Abstract: A method for killing or substantially eradicating a pathogen in the upper respiratory tract of a mammal is disclosed. The method comprises generating molecular iodine (I2) in situ using an oxidant-reductant reaction with a minimum concentration of at least about 25 ppm of I2 and I2 comprises at least 40% of the total iodine atoms. A method for inhibiting superantigens using molecular iodine is also disclosed.

Abstract: The invention relates to the type 5 and type 8 capsular polysaccharides produced by overproducing S. aureus strains, and also to the immunogenic compositions and the vaccines comprising said capsular polysaccharides.

Abstract: A method for monitoring cleaning of a surface includes applying an amount of transparent indicator material to an area of a surface and measuring the amount of transparent indicator material remaining on the surface. The transparent indicator material may be fixed on the surface by drying and, when a fluorescent material, may be measured through exposure to ultraviolet radiation.

Abstract: An anti-tumor substance may be produced from a tumor cell-derived material by Staphylococcus. The anti-tumor substance may include a chemical compound having the formula: Staphylococcus may preferably be Staphylococcus lentus. Further, the tumor cell-derived material may preferably be an Ehrlich tumor cell-derived material.

Abstract: The present invention provides a method of detecting thermonuclease-positive staphylococci that does not require inactivation of DNase-positive/TNase-negative bacteria with heat. The method includes (a) providing a culture medium selective for growing staphylococci; (b) inoculating the culture medium with a sample; (c) incubating the inoculated culture medium under conditions effective to promote the growth of staphylococci; (d) providing an indicator system that produces a differentiable, detectable signal in the presence of thermonuclease-positive staphylococci; (e) contacting the indicator system with the inoculated, incubated culture medium, thereby forming a detection assembly; (f) incubating the detection assembly under conditions effective for generating the differentiable, detectable signal; and (g) detecting the detectable signal. The present invention also provides a culture medium for the selective identification of Staphylococcus aureus.

Abstract: The present invention provides methods, products, and compositions for selectively inhibiting the growth of Staphylococcus aureus without preventing the growth of Lactobacillus species. Specifically, the present invention discloses the use of tetrahydroiso alpha acid or hexahydro beta acid at a concentration effective to inhibit the growth of S. aureus without preventing the growth of Lactobacillus. The inhibition of S. aureus in accordance with the present invention thus provides useful methods, compositions and products such as feminine hygiene products for treating the diseases associated with S. aureus infections and infestations, i.e., toxic shock syndrome, without disrupting the normal bacterial flora in the area of its application.

Abstract: A method for identifying suitable targets for antibacterial agents based on identifying targets of bacteriophage-encoded proteins is described. Also described are compositions useful in the identification methods and in inhibiting bacterial growth, and methods for preparing and using such compositions.

Abstract: The disclosure concerns particular bacteriophage open reading frames, and portions and products of those open reading frames which have antimicrobial activity. Methods of using such products are also described.

Abstract: Strain of lactic acid bacterium, (1) whose 16S ribosomal RNA is characteristic of the genus Streptococcus, (2) whose total protein profile, obtained after migration of the total proteins on an SDS-PAGE electrophoresis gel, is characteristic of that of the strain of lactic acid bacterium CNCM I-1920 but distinct from those of the recognized species belonging to the genus Streptococcus, namely S. acidominimus, S. agalactiae, S. alactolyticus, S. anginosus, S. bovis, S. canis, S. caprinus, S. constellatus, S. cricetus, S. cristatus, S. difficile, S. downei, S. dysgalactiae ssp. dysgalactiae, S. dysgalactiae ssp. equisimilis, S. equi, S. equi ssp. equi, S. equi ssp. zooepidemicus, S. equinus, S. ferus, S. gallolyticus, S. gordonii, S. hyointestinalis, S. hyovaginalis, S. iniae, S. intermedius, S. intestinalis, S. macacae, S. mitis, S. mutans, S. oralis, S. parasanguinis, S. parauberis, S. phocae, S. pleomorphus, S. pneumoniae, S. porcinus, S. pyogenes, S. ratti, S. salivarius, S. sanguinis, S. shiloi, S.

Abstract: The invention concerns a novel chromogenic medium for isolating Staphylococcus aureus, charcterised in that it comprises in a culture medium of Staphyloccus aureus at least one of the following two chromogenic agents: 5-bromo 6-chloro 3-indoxyl phosphate and 5-brono 4-chloro 3-indoxyl glucoside and it further contains deferoxamine.

Abstract: Novel proteins obtainable by mutagenesis of surface-exposed amino acids of domains of natural bacterial receptors, said proteins being obtained without substantial loss of basic structure and stability of said natural bacterial receptors; proteins which have been selected from a protein library embodying a repertoire of said novel proteins; and methods for the manufacture of artificial bacterial receptor structures.

Abstract: A method for preparing a culture of Staphylococcus aureus includes adding pork heart into water and smashing to obtain an extract of pork heart. Peptone and NaCl are then added to the extract to obtain a medium. A strain of S. aureus CGMCC 0485 is recovered and proliferated to obtain a seed solution. The seed solution is combined with the medium and then fermented to obtain a culture, the culture having an anticancer effect.

Abstract: The present invention relates to a method of preparing a phenotypically antibiotic-resistant subpopulation of stationary phase bacteria by treating stationary phase bacteria with high doses of antibacterial agents, the subpopulation thus identified, a process for identifying new antibacterial agents by testing against the antibiotic-resistant subpopulation, the compounds thus identified and their uses, particularly in treating bacterial infections involving dormant bacteria.

Abstract: A method for eliminating Staphylococcus aureus is disclosed, including inoculating a microorganism of the genus Brachybacterium to Staphylococcus aureus to eliminate Staphylococcus aureus. A care garment, a care sheet or care bedclothes, each being immobilized with a microorganism or genus Brachybacterium, is also disclosed. One of the microorganismns of the genus Brachybacterium useful in the invention is novel and is deposited as a bacterial strain AAA-a of the genus Brachybacterium (Accession No. FERM BP-6848) in the International Depositary Authority for the deposit of microorganism.

Abstract: The invention provides ratC polypeptides and DNA (RNA) encoding ratC polypetides and methods for producing such polypeptides by recombinant techniques. Also provided are methods for utilizing ratC polypeptides to screen for antibacterial compounds.

Abstract: The invention provides sugar kinase polypeptides and DNA (RNA) encoding sugar kunase polypepties and methods for producing such polypeptides by recombinant techniques. Also provided are methods or utlizng sugar kinase polypeptides to screen for antibacterial compounds.

Abstract: The invention provides clpL polypeptides, polynucleotides encoding clpL polypeptides and methods for producing such polypeptides by recombinant techniques.

Abstract: The invention provides histidinol dehydrogenase polypeptides and DNA (RNA) encoding histidinol dehydrogenase polypeptides and methods for producing such polypeptides by recombinant techniques. Also provided are methods for utilizing histidinol dehydrogenase polypeptides to screen for antibacterial compounds.

Abstract: Novel response regulator polypeptides and DNA (RNA) encoding such polypeptides and a procedure for producing such polypeptides by recombinant techniques is disclosed. Also disclosed are methods for utilizing such polynucleotides and polypeptides for the treatment of infection, particularly bacterial infections. Antagonists against such the polypeptides of the invention and their use as a therapeutic to treat infections, particularly bacterial infections are also disclosed. Also disclosed are diagnostic assays for detecting diseases related to the presence the nucleic acid sequences and the polypeptides of the invention in a host. Also disclosed are diagnostic assays for detecting polynucleotides encoding response regulators and for detecting the polypeptide in a host.

Abstract: A method of detecting a phosphatidylinositol-specific phospholipase C enzyme by means of a substrate which is cleaved by said enzyme and yields a dye when the chromophoric portion of the substrate is dimerized and oxidized; the invention teaches using in such method, as a novel substrate, a 3-indoxyl-myoinositol-1-phosphate compound of formula (I) ##STR1## wherein R is selected from the group consisting of hydrogen and C.sub.1-4 alkyl, while R.sub.1, R.sub.2, R.sub.3, and R.sub.4 are radicals selected from the group consisting of hydrogen and chromogenic substituents, or of a salt of said formula I compound. The invention provides for a safe, sensitive and commercially viable detection of potentially pathogenic bacterial activity of such microbes as Bacillus cereus, B. Thuringiensis, Staphylococcus aureus and various Listeria strains in potentially infected materials including physiological samples or consumable goods such as foods and beverages.

Abstract: An article for detecting thermostable nuclease positive, potentially enterotoxigenic, staphylococci, containing unhydrolyzed nucleotides, toluidine blue O, and a binder, wherein the article is adapted for placement against a sample suspected of containing enterotoxigenic staphylococci. A method of detecting thermostable nuclease positive staphylococci in a sample utilizing the article, and a kit for the detection of thermostable nuclease positive staphylococci containing the article, are also described.

Abstract: The invention provides sugar kinase polypeptides and DNA (RNA) encoding sugar kinase polypeptides and methods for producing such polypeptides by recombinant techniques. Also provided are methods for utilizing sugar kinase polypeptides to screen for antibacterial compounds.

Abstract: The present invention is directed to the identification of mutant strains of methicillin resistant bacteria, in particular methicillin resistant Staphylococcus aureus, to identify the characteristics of such bacteria and develop drugs that can reverse, inhibit, or reduce bacterial resistance to beta lactam antibiotics, e.g., methicillin. The invention particularly relates to identification of a novel mutant strain of methicillin resistant S. aureus that manifests a unique phenotype, having a block in cell wall synthesis at or close to the branch point in hexose metabolism involved in the synthesis of cell wall components. Accordingly, the invention provides for methods of treatment and corresponding pharmaceutical compositions for treating bacterial, particularly staphylococcal, infections.

Abstract: Tripartite recombinant DNA encoding fusion proteins which comprise three sequences, i.e., a signal peptide which is operable in a Gram positive bacterium, an immunogenic polypeptide linked thereto which is not normally expressed in a Gram positive bacterium, and a cell wall spanning and a membrane anchoring sequence, as well as their use in Gram positive bacteria to express the resultant fusion protein on their surface are described. The preferred cell wall spanning and anchoring polypeptides include Staphylococcus protein A and Streptococcus protein G.

Abstract: The invention provides tetracycline resistance protein polypeptides and DNA (RNA) encoding tetracycline resistance protein polypeptides and methods for producing such polypeptides by recombinant techniques. Also provided are methods for utilizing tetracycline resistance protein polypeptides to screen for antibacterial compounds.

Abstract: Novel response regulator polypeptides and DNA (RNA) encoding such polypeptides and a procedure for producing such polypeptides by recombinant techniques is disclosed. Also disclosed are methods for utilizing such polynucleotides and polypeptides for the treatment of infection, particularly bacterial infections. Antagonists against such the polypeptides of the invention and their use as a therapeutic to treat infections, particularly bacterial infections are also disclosed. Also disclosed are diagnostic assays for detecting diseases related to the presence the nucleic acid sequences and the polypeptides of the invention in a host. Also disclosed are diagnostic assays for detecting polynucleotides encoding response regulators and for detecting the polypeptide in a host.

Abstract: A medium for detecting staphylococci is described. The medium contains components selective for growing staphylococci, and a glucopyranoside indicator substance in sufficient quantity to distinguish colonies containing Bacillus and other microorganisms from colonies containing staphylococci. Methods of detecting staphylococci utilizing such medium are also described.

Abstract: Novel proteins obtainable by mutagenesis of surface-exposed amino acids of domains of natural bacterial receptors, said proteins being obtained without substantial loss of basic structure and stability of said natural bacterial receptors; proteins which have been selected from a protein library embodying a repertoire of said novel proteins; and methods for the manufacture of artificial bacterial receptor structures.

Abstract: Genes encoding Class II EPSPS enzymes are disclosed. The genes are useful in producing transformed bacteria and plants which are tolerant to glyphosate herbicide. Class II EPSPS genes share little homology with known, Class I EPSPS genes, and do not hybridize to probes from Class I EPSPS's. The Class II EPSPS enzymes are characterized by being more kinetically efficient than Class I EPSPS's in the presence of glyphosate. Plants transformed with Class II EPSPS genes are also disclosed as well as a method for selectively controlling weeds in a planted transgenic crop field.

Abstract: A test kit and method for the highly sensitive detection of specific analytes in a sample is provided. The presence of the analyte in the sample results in a decrease in the concentration of a growth inhibiting substance leading to proliferation of cells in the region of the analyte. The presence or absence of the analyte is determined by detecting the presence of increased numbers of cells. Assay sensitivity is accounted for by the exponential amplification of cell number that occurs during cell proliferation in the presence of analyte.

Abstract: The invention provides a cosmetic or dermatological method for detecting and/or selectively quantifying individual microorganisms, and/or whole groups of microorganisms, which are present on human or animal skin, comprising the steps ofremoving a sample of the microflora of the human or animal skin,treating the sample with a deinhibiting medium, adding the treated sample to a culture medium which exhibits favorable growth conditions for a defined group of microorganisms but unfavorable growth conditions for other microorganisms, to produce a selective culture, and incubating the selective culture over a sufficiently long period of time, to allow only the group of microorganisms for which the culture medium exhibits favorable growth conditions the opportunity to multiply, in association with metabolic products, in particular CO.sub.

Abstract: An incubation limit marker for revealing the growth of contaminants present in a sample includes at least one strain or category of classically contaminant bacteria in dehydrated form which, once regenerated, will be present at a maximum concentration of 10.sup.3 CFU/ml. The incubation limit marker also includes a medium used for the dehydration of the contaminant bacterium or bacteria which includes a substrate capable of being degraded by the bacterium or bacteria. The incubation limit marker further includes an indicator of the growth of the bacterium or bacteria, for example, constituted by a colored indicator of changes in pH. A process for the "in vitro" detection of the susceptibility of pathogenic bacteria to various antibiotics present in MIC (i.e., Minimal Inhibitory Concentration) in culture or antibiogram media is carried out directly from the sample of the infected medium, in the presence of the above marker, used as a signal which limits the reading time of the antibiogram.

Abstract: A method for determining the sensitivity of at least one nonparaffinophilic microorganism from a specimen obtained from a patient to an antimicrobial agent. The method includes providing at least one receptacle containing an aqueous solution that does not contain a carbon source and inoculating the solution with the specimen. The method further includes placing into the receptacle (i) a slide having bound thereto a carbon source and (ii) a predetermined quantity of an antimicrobial agent to be tested. By observing the nonparaffinophilic microorganism growth or lack thereof on the slide, it can be determined whether the predetermined quantity of the antimicrobial agent is effective in inhibiting growth of the nonparaffinophilic microorganism on the slide. An associated apparatus is also disclosed.

Abstract: The present invention provides specific binding solid phase assay methods and kits for the detection of the presence or absence of a microorganism by directly staining the microorganism and specifically capturing the stained microorganism on a solid support. The methods find particular utility in the detection of Candida. The methods may simultaneously detect the presence or absence of multiple microorganisms.

Abstract: A method and a kit for detecting methicillin-resistant Staphylococcus aureus which use, as primers in a gene amplification reaction, the four oligonucleotides represented by the following nucleotide sequences (1) through (4):5'AGAAATGACTGAACGTCCG3' (SEQ ID NO:1) (1)5'GCGATCAATGTTACCGTAG3' (SEQ ID NO:2) (2)5'TACATGTCGTTAAACCTGGTG3' (SEQ ID NO:3) (3)5'TACAGTTGTACCGATGAATGG3' (SEQ ID NO:4) (4)wherein A, G, C, and T denote adenine, guanine, cytosine, and thymine, respectively, and any T may be substituted by uracil (U). According to the method and kit of the present invention, it is possible to detect MRSA accurately and rapidly while distinguishing it from MR-CNS. Thus, proper treatment and prevention can be achieved against MRSA infections.

Abstract: Hybridization assay probes specific for Staphylococcus aureus and no other Staphylococcus species.

Abstract: A library of isolated and purified antigens specific for a microorganism is a set of individual molecules. The library forms antigen-antibody complexes useful in the context of diagnosing and treating conditions associated with a specific microorganism such as H. pylori-induced gastro-duodenal disease. For the antigen-antibody complexes in question the antibody is an immunoglobulin, which is IgE if the antigens are allergens. Complexes with IgA, IgG and IgM are also useful. By this multivariate approach, a specific condition is diagnosed with high sensitivity and specificity by determining whether complexes form between a specific antigen library and a biological sample which contains immunoglobulins from an individual. Such libraries also are useful for immunotherapy.

Abstract: The present application discloses a novel method for the detection of Staphylococcus aureus and methicillin-resistant strains of Staphylococcus aureus. Further disclosed is an approximately 230 kDa protein and the use of such protein in detection assays for Staphylococcus aureus and in other diagnostic applications.

Abstract: A test kit and method for the amplification and detection of specific antigen cells using a probe. The method includes reacting the probe-specific cells with enzyme-conjugated molecules to form separate molecules. The specific antigen cells are mixed with a selected antibiotic which antibiotic is adversely affected by the enzyme in the reporter molecules and incubating the mixture to promote a bacterial chain reaction forming satellite colonies of bacteria microcolonies about the specific cells which amplifies the cells. The method then includes detecting the amplified probe-specific cells by observing the satellite colonies.

Abstract: The invention relates to various methodologies for diagnosing Kawasaki syndrome. Various bacteria, including TSST-1 producing Staphylococcus aureus, and SPEB and SPEC producing streptococcus have been found to be indicative of the pathological condition. Also described is a Kawasaki syndrome implicated isolate of S. aureus, and therapeutic methodologies for preventing treating the condition.

Abstract: The present invention relates generally to test articles and assays for the detection of analytes in biological fluid samples. More particularly, the present invention relates to test articles an assays which employ dyed microorganisms as visual labels to detect suspected analytes.

Abstract: Pathogenic microorganisms such as Staphylococcus aureus are differentiated and identified by observing the selective inhibition of the microorganism which occurs when it is contacted with Alphazurine A dye.

Abstract: Pathogenic microorganisms such as Staphylococcus aureus are differentiated and identified by observing the selective inhibition of the microorganism which occurs when it is contacted with Alphazurine A dye.

Abstract: Hybridization assay probes specific for Staphylococcus aureus and no other Staphylococcus species.

Abstract: A method for prophylactic treatments of the colonization of a Staphylococcus aureus bacterial strain having the ability to bind to fibronectin in a mammal. The method comprises administering a prophylactic therapeutically active amount of a protein having fibronectin binding properties to a mammal in need of such treatment. The generation of infections, such as mastitis, caused by a Staphylococcus aureus bacterial strain are thereby prevented. The administration may be via vaccination to induce immunization.

Abstract: The present invention relates to (1) an enzyme-linked immunosorbent assay (ELISA) for detection in milk of antibodies of any isotype which are specific for Staphylococcus aureus proteins in molecular weights ranging from 14,000 to 26,000 daltons, (2) a process for production and purification of the proteins, (3) a method of performing the ELISA utilizing the proteins (4) use of the ELISA for detection of intramammary infection by S. aureus, (5) preparation of monoclonal and polyclonal antibodies against the selected fractions, (6) use of such antibodies of purification of infection specfic antigens, and (7) use of the antibodies in an ELISA for antibodies produced in an individual in response to infection by S. aureus.

Abstract: Nucleic acid probes capable of specifically hybridizing to rRNA of E. coli and Shigella species and not to rRNA of non-E. coli/Shigella are described along with methods utilizing such probes for the specific detection of E. coli and/or Shigella in food and other samples.

Abstract: An efficient process of optical resolution is provided for producing an L-amino acid represented by the following formula (I): ##STR1## wherein R is --CH.sub.2 CO.sub.2 H, --CH.sub.2 CONH.sub.2, --CO.sub.2 H or ##STR2## in which R.sup.1 is hydrogen atom, an alkyl group having 1 to 10 carbon atoms or a halogen-substituted alkyl group having 1 to 10 carbon atoms. The process comprises an optical resolution of an N-substituted carbonyl-D,L-amino acid represented by the formula (II): ##STR3## (wherein R is the same as defined above and R.sup.

Abstract: The present invention provides an in vitro method of culturing Staphylococcus aureus to produce anti-phagocytic pseudocapsular antigens which heretofore were only produced by in vivo culturing techniques. The invention also provides a method for making a killed Stophylococcus aureus vaccine containing the anti-phagocytic pseudocapsular antigen produced in an in vitro culturing method. The anti-phagocytic pseudocapsular antigens are produced by culturing Staphylococcus aureus in a nutrient medium containing milk, milk whey and like milk products. The killed bacteria is useful for treating mastitis caused by Staphylococcus aureus.

Abstract: The subject of the invention is a process for the preparation of capsular polysaccharides characteristic of Staphylococcus aureus, comprising the use of coagulase-negative strains of staphylococci for the preparation of these polysaccharides.The capsular polysaccharides obtained can be used for the preparation of vaccines against Staphylococcus aureus and diagnostic agents.