Abstract: An optical waveguide-type wavelength domain switch includes a waveguide-type multi/demultiplexing device laminate comprising three or more laminated waveguide-type multi/demultiplexing devices, a lens system positioned on a demultiplex side of the waveguide-type multi/demultiplexing device laminate, and a reflective optical phase-modulating cell positioned on an opposite side of the waveguide-type multi/demultiplexing device laminate to the lens system.

Abstract: The invention aims to provide a highly accurate automatic biopolymer determination technique utilizing mass spectrometry whereby calibration prior to measurement or the addition of an internal standard to a sample can be eliminated. The biopolymer automatic identifying method of the invention comprises: retrieving a candidate molecule by matching an observed mass value X obtained by mass spectrometry with a predetermined database; selecting an arbitrary number of candidate molecules with high similarity scores; calibrating the observed mass value X using the candidate molecule as an internal standard; calculating relative error Ec between a calibrated mass value Xc and a theoretical mass value M of the candidate molecule; determining the standard deviation SEc of the relative error; determining a tolerance Tc of database search from the standard deviation SEc; and repeating a database search based on the tolerance Tc.

Abstract: An interface is provided that corresponds to an individual person without being restricted to a particular place within a room, by performing gesture recognition while identifying an individual person. A stereo camera (1) picks up an image of a user (4), and based on the image pickup output, an image processor 2 transmits a color image within a visual field and a distance image to an information integrated recognition device (3). The information integrated recognition device (3) identifies an individual by the face of the user (4), senses the position, and recognizes a significant gesture based on a hand sign of the user (4). The information integrated recognition device (3) executes a command corresponding the identified user (4) and performs operations of all devices (6) to be operated in the room (such as a TV set, an air conditioner, an electric fan, illumination, acoustic condition, and window opening/closing).

Abstract: A device for measuring the dynamic matrix sensitivity of an inertia sensor is provided with a motion generating machine or a vibrating table for inducing a translational or rotary motion, an acceleration measuring unit, an angular velocity measuring unit or angular acceleration measuring unit, an output device for fetching an output from the unit, one or, pre light reflectors, a displacement measuring device for seizing a multidimensional motion by using a laser interferometer radiating light from a plurality of directions to the light reflectors, a data processing unit for processing a data indicating the state of motion and obtained from the displacement measuring unit, and a displaying device to display or a transmitting device to transmit the output of the data processing unit and the output of the acceleration measuring unit, angular velocity measuring unit or angular acceleration measuring unit.

Abstract: Disclosed is a method for producing ultrafine particles of a Prussian blue-type metal complex wherein (A) an aqueous solution containing an anionic metal cyano complex having a metal atom M1 as the central metal is mixed with an aqueous solution containing metal cations of a metal atom M2 for precipitating a crystal of a Prussian blue-type metal complex having the metal atom M1 and the metal atom M2; then (B) a solution obtained by dissolving a ligand L in a solvent is mixed with the crystal of the Prussian blue-type metal complex for forming a dispersion liquid of ultrafine particles of the Prussian blue-type metal complex; and the (C) the Prussian blue-type metal complex is separated from the dispersion liquid as nanometer-sized ultrafine particles.

Abstract: A serial-parallel converter/encoder unit 11 inputs a transmission symbol data at a transmission symbol rate that is one-Nth of a base-point symbol rate. A precoder/collator 13 creates a transmission symbol waveform at the base-point symbol rate. The transmission symbol waveform becomes a transmission signal after passing through a roll-off filter 14 with a band corresponding to the base-point symbol rate and a modulator 15. A reception signal demodulated by a demodulator 33 is input to a fractionally-spaced equalizer 38 that operates at the base-point symbol rate and is forcibly equalized at the transmission symbol rate by using a reference signal. A level of a signal output from the fractionally-spaced equalizer 38 at the transmission symbol rate is determined by a level determining unit 39 and becomes a reception symbol data by a sawtooth-function output unit 40.

Abstract: The present invention provides electroluminescent materials that emit very bright light with little energy consumption, little loss of energy converted into heat, etc., and suffers from little deterioration due to long-term use, in particular, inorganic electroluminescent materials that emit blue to green light having a wavelength shorter than yellow.

Abstract: A carbon quantity detecting sensor for continuously detecting a carbon quantity of measuring gases with increased precision using a simplifier structure is disclosed. The sensor includes at least a proton conductive body composed of a solid electrolyte body having a proton conductivity, an electrode pair composed of a measuring electrode and a reference electrode formed on the proton conductive body at opposing surfaces thereof respectively, and a power source for applying at least one of a given current or a given voltage across the electrode pair. The measuring gases electrode is exposed to the measuring gases and the reference electrode is isolated from the measuring gases. This enables the carbon quantity of measuring gases to be detected with increased precision for a long period of time without causing a carbon component to accumulate on a surface of the measuring electrode due to an electrochemical reaction.

Abstract: A process for producing through simple operations a molding die for optical device having an antireflective structure of nano-order microscopic uneven plane on a substratum surface. The molding die for optical device having microscopic uneven plane (antireflective structure die plane) on a surface of substratum is produced by a process comprising forming one or more etching transfer layers on substratum; forming thin film for formation of semispherical microparticles on the etching transfer layers; causing the thin film to undergo aggregation, or decomposition, or nucleation of the material by the use of any of thermal reaction, photoreaction and gas reaction or a combination of these reactions so as to form multiple semispherical island-like microparticles; and using the multiple islandlike microparticles as a protective mask, carrying out sequential etching of the etching transfer layers and substratum by reactive gas to thereby form a conical pattern on the microscopic surface of the substratum.

Abstract: An unknown word is additionally registered in a speech recognition dictionary by utilizing a correction result, and a new pronunciation of the word that has been registered in a speech recognition dictionary is additionally registered in the speech recognition dictionary, thereby increasing the accuracy of speech recognition. The start time and finish time of each phoneme unit in speech data corresponding to each phoneme included in a phoneme sequence acquired by a phoneme sequence converting section 13 are added to the phoneme sequence. A phoneme sequence extracting section 15 extracts from the phoneme sequence a phoneme sequence portion composed of phonemes existing in a segment corresponding to the period from the start time to the finish time of the word segment of the word corrected by a word correcting section 9 and the extracted phoneme sequence portion is determined as the pronunciation of the corrected word.

Abstract: A laser illuminator comprising at least one optical diffusion means capable of modifying an optical diffusion condition (3) and at least one optical suppression means for suppressing divergence of light (100), wherein the optical diffusion means and the optical suppression means are disposed along an optical path of a laser beam (6) radiating from a laser source and the laser beam is converted into a diffused and non-divergent light beam (6-2) for illuminating or exciting an object by passing through the optical diffusion means and the optical suppression means.

Abstract: An electrode connection structure of a semiconductor chip is provided to realize a highly reliable electrical connection with low stress without using a bump. A conductive member may be used for such an electrode connection structure. A semiconductor device is provided wherein semiconductor chips are arranged in layers without providing the semiconductor chips with a through via, and a method is provided for manufacturing such a semiconductor device. A part or all of the surface of a horizontal recess, which is formed in an adhesive layer arranged between a first electrode of a lower layer and a second electrode of an upper layer, is provided with a conductive member for connecting the first electrode and the second electrode.

Abstract: To provide a semiconductor nonvolatile storage device capable of applying distributed voltage efficiently to a ferroelectric capacitor in a semiconductor nonvolatile storage device having an MFMIS structure without enlarging a memory cell area and a method of fabricating the same, a ferroelectric nonvolatile storage element is constructed by a structure successively laminated with a first insulator layer (3), a first conductor layer (4), a ferroelectric layer (5) and a second conductor layer (6) on a channel region and is constructed by a structure having a third conductor (9) and a fourth conductor (10) respectively laminated on a source region and a drain region, in which the third conductor (9) and the fourth conductor (10) are opposed to each other via the first conductor layer (4) and a second insulator thin film (11).

Abstract: The present invention provides a music artist retrieval system which makes it possible for users to automatically retrieve an unknown music artist similar to the user's favorite artist while actually reproducing and confirming a piece of music of the unknown artist. A music artist similarity map storing section (13) computes a plurality of similarities for a plurality of music artists and makes a music artist similarity map for the plurality of music artists based on the plurality of similarities, then stores the music artist similarity map. Here, the similarities are computed between one of the plurality of music artists and the other music artists based on features of the respective music artists. A similar artists selecting and displaying section (17) displays on a display plurality of indications related to one music artist and two or more music artists whose similarities are close to the one music artist, based on the music artist similarity map.

Abstract: Provided is a detection method and device for analyzing trace substance of interest in a short time and with high accuracy without the need of performing any treatment for binding a fluorescent substance to the substance of interest or using any large apparatus. The substance of interest is detected by being immobilizing on a surface of any one of a hole transport layer, an electron transport layer, a luminescent layer, a buffer layer, and inside surfaces of electrodes for an organic electroluminescent device based on a change in at least one luminescent property selected from luminescence intensity, luminous efficiency, and emission spectrum of the organic electroluminescent device before and after the immobilization of the substance of interest.

Abstract: A portable terminal device (1) capable of easily evaluating mental fatigue comprises: an operation unit (4); an imaging unit for measuring ambient light (5); a display screen (2) or a light-emitting element (3) for presenting a flashing image or light while a flicker frequency of the flashing source is being monotonically changed from a start frequency to an ending frequency; and a recording unit for, when a user operates the operation unit (4) as the user perceives a flicker, recording the flicker frequency at the time point as a measured frequency, wherein: a first frequency datum, which is the measured frequency measured when the user is in a healthy condition, is associated with a first luminance datum, which is a measured ambient luminance, and the associated datum is stored in the recording unit, a proportion of decrease of a second frequency datum, which is the measured frequency measured when the user is not in a healthy condition, from the first frequency datum recorded in the recording unit and asso

Abstract: An electronic media communication apparatus is provided in which encryption keys and decryption algorithms are provided as circuits concealed in logic programmable devices. When the client requests delivery of electronic media, the server individually encrypts the electronic media and delivers the encrypted electronic media to the client. In the client, an electronic media specific circuit section uses logic circuit data received via a client data communication section to generate an electronic media specific logic circuit. Then, a logic circuit configuration section combines the logic circuit with a terminal specific circuit section uniquely implemented for the client to form an electronic media security circuit section. The original digital content can then be generated by inputting the encrypted electronic media stored in a storage unit to the electronic media security circuit section.

Abstract: The object of the present invention is to provide methods for inhibiting proliferation of neural stem cells, an agent for inhibiting proliferation of neural stem cells, and methods for using the same. According to the method of the present invention, a galectin-1 inhibitor such as anti-galectin-1 antibody and/or an integrin ?1 inhibitor such as anti-integrin ?1 antibody is administered to a human or a vertebrate other than human for inhibiting proliferation of neural stem cells. This method can be used for treatment of nerve injury and nerve tumors.

Abstract: A polarization modulation imaging ellipsometer capable of measuring ellipsometric parameters of the surface of a sample for each of the measured points with high precision and at high speed, which has a light source unit that emits light whose intensity periodically changes at a predetermined frequency; an incident-light optical unit having a collimator, a polarizer, and a photoelastic phase modulator which modulates light emitted from the light source unit an emitted-light optical unit having an analyzer which analyzes a polarization state of light that has been reflected from or transmitted through the sample and a two-dimensional detector which converts light received from the analyzer to an electrical signal and outputs the electrical signal; and a control/analysis unit which operates the light source unit and the photoelastic phase modulator at the same frequency, and calculates ellipsometric parameters of each of the measured points.

Abstract: The present invention provides a “nucleic acid adaptor molecule” having specific binding affinity to a GST protein portion serving as an N-terminal fusion partner in a fusion protein consisting of the GST protein and a protein of interest. A “nucleic acid adaptor molecule against a GST protein” according to the present invention is an RNA aptamer molecule having any of the following nucleotide sequences I to III: nucleotide sequence I (SEQ ID NO: 1): GGUAGAUACGAUGGAUGGUUGUGUAAAGGUGGUCGUAUCCGCCGA CAUG ACGCGCAGCCAA 61; nucleotide sequence II (SEQ ID NO: 2): GGUAGAUACGAUGGACUAACUGCGCAAAUUACUCGUAUUAGCCGA CAUG ACGCGCAGCCAA 61; or nucleotide sequence III (SEQ ID NO: 3): GGUAGAUACGAUGGAUACCGAAAAAUUAGUGUCGUUGACUGCAA CAUGA CGCGCAGCCAA 60.