tree named ‘Pam's mountain bouquet’

A new and distinct cultivar of flowering dogwood tree, which has fused bracts is provided. This dogwood tree is botanically known as Cornus kousa and referred to by the following cultivar name: ‘Pam's Mountain Bouquet’.

Skip to: Description  ·  Claims  ·  References Cited  · Patent History  ·  Patent History
Description
BACKGROUND OF THE INVENTION

The present invention relates to a new and distinct cultivar of flowering dogwood tree cultivar, which has fused bracts. This dogwood tree is botanically known as Cornus kousa and hereinafter referred to by the following cultivar name: ‘Pam's Mountain Bouquet’.

This new dogwood cultivar was discovered in a planting of seedlings within a cultivated area in Oak Ridge, Tenn. ‘Pam's Mountain Bouquet’ is a selection from the original seedlings grown in Oak Ridge, Tenn. from seed gifted by Polly Hill. Asexual reproduction of ‘Pam's Mountain Bouquet’ by rooting of harvested terminal cuttings and grafting of axillary buds onto seedling rootstocks in Oak Ridge, Tenn. and at a nursery located in Belvidere Tenn. have shown that the unique features of this new dogwood cultivar are stable and reproduced true-to-type in successive vegetative generations.

BRIEF DESCRIPTION OF THE DRAWINGS

FIG. 1. Photograph of ‘Pam's Mountain Bouquet’. Colors in the photograph may differ from actual colors due to lighting and light reflectance.

FIGS. 2A and 2B. Close-up Photographs of ‘Pam's Mountain Bouquet’ bracts.

FIG. 3. Dendrogram illustrating the relatedness of “Pam's Mountain Bouquet” to other selected Cornus kousa cultivars using 11 microsatellite (SSR; Simple Sequence Repeat) markers. Note: Cultivar Beni Fuji is disclosed in U.S. Plant. Pat. No. 8,676.

DETAILED DESCRIPTION OF THE NEW VARIETY

A new and distinct cultivar of flowering dogwood tree cultivar, which has fused bracts is provided. This dogwood tree cultivar is botanically known as Cornus kousa and referred to by the following cultivar name: ‘Pam's Mountain Bouquet’. This cultivar appears to be resistant to powdery mildew caused by Erisphe pulchra and dogwood anthracnose caused by Discula destructiva.

This new and distinct dogwood tree cultivar was discovered in a planting of seedlings within a cultivated area in Oak Ridge, Tenn. and arose from seed gifted by Ms. Polly Hill. ‘Pam's Mountain Bouquet’ is a selection from the original seedlings. The instant cultivar was derived from open-pollinated seeds that were bulked from maternal parents ‘Big Apple’, ‘Snowbird’, ‘Steeple’ and an unnamed tree and the potential paternal parents ‘Big Apple’, ‘Julian’, ‘Steeple’ and another unnamed tree (Auge et al., 2002). Thus, it is not possible to ascertain the exact parentage. The subject dogwood tree cultivar differs from all of the potential parents in that the instant cultivar has fused bracts, whereas none of the potential parent cultivars show the same characteristic.

Asexual reproduction of ‘Pam's Mountain Bouquet’ by rooting of harvested terminal cuttings and grafting of axillary buds onto seedling rootstocks in Oak Ridge, Tenn. and at a nursery located in Belvidere, Tenn. has shown that the unique features of this new dogwood cultivar are stable and reproduced true-to-type in successive generations.

DETAILED BOTANICAL DESCRIPTION

The following observations, measurements and comparisons describe this cultivar grown in Oak Ridge, Tenn. Trees used for this description were about twenty (20) years old. Plant hardiness is expected to be zones 4-9. The color characteristic descriptions use color references to The Royal Horticultural Society (R.H.S.) Colour Chart (published 2001), except where general terms of ordinary dictionary significance are used. Measurements are provided as an average (with ranges also provided as indicated).

The following Table 1 shows microsatellite (SSR) markers used to perform unweighted pair group with arithmetic mean (UPGMA) cluster analysis of 29 cultivars and lines of Cornus kousa. GenBank accession numbers are given along with, locus designations, forward (F) and reverse (R) primer sequences (5′-3′ direction), and repeat motif:

TABLE 1 GenBank acces- sion no. Locus Primer sequences (5'-3') Repeat EU544308 CK005 F:GCATTTGTCCTTTGTTTGACAT (AC)20 (SEQ ID NO: 1) R:TTTTTCGCGAAGTGTTCTCTAC (SEQ ID NO: 2) EU125522 CK007 F:GAGCCCAGAAGAAGAATATAGAC (AG)8 (SEQ ID NO: 3) R:ATATAATTGGGTTGGGTTTTG (SEQ ID NO: 4) EU125523 CK015 F:GTCAAATTTTTGATCTTTCTCTCT (CT)10 (SEQ ID NO: 5) R:GGAGAGACAGAGTACAGTAGAGGT (SEQ ID NO: 6) EU125524 CK029 F:AATTTAGGTTAAGGTTTTGATTTG (TC)8 (SEQ ID NO: 7) R:AGAGAGAATAGGTTACAGCATCAT (SEQ ID NO: 8) EU125525 CK031 F:TGTCACTGCTTACAGAAACAAT (CT)7 (SEQ ID NO: 9) R:TATGACGAGATTGTATAAGTTGCT (SEQ ID NO:10) EU125526 CK040 F:CCAAGTCAGTTTGGTAGTAATTC (GT)16 (SEQ ID NO: 11) R:AGTGCAACTTTTACTTGCTATGT (SEQ ID NO: 12) EU125529 CK048 F:ACCAACCAAAAGAAGTATAAAGAA (TA)6 (SEQ ID NO: 13) R:CCTATAAATAAGGAGTGATTTGGT (SEQ ID NO: 14) EU544309 CK058 F:CTTAAGTCACAAAGACAATGAAAT (GT)10 (SEQ ID NO: 15) R:AAGAGAGTTCAGATTTATCTTTGC (SEQ ID NO: 16) EU544310 CK070 F:CTTTTCTACACCCTTAACAAGTG (GT)9 (SEQ ID NO: 17) R:TAGACAATATGTGCTTAATTGGTT (SEQ ID NO: 18) EU544311 CK071 F:CTGCTCGGTTAAGGTATGTT  (TG)9 (SEQ ID NO: 19) R:TTTAAAGTGCGTTGTATACATAA AT (SEQ ID NO: 20) EU544312 CK072 F:AGCACTCATAGTCCTTGCAC (GT)10 (SEQ ID NO: 21) R:GTTAAAACGAAGAAGATACAACAA (SEQ ID NO: 22)

TABLE 2 Characteristics of Pam's Mountain Bouquet' Color Descriptions are based upon the Royal Horticultural Society's (RHS) colour chart, 2001. Comparative Variety Generalized ‘Pam's Mountain (Milky Character Characteristics Bouquet’ Way Select) 1 Tree form upright spreading Spreading- (observation) semi-upright to semi- spreading upright weeping others 2 Tree height dwarf low Medium (observation) low (about 3-4 meters; medium spread about 4 -5 high meters, and very high dependent on age and environment) 3 Branch thickness thin medium Medium (measurement) medium (age dependent) Thickness in the thick middle portion of a plant 4 Color of current Yellow Green Green Shoot Yellow green 143B 143B (observation) Green current shoot Grayish green color in the Purple middle portion Crimson of a plant Brown Others 5 Branch color Yellow Greyed; Green Greyed; (observation) Yellow green 198B Green current branch Green 198B color in the Purplish middle portion crimson of a plant Crimson second year+ Brown Others 6 Dark spots on Absent Absent Absent Branch Present (observation) presence of dark spots on the branch 7 Branching Low High Medium (observation) Medium density of High branching 8 Internode length Short Short Short (measurement) medium Internode length long in the middle portion of a plant 9 whole shape of Lanceolate Obovate Obovate leaves Oblanceolate (observation) Oblong see Fig. 1 whole Elliptical shape of a leaf in Ovate the middle Obovate portion of a plant Orbicular Others 10 Shape of leaf Acuminate Acuminate Acuminate tip(observation) Acute see Fig. 2 Tip obtuse shape of a leaf in Rotundate the middle Others portion of a plant 11 Shape of leaf Acuminate Truncate Truncate Base Acute (observation) obtuse see FIG. 2A Rotundate and FIG. 2B Others Base shape of a leaf in the middle portion of a plant 12 Shape of leaf Entire Entire Entire Margin others (observation) shape of a leaf margin in the middle portion of a plant 13 Leaf rolling Rolling inward Rolling inward Rolling (observation) Flat inward Rolling outward 14 Leaf curvature In-curved Flat Flat (observation) Flat Out-curved 15 Leaf margin None None None Undulation presence (observation) 16 Leaf length Short Long Medium (measurement) Medium (about 10-14 cm) Length from the long tip to the base of mature leaf 17 Leaf width Narrow Narrow Medium (measurement) Medium (about 4-5 cm) The maximum wide width of mature leaf 18 Leaf thickness Thin Medium Medium (observation) Medium Thickness of Thick mature leaf 19 Bud color Yellowish Grayish green Grayish (observation) white 179A Green Color of bud just Yellow 191A after sprouting Yellow green Green Grayish green Crimson Others 20 Immature leaf Yellowish Light Green Light Green color white 135B 135B (observation) Yellow Yellow green Green Grayish green pink Crimson others 21 Presence of Absent Absent Absent anthocyanin present (observation) Coloration by anthocyanin on the immature leaf upperside 22 Color of leaf Yellow Green Green upperside Yellow green 143B 146A (observation) Green Color of mature Grayish green leaf upperside Purplish crimson Crimson others 23 Color of leaf Yellow Light Green Medium lowerside Yellow green 146B Green (observation) Light green 137A Color of mature Green leaf lowerside Dark green Grayish green Purplish crimson others 24 Seasonal change Unchanged Changed Changed of a mature leaf changed (observation) 25 Color of leaves in Yellow Red Dull Red to autumn Orange 10C -46A maroon (observation) Crimson 61B others 26 Leaf variegation Not variegated Not variegated Not (observation) variegated variegated Variegation on leaf upperside 27 Variegation Spotted NA NA pattern Splashed (observation) Margined Pattern of Centered variegation on a Blotched leaf upperside others 28 Variegation color White NA NA (observation) Yellowish white Greenish white Yellow Yellow Green Green Crimson others 29 seasonal change Unchanged NA NA of variegation changed color (observation) 30 Hair on leaf None None None upperside Low (observation) Medium hair density on a high mature leaf upperside 31 Hair on leaf None None None lowerside Low (observation) Medium hair density on a high mature leaf lowerside 32 Petiole length Short Short Medium (measurement) Medium (about 1.5-2.5 Length from Long cm.) the base of blade Very long to the base petiole 33 Petiole width Narrow Medium Medium (measurement) Medium (<8 mm) The maximum wide width of a mature leaf petiole 34 Petiole color Yellowish white Green Green (observation) Yellow Green 143B 143B Green Crimson others 35 Inflorescence Corymb Umbel Umbel type Umbel (observation) Head others 36 Inflorescence Upright Upright Upright direction Horizontal (observation) pendulous 37 Inflorescence Small Medium Medium diameter Medium (diagonal mean (observation) large length including bracts = 7.4 cm.; mean width not including bracts = 5.3 cm) 38 Flower diameter Small Small Small (measurement) Medium Large Very large 39 Floret diameter Small Small Small (measurement) Medium Large 40 Floret color White Yellow Greenish (observation) Yellowish white 150C yellow Greenish yellow 150C Light Green others 41 Bract type Single 83% are FUSED; Single and (observation) Semi-double 17% are Single unfused Full-double (see Table 3) others 42 Uniformity of Not uniform Not uniform Uniform bract size uniform (observation) 43 Bract over- Not overlap No overlap -- Slightly lapping Slightly fused overlap (observation) overlap overlap 44 Bract orientation Ascending Recurved, Horizontal (observation) Horizontal Reflexed, or Flat arching 45 Bract rolling Rolling inward Varies (may roll Horizontal (observation) Horizontal inward or Rolling outward outward 46 Degree of bract Weak strong Weak rolling Medium (observation) strong 47 Bract curvature In-curved Varies Horizontal (observation) Horizontal (can be recurved, Out-curved flat, or reflexed) 48 Bract twisting None None None (observation) Weak Medium strong 49 Whole shape of Oblong Obovate bracts Elliptical Ovate (observation) Ovate Obovate Orbicular others 50 Shape of bract Acuminate Acuminate apex Acute Acuminate (observation) Abtuse Rotundate Emarginated others 51 Bract length Short Medium Medium (measurement) Medium Long 52 Bract width Narrow FUSED Medium (measurement) Medium wide 53 Number of bracts Few FUSED, but 4 Medium(4) (measurement) Medium(4) Many(over 10) 54 Bract color (color of bract 155A 155A (measurement) in full bloom) (immature: 157A) 55 Bract variegation Not variegated Not variegated Not (observation) variegated variegated 56 Variegation Margined NA NA pattern Splashed (observation) Bi-colored Spotted shaded others 57 Variegation (Color of NA NA color variegation (measurement) pattern of a bract in full bloom) 58 Pistil color White Yellow green Yellow (observation) Yellowish Not coded green white Not coded Greenish white Yellow green Green others 59 Stigma color White Dark Green Green (observation) Yellowish (Not Coded) (Not white Coded) Greenish white Yellow green Green others 60 Peduncle Thin Medium Medium thickness Medium (measurement) thick 61 Peduncle length Short Long Medium (measurement) Medium (mean of 6.8 cm) long 62 Peduncle color Yellowish white Yellow green Yellow (observation) yellow 144B green Yellow green 144B Green Crimson brown others 63 Fruit shape Elliptical Globose Globose (observation) Ovate Obovate Globose others 64 Fruit length Short Medium Medium (measurement) Medium (about 4 cm) long 65 Fruit width Narrow Medium Medium (measurement) Medium (about 4 cm) wide 66 Fruit color Yellow Unripe:143B; Ripe: 33B (observation) Orange Ripe 33B to 43A. to 44A Crimson Highly variable Highly Purplish black depending on variable Black ripeness depending others on ripeness 67 Fragrance Absent Absent Absent (observation) present 68 Seed fertility Sterile High High (observation) Low Medium high 69 Time to the first Early Medium Medium flowering Medium (April-mid-May) (observation) late 70 Blooming habit Few Many Many (observation) Medium many 71 Flowering One season One season One season season flowering flowering flowering (observation) Recurrent blooming others 72 Flowering time Early Medium Medium (observation) Medium late 73 Deciduous or Deciduous Deciduous Deciduous evergreen Half-deciduous (observation) evergreen 74 Cold hardiness Weak Medium Medium (observation) Medium (to −20° C.—no strong effect) 75 Heat tolerance Weak Strong Strong (observation) Medium (to 40° C.—no strong effect) 76 Pest resistance Weak Strong Strong (observation) Medium (no specific pests strong noted; resistant to dogwood anthracnose and powdery mildew) 77 Disease Weak Strong Strong resistance Medium (observation) strong 78 79 Bark color n/a Grayed-Green Not 198B observed 80 Bark texture n/a Smooth Not observed 81 Angle of n/a 20°-30° from Not Emerging vertical stem observed Branches 82 Time to first leaf n/a Mid- to late-April Not bud burst observed 83 Leaf Vein color n/a Green-Greyed Not 192A observed 84 Immature Leaf n/a Similar to fully Not color expanded leaf observed color 85 Bract base n/a Truncate Not observed 86 Bract margin n/a Entire Not observed 87 Vestiture n/a Puberulous, Not reticulate observed 88 Flower/ n/a Mean = 34 Not inflorescensce observed number 89 Seed shape n/a Flattened along Not length observed 90 Seed color n/a Greyed Yellow Not 162D observed 91 Seed number n/a 0-17 per fruit Not observed 92 Bloom duration n/a 3-5 weeks Not (dried, dead observed bracts are retained as a “collar” on peduncle until fruit fall in Autumn) 93 Time of Fruit n/a Begins mid- to Not Ripening late-August observed through October 94 Trunk diameter n/a 18 cm at 15 years Not (at approximately of age observed breast height) 95 Anther color n/a Greyed-purple Not N186 observed 96 Flower petal n/a Yellow-green Not color 145C observed 97 Style/Stigma n/a Inconspicuous Not description observed
  • Botanical classification: Cornus kousa ‘Pam's Mountain Bouquet’.
  • Unique features: This tree features heavy flowering and exhibits fused bracts. About 82% of all bracts on the cultivar exhibit some degree of fusion (one side, two sides or three to four sides being fused; see data in Table 3).

TABLE 3 Cornus kousa ‘Pam's Mountain Bouquet’ bract characteristics. One side Two sides 3-4 sides Year Not fused fused fused fused 2008 (n = 50) 7 (14%) 3 (6%) 12 (24%) 28 (56%) 2009 (n = 50) 10 (20%) 1 (2%) 4 (8%) 35 (70%) 2011 (n = 50) 9 (18%)  5 (10%) 9 (18%) 27 (54%) Mean 9 (18%) 3 (6%) 8 (16%) 30 (60%)
  • All categories of fused bracts=82%.
  • Disease susceptibility: None noted. Powdery mildew caused by Erisphe pulchra and dogwood anthracnose Discula destructiva were not observed. Nearby C. florida (flowering dogwood) trees were heavily infested with powdery mildew, but not dogwood anthracnose.
  • Insect damage: None noted.

REFERENCES

  • Auge, R. M., M. T. Windham, J. L. Moore, W. T. Witte, E. Kubikova, W. E. Klingeman, R. M. Evans, J. H. Reiss, P. C. Flanagan, and A. M. Saxton. 2002. Leaf curl and water relations of kousa dogwoods showing resistance to summer stress. J. Environ. Hort. 20 (3):143-147.
  • Wadl, P. A., X. Wang, A. N. Trigiano, J. A. Skinner, M. T. Windham, T. A. Rinehart, S. M. Reed, V. R. Pantalone and R N. Trigiano. 2008. Molecular identification key for cultivars and lines of Cornus florida and C. kousa based on microsatellite loci. J. Amer. Soc. Hort. Sci. 133 (6): 783-793.
  • Wadl, P. W., X. Wang, B. E. Scheffler, T. A. Rinehart, and R. N. Trigiano. 2008. Microsatellites from kousa dogwood (Cornus kousa). Molec. Ecol. Res. 8:780-782. DOI:10.1111/j.1471-8286.2007.0262.x.
  • Wadl, P. W., Windham, M. T., Evans, R., Trigiano, R. N. 2014. Three New Cultivars of Cornus kousa: Empire, Pam's Mountain Bouquet, and Red Steeple. HortScience 49 (9):1230-1233.

Claims

1. A new and distinct cultivar of Dogwood tree, Cornus kousa, named ‘PAM'S MOUNTAIN BOUQUET’, as illustrated and described.

Referenced Cited
Other references
  • Wadl, P.A. et al. “Microsatellites from kousa dogwood (Cornus kousa)” Molecular Ecology Resources, 2008, pp. 780-782, vol. 8.
  • Wadl, P.A. et al. “Molecular Identification Keys for Cultivars and Lines of Cornus florida and C. kousa Based on Simple Sequence Repeat Loci” Journal of the American Society for Horticultural Science, 2008, pp. 783-793, vol. 133, No. 6.
Patent History
Patent number: PP25575
Type: Grant
Filed: May 3, 2012
Date of Patent: May 26, 2015
Patent Publication Number: 20130298297
Assignee: University of Tennessee Research Foundation (Knoxville, TN)
Inventors: Robert N. Trigiano (Maryville, TN), Phillip A. Wadl (Powell, TN), Mark T. Windham (Knoxville, TN), Richard M. Evans (Oak Ridge, TN)
Primary Examiner: Anne Marie Grunberg
Application Number: 13/506,624
Classifications
Current U.S. Class: Dogwood (PLT/220)
International Classification: A01H 5/02 (20060101);