Abstract: Provided herein are engineered host cells suitable for expression of functional T cell receptors (TCR) and methods of using these cells to identify TCRs that specifically bind to a desired peptide-major histocompatibility complex (MHC) complex.

Abstract: A method, software, database, and system in which a query attribute is used as the basis for accessing stored attribute combinations and their frequencies of occurrence for individuals; and tabulating, based on frequencies of occurrence, those attribute combinations that are most likely to co-occur with the query attribute.

Abstract: The invention provides a method for producing a ciliary marginal zone stem cell induced to differentiate from a pluripotent stem cell, including either the following step (1) or step (2), or both of these steps: (1) a step of floating culturing cells obtained from a cell aggregate containing a ciliary marginal zone-like structure induced to differentiate from pluripotent stem cells, thereby obtaining a retinosphere; and (2) a step of collecting stage specific embryonic antigen-1 positive cells from cells obtained from a cell aggregate containing a ciliary marginal zone-like structure induced to differentiate from pluripotent stem cells.

Abstract: Polynucleotides encoding peptides, proteins, enzymes, and functional fragments thereof are disclosed. The polynucleotides of the disclosure can be effectively delivered to an organ, such as the lung, and expressed within cells of the organ. The polyribonucleotides of the disclosure can be used to treat a disease or condition associated with a gene of the ATP-binding cassette (ABC) family, such as ABCA3.

Abstract: The present disclosure provides transgenic nematode systems for assessing function of heterologous genes, their variants and drug discovery. The transgenic nematodes contain a heterologous gene that is inserted via homologous recombination at the native locus replacing and removing the nematode ortholog, wherein expression of the heterologous gene rescues function of the removed nematode ortholog and a transgenic control animal is provided. The heterologous gene may be further modified to provide a variant, such as a human clinical variant, whereby a transgenic test animal is provided. Those transgenic test animals are used in methods to assess function of the heterologous variant and drug screens to find therapeutic candidates reversing deviant activity back to wildtype.

Abstract: Disclosed herein include microRNA antagonists, therapeutic compositions that include one or more of such microRNA antagonists, and methods of treating and/or ameliorating cardiac diseases and/or muscular dystrophy disorders with the microRNA antagonists. Also included are combination therapies, wherein a therapeutic composition disclosed herein and an additional therapy agent are provided to a subject having or suspected of having cardiac disease and/or muscular dystrophy disorder. In particular, some embodiments disclosed herein relate to compositions and methods for transiently administering a mixture of microRNA antagonists for promoting cardiomyocyte proliferation and cardiac regeneration.

Abstract: The present invention relates to the discovery that inhibition of Dickkopf2 (DKK2) increases CD8+ cytotoxic T lymphocyte (CTL) activity, attenuates tumor, and hence suppresses tumor formation. Thus, in various embodiments described herein, the methods of the invention relate to methods of treating cancer by administering to a patient an effective amount of a humanized anti-DKK2 antibody, methods for providing anti-tumor immunity in a subject, methods of stimulating a T cell mediated immune response to a cell population or a tissue and suppressing tumor in a subject. Additionally, the current invention includes methods of diagnosing a cancer or a predisposition of developing a cancer or a metastasis and methods for determining the use of immunotherapy treatment or cancer vaccine for treating cancer. Furthermore, the invention encompasses a pharmaceutical composition for treating cancer as well as a kit for carrying out the aforementioned methods.

Abstract: The present invention relates to a method comprising inferring activity of a PI3K cellular signaling pathway in a tissue and/or cells and/or a body fluid of a medical subject based at least on expression levels of one or more target gene(s) of the PI3K cellular signaling pathway measured in an extracted sample of the tissue and/or the cells and/or the body fluid of the medical subject. The present invention further relates to an apparatus comprising a digital processor configured to perform such a method, a non-transitory storage medium storing instructions that are executable by a digital processing device to perform such a method, and a computer program comprising program code means for causing a digital processing device to perform such a method.

Abstract: Semen and sperm cell processing and preservation systems, and methods of producing a mammal and methods of producing mammalian embryos are disclosed. The present invention is directed to sperm cell preservation, fertilization, and insemination, maintaining or enhancing sperm quality and addressing one or more sperm cell characteristics, such as viability, motility, functionality, fertilization rates, and pregnancy rates. Further, sperm cell characteristics may be addressed within the context of various collection, handling, separation, storage, transportation, usage, fertilization, or insemination techniques.

Abstract: The present invention relates generally to methods for diagnosing the presence or the risk of development or the therapy control of spondyloarthritis (Spa), in particular, of ankylosing spondylitis (AS) and undifferentiated spondyloarthritis in a subject, in particular in mammals. In addition, the present invention relates to test kits for use in the diaposis of the presence or the risk of development, or for the therapy control of Spa, like AS and undifferentiated spondyloarthritis, in a subject. In particular, the present invention relates to a method for diagnosing the presence or the risk of development, or for the therapy control of Spa, like AS and undifferentiated spondyloarthritis, it a subject analysing for the presence of autoantibodies against CD74 and/or IKBKB in a subject. The presence of autoantibodies against CD74 and/or IKBKB is indicative for the presence or the risk of development, or for the therapy control of Spa, like AS and undifferentiated spondyloarthritis.

Abstract: Provided is an SgRNA combination, comprising an SgRNA specifically targeting the GGTA1 gene, an SgRNA specifically targeting the CMAH gene and an SgRNA specifically targeting the ?4GalNT2 gene. Also provided is a CRISPR/Cas9 vector combination, comprising a GGTA1-CRISPR/Cas9 vector, a CMAH-CRISPR/Cas9 vector and a ?4GalNT2-CRISPR/Cas9 vector. Also provided is an applicaton of the CRISPR/Cas9 vector combination in knocking out the GGTA1 gene, the CMAH gene and the ?4GalNT2 gene. The knockout rates of the three genes with the specifically targeted SgRNA sequences are respectively 56%, 63%, and 41%. A three genes knockoutpig can be obtained, wherein the three genes related to immune rejectionare knocked out, and heart valves of said pig can be acquired.

Abstract: Disclosed herein include microRNA antagonists, therapeutic compositions that include one or more of such microRNA antagonists, and methods of treating and/or ameliorating cardiac diseases and/or muscular dystrophy disorders with the microRNA antagonists. Also included are combination therapies, wherein a therapeutic composition disclosed herein and an additional therapy agent are provided to a subject having or suspected of having cardiac disease and/or muscular dystrophy disorder. In particular, some embodiments disclosed herein relate to compositions and methods for transiently administering a mixture of microRNA antagonists for promoting cardiomyocyte proliferation and cardiac regeneration.

Abstract: Some aspects of this disclosure provide strategies, systems, reagents, methods, and kits that are useful for the targeted editing of nucleic acids, including editing a single site within the genome of a cell or subject, e.g., within the human genome. In some embodiments, fusion proteins of Cas9 and nucleic acid editing enzymes or enzyme domains, e.g., deaminase domains, are provided. In some embodiments, methods for targeted nucleic acid editing are provided. In some embodiments, reagents and kits for the generation of targeted nucleic acid editing proteins, e.g., fusion proteins of Cas9 and nucleic acid editing enzymes or domains, are provided.

Abstract: The application relates to antimicrobial agents against Gram-negative bacteria, in particular to fusion proteins composed of an enzyme having the activity of degrading the cell wall of Gram-negative bacteria and a peptide stretch fused to the enzyme at the N- or C-terminus, as well as pharmaceutical compositions comprising the same. Moreover, it relates to nucleic acid molecules encoding such a fusion protein, vectors comprising said nucleic acid molecules and host cells comprising either said nucleic acid molecules or said vectors. In addition, it relates to such a fusion protein for use as a medicament, in particular for the treatment or prevention of Gram-negative bacterial infections, as diagnostic means or as cosmetic substance. The application also relates to the treatment or prevention of Gram-negative bacterial contamination of foodstuff, of food processing equipment, of food processing plants, of surfaces coming into contact with foodstuff, of medical devices, of surfaces in hospitals and surgeries.

Abstract: The present invention includes mutant AID, APOBEC, and Tet enzymes with improved functions. In one aspect the invention provides APOBEC fusion proteins comprising hyperactive deamination activity. In another aspect, the invention provides AID mutant proteins comprising hyperactive deamination activity. In yet another aspect, the invention provides mutant Tet proteins capable of stalling oxidation at a 5-hydroxymethylcytosine (hmC).

Abstract: Described herein are compositions and methods for modulation of gene expression in the liver including modulation of PCSK9, TTR, SERPINA1, KLKB1 and/or HAO1.

Abstract: Methods and kits for detecting alternating spatial expression of PTEN and, optionally, SMAD4, CD44, and/or TP53 in colonic tumors are described. The methods and kits are useful for identifying a cancer stem cell (CSC)-like zone within a colonic tumor, identifying an adenoma-adenocarcinoma (Ad-ACA) transition zone in a colorectal cancer (CRC) tumor, identifying a CRC tumor that contains high-grade adenoma and/or early adenocarcinoma regions, identifying CSCs in a CRC tumor, diagnosing a subject with high-grade colon adenoma and/or early adenocarcinoma, and determining the likelihood that a colonic tumor in a subject will undergo invasive transformation if left untreated.

Abstract: The present invention is directed to provide nucleic acid molecules that promote proliferation of pancreatic islet ?-cells. A proliferation promoting agent for promoting proliferation of pancreatic islet ?-cells according to the present invention contains at least one of a nucleic acid molecule having SEQ ID NO: 1 or a nucleic acid molecule having SEQ ID NO: 2: (SEQ?ID?NO:?1) UAAAGUGCUGACAGUGCAGAU (SEQ?ID?NO:?2) AGCUACAUCUGGCUACUGGGUCUC.

Abstract: A biological product for clinical xenotransplantation into a human and a method of preparing biological product for clinical xenotransplantation into a human involving producing a non-wild type, biologically engineered swine having a biologically engineered genome such that the swine does not express one or more extracellular surface glycan epitopes, is free of certain pathogens, is reared according to a bioburden-reducing procedure in a closed designated pathogen free herd, wherein the biological product is harvested following the swine being euthanized and the product is aseptically removed from the swine, the biological product is processed involving sterilization and storing the product in a sterile container, and the product does not contain one or more extracellular surface glycans, is free of certain designated pathogens, is biologically active and comprises live cells and tissues capable of vascularizing after xenotransplantation.

Abstract: The invention provides knock-in non-human cells and mammals having a genome encoding chimeric antibodies and methods of producing knock-in cells and mammals. Certain aspects of the invention include chimeric antibodies, humanized antibodies, pharmaceutical compositions and kits. Certain aspects of the invention also relate to diagnostic and treatment methods using the antibodies of the invention.

Abstract: The present invention relates in part to nucleic acids encoding proteins, nucleic acids containing non-canonical nucleotides, therapeutics comprising nucleic acids, methods, kits, and devices for inducing cells to express proteins, methods, kits, and devices for transfecting, gene editing, and reprogramming cells, and cells, organisms, and therapeutics produced using these methods, kits, and devices. Methods for inducing cells to express proteins and for reprogramming and gene-editing cells using RNA are disclosed. Methods for producing cells from patient samples, cells produced using these methods, and therapeutics comprising cells produced using these methods are also disclosed.

Abstract: A method is provided of targeted genome editing of an animal using site specific homologous integration. A composition comprising a single stranded oligonucleotide or double stranded nucleic acid molecule comprising a nucleic acid molecule of interest and sequences flanking a target locus cleavage site is injected into the zygote of an animal along with a nuclease and a guide nucleic acid molecule that targets the nuclease to a target locus. The composition is injected into the zygote after fertilization and prior to formation of a nucleus. The nucleic acid molecule of interest is recombined into the genome with high efficiency. The process allows for integration of nucleic acid molecules into the genome of animals in which the pronuclei cannot be visually observed during injection.

Abstract: Methods for the production, capturing and purification of recombinant human lysosomal proteins are described. Such recombinant human lysosomal proteins can have high content of mannose-6-phosphate residues. Also described are pharmaceutical compositions comprising such recombinant human lysosomal proteins, as well as methods of treatment and uses of such recombinant human lysosomal proteins.

Abstract: The present invention provides a method of producing a multipotent stem cell, said method comprising culturing at least one fibroblast cell in the presence of an effective amount of at least one small molecule reprogramming factor(s) that induces the cell to de-differentiate into a multipotent stem cell, wherein the method excludes the use of reprogramming factor(s) that are not small molecules. The small molecule reprogramming factor(s) may include a G9a HMTase inhibitor(s) and/or a MEK inhibitor(s) optionally in combination with other small molecule reprogramming factor(s). The invention also includes methods of differentiating the multipotent stem cells, cells produced by the methods, assays using the cells and kits for use in the methods.

Abstract: The present invention relates to polypeptides and uses thereof for reducing CD95-meditated cell motility. In particular, the present invention relates to a polypeptide having an amino acid sequence having at least 70% of identity with the amino acid sequence ranging from the amino-acid residue at position 175 to the amino-acid residue at position 191 in SEQ ID NO:1.

Abstract: Provided herein are engineered cell lines. In some embodiments, cells of an engineered cell line have altered expression of a gene and/or altered expression of an miRNA, wherein the altered expression results in increased or decreased production of a virus. The virus is a picornavirus, such as a poliovirus or Enterovirus 71. Also provided herein are methods for using the engineered cells to produce virus, and methods for treating a subject having or at risk of having a viral infection.

Abstract: The invention provides methods for identifying immunobinders, such as scFv antibodies, capable of specifically binding to cell surface antigens, and compositions identified according to said methods.

Abstract: Methods compositions and kits are provided for performing a chromatin or chromosome conformation capture assay in partitions.

Abstract: There are provided methods and compositions for activating the expression of an exogenous gene by an exogenous integrase specifically in cells in which the exogenous integrase is expressed. The invention further relates to uses of the compositions in treatment of various conditions and disorders, as exemplified by selectively activating expression of a toxin only in target cell populations.

Abstract: The present invention provides a method and components thereof of performing genetic modification under a drug-free environment. The method comprises the steps of generating a trapped mammalian cell library by trapper constructs (including the element of piggyBac terminal inverted repeats (TIRs)), reporter constructs, and helper constructs (including a sequence of an internal ribosomal entry site (IRES)). The present art allows: (1) to target & identify the silenced loci; (2) to separate genes with low-level expression at certain differentiation stages; (3) to evaluate the efficiency of gene targeting in the silent or repressed loci. The present invention avoids the biased gene targeting observed in the prior arts, and eliminates the needs of introducing antibiotic genes into the host genome which may lead to a potential threat of drifting antibiotic resistant genes into environment.

Abstract: The invention relates to a method for the production of a set of seeds which are genetically identical to the male gametes from which they arise, which may comprise placing a limited number of paternal gametes that have the form of tetrads or dyads on the stigma of a flower to fertilize maternal egg cells to obtain a number of zygotes; and inducing the loss of maternal chromosomes from the zygotes to obtain a seed set containing a limited number of seeds in which the maternal chromosomes are absent. In a preferred embodiment the father plant exhibits suppression of chromosome recombination or second division restitution (SDR) during meiosis.

Abstract: Genetically engineered mice having a corrected Crb1rd8 mutation and methods for correcting the Crb1rd8 mutation to produce the genetically engineered mice are provided according to aspects of the present invention. Kits, expression vectors and fusion proteins according to aspects of the invention are provided for use to produce the genetically engineered mice characterized by a corrected Crb1rd8 mutation.

Abstract: Provided herein are methods of integrating one or more exogenous nucleic acids into one or more selected target sites of a host cell genome. In certain embodiments, the methods comprise contacting the host cell genome with one or more integration polynucleotides comprising an exogenous nucleic acid to be integrated into a genomic target site, and a nuclease capable of causing a double-strand break near or within the genomic target site.

Abstract: The disclosure relates generally to the targeting of genes to, and their integration into, an immunoglobulin (antibody) heavy chain locus. In particular, the methods described herein contemplate replacing the single rearranged heavy chain V, D, and J genes of a B cell lymphoma such as DT40 with independently rearranged VH-D-JH genes of chicken, in a system for generating immunoglobulin diversity. Also contemplated is replacement of the chicken VH-D-JH with rearranged VH-D-JH genes of other vertebrates including human in a system for generating immunoglobulin diversity, with the exception of any substitution disclosed and claimed in PCT application WO 2009/029315 A2. Also described is construction of a diverse chicken immunoglobulin heavy chain VDJ library in DT40 by homologous gene replacement of the single endogenous rearranged VDJ gene with a chicken VDJ repertoire using the described targeting vectors.

Abstract: Disclosed herein are methods and compositions for insertion of Factor IX (FIX) sequences into the genome of a cell for treating hemophilia B.

Abstract: The invention provides genetically modified non-human animals that express chimeric human/non-human MHC I polypeptide and/or human or humanized ?2 microglobulin polypeptide, as well as embryos, cells, and tissues comprising the same. Also provided are constructs for making said genetically modified animals and methods of making the same. Methods of using the genetically modified animals to study various aspects of human immune system are provided.

Abstract: The invention relates to a method for the simultaneous integration of two or more copies of a polynucleotide of interest into the chromosome of a fungal host cell comprising at least two pairs of recognition sequences of a site-specific recombinase, each pair flanking a resident negative selection marker; transformation of the cell with a construct carrying a gene of interest also flanked by the recognition sequences to ensure double-crossover events after transient expression of the recombinase, followed by selection for excision of all negative selection markers from the cell.

Abstract: The present invention relates to genetic techniques employing the direct ligatation of an external DNA fragment generated in situ by the same ZFNs that target the genome. ObLiGaRe, i.e., the obligated ligation-gated recombination, is a new method for genetic engineering using custom designed nucleases, and a strategy of site-specific gene insertion utilizing the NHEJ pathway. It applies a similar logic to the one used in unidirectional loxP sites (Oberdoerffer et al., 2003) but maintains all the advantages and flexibility of CDNs.

Abstract: Provided is a transgenic animal model for testing immunogenicity and protective efficacy of human vaccines and the method for generating such a multitransgenic animal. Also disclosed are methods for screening compositions for human vaccine development. More specifically, a mouse model capable of expressing human leukocyte antigen DR4, and human costimulatory molecules (CD80) upon infusion of human HLA-matched hematopoietic stem cells, which can develop into a functional human immune system is provided.

Abstract: This present invention provides novel methods for deriving embryonic stem cells, those cells and cell lines, and the use of the cells for therapeutic and research purposes without the destruction of the embryo. It also relates to novel methods of establishing and storing an autologous stem cell line prior to implantation of an embryo, e.g., in conjunction with reproductive therapies such as IVF.

Abstract: The invention pertains to an expression vector or a combination of at least two expression vectors comprising at least (a) a polynucleotide encoding a product of interest or an insertion site for incorporating a polynucleotide encoding a product of interest; (b) a polynucleotide encoding a first selectable marker (sm I); (c) a polynucleotide encoding a second selectable marker (sm II), which is different from the first selectable marker (sm I), wherein the activity of the selectable marker (sm I) or (sm II) is at least partially influenced by the activity of the other selectable marker and wherein the selectable markers (sm I) and (sm II) are involved in the folate metabolism. Also provided are suitable host cells, selection methods and methods for producing polypeptides with high yield.

Abstract: A spermatogonial stem cell line that is derived from testes of rats characterized by a desirable genetic background can serve as a source for cells to transplant into male-sterile recipient animals that are immuno-compatible with the spermatogonial line. Rat cells thus transplanted readily develop into fertilization-competent, haploid male gametes, with little or no endogenous sperm competition generated by the testes of the male-sterile recipient. This approach, constituting the first vector system for the use of rat spermatogonial lines from in vitro culture in generating mutant rats on a desired genetic background, effects maximal germline transmission of donor haplotypes from the transplanted spermatogonial cells.

Abstract: The invention relates to polynucleotides, particularly chimeric polynucleotides useful for optimal production of functional immunoglobulins with human idiotypes in rodents. The invention further relates to rodents comprising such polynucleotides.

Abstract: The present disclosure describes an animal model of central neuropathic pain relevant to spinal cord injury, as well as methods of using the model to screen for therapeutic agents and to test existing therapies.

Abstract: The present disclosure provides a non-naturally occurring miRNA having a stem-loop structure comprising a scaffold derived from a first endogenous miRNA (e.g., miR-196a-2 or miR-204), a mature strand derived from a second endogenous miRNA, and a star strand sequence that is at least partially complementary to the mature strand sequence. The present disclosure also provides a non-naturally occurring miRNA having a stem-loop structure comprising a scaffold derived from an endogenous miRNA (e.g., miR-196a-2 or miR-204), a mature strand designed t be at least partially complementary to a target RNA, and a star strand sequence that is at least partially complementary to the mature strand sequence. The methods and compositions of the disclosure may be used to mediate gene silencing via the RNAi pathway.

Abstract: There is provided a method for determining whether a mammalian subject having a bladder cancer belongs to a first or a second group, wherein the prognosis of subjects of the second group is worse than the prognosis of subjects of the first group, comprising the steps of: a) evaluating an amount of PODXL in at least part of a sample earlier obtained from the subject and determining a sample value corresponding to the evaluated amount; b) comparing said sample value with a predetermined reference value; and if said sample value is higher than said reference value, c1) concluding that the subject belongs to the second group; and if said sample value is lower than or equal to said reference value, c2) concluding that the subject belongs to the first group.

Abstract: The invention provides methods for identifying immunobinders, such as scFv antibodies, capable of specifically binding to cell surface antigens, and compositions identified according to said methods.

Abstract: Methods of producing populations of predominantly astrocytes, neurons or oligodendrocytes are provided. In addition, methods of treating mammals having astroglial tumors, oligodendrocyte tumors, or neuronal tumors are provided.

Abstract: Disclosed herein are methods for decreasing Factor 12 and treating or preventing inflammatory conditions in an individual in need thereof. Examples of disease conditions that can be ameliorated with the administration of antisense compounds targeted to Factor 12 include hereditary angioedema (HAE). Methods for inhibiting Factor 12 can also be used as a prophylactic treatment to prevent individuals at risk for developing an inflammatory condition, such as, hereditary angioedema.

Abstract: A method for purifying or detecting a target protein present in a solution, includes, before carrying out the actual detection or purification step, a step of contacting the solution with an aptamer binding specifically to the target protein, where the aptamer does not bind to a protein homologous to the target protein that could also be present in the solution.