein said non-human transgenic mammal is selected from a group of mammals consisting of:
- a) caprine;
- b) bovine;
- c) porcine;
- d) rodent; and
- e) ovine.
73. The mammal of claim 60 wherein said modified nucleic acid sequence is modified to provide for the expression of a modified amino acid sequence such at least one glycosylation site on said parasite protein or protein fragment thereof produced by said non-human transgenic mammal is eliminated.
Type: Application
Filed: Sep 24, 2004
Publication Date: Mar 31, 2005
Inventors: Li Chen (Acton, MA), Harry Meade (Newton, MA)
Application Number: 10/949,975