Abstract: This invention concerns improved methods, uses, and kits for treating chronic wounds through the administration of anti-connexin agents, particularly anti-connexin 43 antisense polynucleotides. The methods, uses, and kits of the invention are based on the surprising and unexpected discovery that chronic wounds that do not increase or decrease in size by more than a pre-determined amount during a pre-treatment phase are more amenable to successful treatment than wounds whose size varies outside the target range during the pre-treatment phase.

Abstract: A therapeutic and/or cosmetic formulation comprising at least one anti-sense polynucleotide to a connexin protein together with a pharmaceutically acceptable carrier or vehicle is useful in site specific down regulation of connexin protein expression, particularly in reduction of neuronal cells death, wound healing, reduction of inflammation, decrease of scar formation and skin rejuvenation and thickening.

Abstract: Treatment of fibrosis and fibrotic diseases, disorders, and conditions, and associated methods, compositions, formulations and articles.

Abstract: Connexin modulation for the treatment of wounds that do not heal at expected rates, including delayed healing wounds, incompletely healing wounds, and chronic wounds, and associated methods, compositions and articles.

Abstract: Medical devices comprising an anti-connexin agent suitable for introduction into a subject.

Abstract: Methods and compositions comprising combinations of one or more anti-connexin agents and one or more other agents useful for the promotion and/or improvement of wound healing and/or tissue repair.

Abstract: This invention concerns improved methods, uses, and kits for treating chronic wounds through the administration of anti-connexin agents, particularly anti-connexin 43 antisense polynucleotides. The methods, uses, and kits of the invention are based on the surprising and unexpected discovery that chronic wounds that do not increase or decrease in size by more than a pre-determined amount during a pre-treatment phase are more amenable to successful treatment than wounds whose size varies outside the target range during the pre-treatment phase.

Abstract: Methods and compositions for modulating the activities of connexins are provided, including, for example, for use for treatment of cardiovascular, vascular, neurological, for wounds and for other indications. These compounds and methods can be used therapeutically, for example, to reduce the severity of adverse effects associated diseases and disorders where localized disruption in direct cell-cell communication or prevention of hemichannel opening is desirable.

Abstract: A therapeutic and/or cosmetic formulation comprising at least one anti-sense polynucleotide to a connexin protein together with a pharmaceutically acceptable carrier or vehicle is useful in site specific down regulation of connexin protein expression, particularly in reduction of neuronal cells death, wound healing, reduction of inflammation, decrease of scar formation and skin rejuvenation and thickening.

Abstract: This invention concerns improved methods, uses, and kits for treating chronic wounds through the administration of anti-connexin agents, particularly anti-connexin 43 antisense polynucleotides. The methods, uses, and kits of the invention are based on the surprising and unexpected discovery that chronic wounds that do not increase or decrease in size by more than a pre-determined amount during a pre-treatment phase are more amenable to successful treatment than wounds whose size varies outside the target range during the pre-treatment phase.

Abstract: The present invention concerns an isolated polynucleotide comprising a nucleotide sequence having substantial homology to any of the following nucleotide sequences: catcgttatgggacta (SEQ ID NO: 2), cattcttgatccttcc (SEQ ID NO: 1), cttttcaatctgactg SEQ ID NO: atgaaaatactcataa (SEQ ID NO: 5), gtgataaaagaaccat (SEQ ID NO: 10), gggttcatgaaagtga (SEQ ID NO: 11), gatgaccctcttatcc (SEQ ID NO: 8), tggaaggaatgtctgg (SEQ ID NO: 4), gcatctgcttccaaca (SEQ ID NO: 3), catcgttaggctagctacaacgatgggacta (SEQ ID NO: 9), tccaccaaggctagctacaacgaccatcaaa (SEQ ID NO: 12), gtcaacaaggctagctacaacgatgagctca (SEQ ID NO: 13), and cttttcaaggctagctacaacgactgactgt (SEQ ID NO: 6), and their use in the treatment of wounds.

Abstract: Medical devices comprising an anti-connexin agent suitable for introduction into a subject.

Abstract: Connexin modulation for the treatment of wounds that do not heal at expected rates, including delayed healing wounds, incompletely healing wounds, and chronic wounds, and associated methods, compositions and articles.

Abstract: Treatment of fibrosis and fibrotic diseases, disorders, and conditions, and associated methods, compositions, formulations and articles.

Abstract: Anti-cadherin and anti-ZO-1 agents and compositions, and kits containing them for use in the promotion and/or improvement of wound healing and/or tissue repair, and for anti-scarring, anti-inflammatory, anti-fibrosis and anti-adhesion indications.

Abstract: This invention concerns improved methods, uses, and kits for treating chronic wounds through the administration of anti-connexin agents, particularly anti-connexin 43 antisense polynucleotides. The methods, uses, and kits of the invention are based on the surprising and unexpected discovery that chronic wounds that do not increase or decrease in size by more than a pre-determined amount during a pre-treatment phase are more amenable to successful treatment than wounds whose size varies outside the target range during the pre-treatment phase.

Abstract: This invention concerns improved methods, uses, and kits for treating chronic wounds through the administration of anti-connexin agents, particularly anti-connexin 43 antisense polynucleotides. The methods, uses, and kits of the invention are based on the surprising and unexpected discovery that chronic wounds that do not increase or decrease in size by more than a pre-determined amount during a pre-treatment phase are more amenable to successful treatment than wounds whose size varies outside the target range during the pre-treatment phase.

Abstract: Methods and compositions for modulating the activities of connexins are provided, including, for example, for use in post-surgical, trauma, or tissue engineering applications. These compounds and methods can be used therapeutically, for example, to reduce the severity of adverse effects associated diseases and disorders where localized disruption in direct cell-cell communication is desirable.

Abstract: Connexin modulation for the treatment of wounds that do not heal at expected rates, including delayed healing wounds, incompletely healing wounds, and chronic wounds, and associated methods, compositions and articles.

Abstract: Connexin modulation for the treatment of wounds that do not heal at expected rates, including delayed healing wounds, incompletely healing wounds, and chronic wounds, and associated methods, compositions and articles.