Abstract: Disclosed are catalytic antibodies and polypeptides capable of degrading cocaine. Said catalytic antibodies and polypeptides are characterized by the amino acid sequence of their complementarity determining regions and framework regions. The present invention also discloses a pharmaceutical composition and a method for decreasing the concentration of cocaine in a subject. Finally, the invention discloses pharmaceutical compositions and methods for treating cocaine overdose and addiction in subjects.

Abstract: Caption processing device and method for a display unit with a separate display is presented, where the caption is displayed separately from a monitor which displays the video signal, so that partial covering of the video signal by the caption is avoided. The caption processing device for a display unit which extracts caption data from a video signal and displays the caption, the device includes the separate display for displaying the caption separate from the video signal, a control part for generating a control signal which can control display of the caption data, and a display driving part for receiving the caption data, processing the caption data according to the control signal from the control part and applying the processed data to the display.

Abstract: Plasmids are provided which upon introduction into a suitable host render the host capable of effecting expression of DNA encoding a desired polypeptide under the control of an osmB promoter. Such plasmids may be used to produce polypeptides such as superoxide dismutases, acetylcholinesterase, growth hormones and hepatitis antigen.

Abstract: This invention provides a method for increasing the level of heat shock protein in a cell which comprises contacting the cell with an effective amount of N-acetyl-leucyl-leucyl-norleucinal, so as to thereby increase the level of heat shock protein in the cell. This invention further provides a protein characterized by increased levels of the protein in a cell in response to contacting the cell with an effective amount of N-acetyl-leucyl-leucyl-norleucinal. This invention also provides a method for increasing the binding of apoprotein B100 to a heat shock protein in a cell. This invention provides a method of preserving an organ ex vivo, which comprises contacting the organ with an effective amount of N-acetyl-leucyl-leucyl-norleucinal. This invention also provides a method of preserving an organ in vivo, which comprises contacting the organ with an effective amount of N-acetyl-leucyl-leucyl-norleucinal.

Abstract: The present invention provides for a method for generating a directed, recombinant fusion nucleic acid molecule which includes: (A) contacting a first pair of single-stranded primers with a first strand and a second strand of a first nucleic acid molecule and a second pair of single-stranded primers with a first strand and a second strand of a second nucleic acid molecule under hybridization conditions, (B) amplifying the first nucleic acid molecule and the first pair of primers and the second nucleic acid molecule and the second pair of primers under amplification conditions, separately; (C) mixing the amplification products from step (B) and the first primer of the first pair of primers and the second primer of the second pair of primers under hybridization conditions; (D) amplifying the hybridized molecules of step (C) under amplification conditions so as to generate a directed, recombinant fusion nucleic acid molecule so as to generate a directed, recombinant fusion nucleic acid molecule.

Abstract: This invention is directed to dihydropyrimidine compounds which are selective antagonists for human .alpha..sub.1C receptors and which have the structure: ##STR1## wherein A is aryl; R.sub.1, R.sub.2 and R.sub.3 are alkyl or heteroalkyl; R.sub.4 is heterocyclic alkyl; and X is S, O or NR.sub.3. This invention also relates to use of these compounds for the treatment of benign prostatic hyperplasia and other diseases where antagonism of the human .alpha..sub.1C receptor is useful. The invention further provides pharmaceutical compositions comprising a therapeutically effective amount of such a compound and a pharmaceutically acceptable carrier.

Abstract: This invention provides an isolated mammalian nucleic acid molecule encoding an alternatively spliced prostate-specific membrane (PSM') antigen. This invention provides an isolated nucleic acid molecule encoding a prostate-specific membrane antigen promoter. This invention provides a method of detecting hematogenous micrometastic tumor cells of a subject, and determining prostate cancer progression in a subject.

Abstract: A pharmaceutical composition which comprises the c-kit ligand (KL) purified by applicants or produced by applicants' recombinant methods in combination with other hematopoietic factors and a pharmaceutically acceptable carrier is provided as well as methods of treating patients which comprise administering to the patient the pharmaceutical composition of this invention. This invention provides combination therapies using c-kit ligand (KL) and a purified c-kit ligand (KL) polypeptide, or a soluble fragment thereof and other hematopoietic factors. It also provides methods and compositions for ex-vivo use of KL alone or in combination therapy. A mutated KL antagonist is also described. Such an antagonist may also be a small molecule. Antisense nucleic acids to KL as therapeutics are also described. Lastly, compositions and methods are described that take advantage of the role of KL in germ cells, mast cells and melanocytes.

Abstract: An apparatus for controlling input of textile softener in a washing machine, wherein a textile softener input function is provided by arranging the textile softener input function in a washing course selection displayer disposed on an operation panel to be performed as an independent course or to be associated with other washing courses. A method for controlling input of textile softener in a washing machine comprising the steps of: halting operation of the washing machine after water-supply is completed in the last rinsing stroke; sounding a buzzer n-times after halting the operation of the washing machine; waiting for a predetermined time after completion of the buzzer sound; and performing a rinsing and dehydration strokes only when the textile softener is put in a washtub and the washing machine is re-operated, or waiting continuously when the washing machine is not re-operated.

Abstract: This invention provides isolated nucleic acid molecules encoding human 5-HT.sub.1D receptors, isolated proteins which are human 5-HT.sub.1D receptors, vectors comprising isolated nucleic acid molecules encoding human 5-HT.sub.1D receptors, mammalian cells comprising such vectors, antibodies directed to human 5-HT.sub.1D receptors, nucleic acid probes useful for detecting nucleic acid encoding human 5-HT.sub.1D receptors, antisense oligonucleotides complementary to any sequences of a nucleic acid molecule which encodes a human 5-HT.sub.1D receptor, pharmaceutical compounds related to human 5-HT.sub.1D receptors, and nonhuman transgenic animals which express DNA which encodes a normal or a mutant human 5-HT.sub.1D receptor. This invention further provides methods for determining ligand binding, detecting expression, drug screening, and treatment involving the human 5-HT.sub.1D receptor.

Abstract: Substantially purified Eimeria maxima gametocytes have been prepared and methods for their preparations are disclosed. A proteinaceous extract derived from the gametocytes comprises at least nine proteins of varying molecular weights. Vaccines for conferring upon a chicken immunity against infection comprise an effective immunizing amount of gametocyte extract or antigenic protein, and a carrier.

Abstract: The present invention relates generally to an in vivo system for gene expression and, more particularly, to the use of the system to screen for molecules which are capable of inhibiting, reducing, altering or otherwise modulating expression of a target nucleotide sequence or the activity of a gene product. The in vivo system of the present invention is particularly but not exclusively useful for screening for antisense, sense or ribozyme constructs or transdominant polypeptides, small peptides or other chemical compounds that are capable of inhibiting, reducing, altering or otherwise modulating expression of target genes or target genetic sequences or the activity of target gene products of commercial importance such as in medical, agricultural and industrial fields.

Abstract: The present invention provides the compound having the structure: ##STR1## wherein each of R.sub.1 and R.sub.2 are independently the same as or different from each other; when R.sub.1 and R.sub.2 are the same, each is a substituted or unsubstituted arylamino, cycloalkylamino, pyridineamino, piperidino, 9-purine-6-amine, or thiozoleamino group; when R.sub.1 and R.sub.2 are different, R.sub.1 =R.sub.3 --N--R.sub.4, wherein each of R.sub.3 and R.sub.4 are independently the same as or different from each other and are a hydrogen atom, a hydroxyl group, a substituted or unsubstituted, branched or unbranched alkyl, alkenyl, cycloalkyl, aryl, alkyloxy, aryloxy, arylalkyloxy, or pyridine group, or R.sub.3 and R.sub.4 bond together to form a piperidine group and R.sub.2 is a hydroxylamino, hydroxyl, amino, alkylamino, dialkylamino or alkyloxy group; and n is an integer from about 4 to about 8.

Abstract: The present invention provides for an antisense oligonucleotide having the sequence 5'GCTCGGCGCCGCCATTTCCAG3'(SEQ ID NO:1). The invention also provides for an antisense oligonucleotide having the sequence 5'GTCAGCGGCCATCAGCTT3'(SEQ ID NO:2). The present invention further provides for a method for treating a neurodegenerative disorder in a subject which comprises administering to the subject a compound in an amount effective to inhibit neuronal cell death and thus treat the neurodegenerative disorder in the subject, which compound comprises the oligonucleotide 5'GCTCGGCGCCGCCATTTCCAG3' (SEQ ID NO:1) and a delivery agent. The present invention provides for a method of inhibiting trophic factor withdrawal mediated death of a cell which comprises contacting the cell with an amount of the oligonucleotide 5'GCTCGGCGCCGCCATTTCCAG3' (SEQ ID NO:1) effective to inhibit death of the cell.

Abstract: The present invention relates to a recombinant herpesvirus of turkeys comprises foreign DNA inserted into a site in the herpesvirus of turkeys genome which is not essential for replication of the herpesvirus of turkeys. The invention further relates to homology vectors which produce recombinant herpesvirus of turkeys by inserting foreign DNA into herpesvirus of turkeys genome. Genetically-engineered virus S-FPV-062 is described in the Materials and Methods section which follows. One advantage of recombinant HVT as live vaccines is that they may be engineered to express only a limited number of antigens that are needed to confer protective immunity to the corresponding pathogens. Consequently, host animals vaccinated with the recombinant HVT can be distinguished from those which have been infected with the wild type virus by the absence of antigens that are normally present in the wild type virus.

Abstract: This invention relates to a method for fabricating a thin film transistor used for LCD which can improve performance and productivity of an element by forming it with atmospheric pressure CVD method including processes for forming a gate electrode having sloped sides on an insulation substrate, forming a gate insulation film, a semiconductor layer and a channel protection layer successively with atmospheric pressure chemical vapor deposition method on all over the insulation substrate, patterning the channel protection layer such that the channel protection layer is to have a narrower pattern width than the pattern width of the gate electrode remaining the channel protection layer only on the semiconductor layer over the gate electrode, forming an impurity injected semiconductor layer for making resistive contact by injecting impurities into the semiconductor layer using the channel protection layer as a mask, and forming source and drain electrodes over the channel protection layer, the impurity injected sem

Abstract: Method for manufacturing a T-gate useful for reducing a gate resistance, improving through-put, and simplifying an MMIC (monolithic microwave integrated circuit) process is disclosed, the method including the steps of depositing a first photoresist layer on a semiconductor substrate and patterning the first photoresist layer so as to expose a predetermined portion of the surface of the substrate; successively forming a seed metal layer and a second photoresist layer on the entire surface inclusive of the exposed substrate and patterning the second photoresist layer so as to define a gate electrode region; plating Au on the seed metal layer on the gate electrode region so as to form a gate electrode; and removing the first and second photoresist layers and the seed metal layer except the gate electrode.

Abstract: A non-contact apparatus for monitoring the contents of a container, especially but not exclusively for quality control monitoring purposes associated with high speed packaging processes, comprises a non-contact ultrasound generation member, adapted so as to generate an ultrasound signal within the container (1). A non-contact detection scheme is employed to enable the contents of the container to be monitored by analysing ultrasound signals that have propagated through or round the container (1) either transmitted through or reflected from the containers contents. In use, the apparatus may be adapted to provide information about container fill level (h) or the presence or absence of an insert (14) such as a head forming device by analysing the measured signal profiles generated by a ultrasound detection member (3).

Abstract: A motor driven antenna apparatus for use in automobiles according to the present invention, includes a telescopic antenna mounted on the automobiles, a drive control mechanism for extending and retracting the telescopic antenna by a motor driven motor, a case for holding the drive control mechanism, a through-hole formed in a side wall of the case to make an inside and an outside of the case communicate with each other, and a duct having a first opening portion at one end and a second opening portion at other end, and attached to the case such that the first opening portion is connected to the through-hole outside the case and the second opening portion is formed outward below the through-hole. A foreign object blocking member is provided below the second opening portion and opposed to the second opening portion with a predetermined distance therebetween.

Abstract: The invention relates to a method of treating sleep disorders in a patient in need thereof comprising the administration of a hypnotically effective amount of a non-allosteric GABA.sub.A agonist.