Abstract: A method and device for preferentially delivering a compound such as an antigen to the cytosol of an immune cell. The method comprises passing a cell suspension comprising the target immune cell through a microfluidic device and contacting the suspension with the compound(s) or payload to be delivered.

Abstract: An approximating anchor device, corresponding kits, and methods for implementing the device are described herein. In one embodiment, the approximating anchor device includes a first cylindrical fastener defining a first set of cross lumens, each of the first set of cross lumens extending substantially perpendicular to a central axis of the first cylindrical fastener, a second cylindrical fastener defining a second set of cross lumens, each of the second set of cross lumens extending substantially perpendicular to a central axis of the second cylindrical fastener, and a string running through the first set of cross lumens of the first cylindrical fastener and the second set of cross lumens of the second cylindrical fastener. Tightening of the string will draw the first cylindrical fastener and the second cylindrical fastener towards each other.

Abstract: The disclosure describes an adaptive and optimal imaging of individual quantum emitters within a lattice or optical field of view for quantum computing. Advanced image processing techniques are described to identify individual optically active quantum bits (qubits) with an imager. Images of individual and optically-resolved quantum emitters fluorescing as a lattice are decomposed and recognized based on fluorescence. Expected spatial distributions of the quantum emitters guides the processing, which uses adaptive fitting of peak distribution functions to determine the number of quantum emitters in real time. These techniques can be used for the loading process, where atoms or ions enter the trap one-by-one, for the identification of solid-state emitters, and for internal state-detection of the quantum emitters, where each emitter can be fluorescent or dark depending on its internal state.

Abstract: A method for studying the behavior of an animal in an experimental area including stimulating the animal using a stimulus device; collecting data from the animal using a data collection device; analyzing the collected data; and developing a quantitative behavioral primitive from the analyzed data. A system for studying the behavior of an animal in an experimental area including a stimulus device for stimulating the animal; a data collection device for collecting data from the animal; a device for analyzing the collected data; and a device for developing a quantitative behavioral primitive from the analyzed data. A computer implemented method, a computer system and a nontransitory computer readable storage medium related to the same. Also, a method and apparatus for automatically discovering, characterizing and classifying the behavior of an animal in an experimental area. Further, use of a depth camera and/or a touch sensitive device related to the same.

Abstract: According to some aspects, a cardiac pacemaker for implantation within a subject is provided, the pacemaker including a housing, at least one sensor configured to detect an activity level of the subject, and at least one processor coupled to the sensor configured to detect inactivity of the subject based on output from the at least one sensor, produce a first signal configured to increase the heart rate of the subject to a first heart rate during a first time period, wherein the first heart rate is above a resting heart rate and below 100 beats per minute, and in response to determining that the first time period has elapsed, producing a second signal configured to increase the heart rate of the subject to a second heart rate during a second time period, wherein the second heart rate is between 100 and 140 beats per minute.

Abstract: Provided are methods of treating an autoimmune disease in a subject, or of suppressing transplant rejection in a subject, or of treating a cancer in a subject, as well as compositions therefor.

Abstract: Provided are modified arenaviruses and populations thereof, wherein the modified arenaviruses include i) an introduced PPXY domain; ii) an increased number of PPXY domains; iii) a substituted amino acid in place of S41 in a viral Z protein that is not a substrate for a serine or tyrosine kinase, or a combination of i)-iii). A PPXY domain can include a phosphomimetic replacement of the Y amino acid. Modified Old World and New World arenaviruses are included. Arenavirus production is provided using cell cultures that contain a kinase inhibitor that inhibits a kinase that can phosphorylate the Y amino acid of the PPXY domain, or by cells that have disrupted kinase gene expression, or by cells that have a disrupted ESCRT system. Also provided are pharmaceutical formulations that contain modified arenaviruses, and methods of using such formulations for stimulating an immune response hat is fully or partially protective against arenavirus infection.

Abstract: Disclosed herein are secondary amine compounds that inhibit tRNA synthetase. The compounds of the invention are useful in inhibiting tRNA synthetase in Gram-negative bacteria and are useful in killing Gram-negative bacteria. The secondary amine compounds of the invention are also useful in the treatment of tuberculosis.

Abstract: A nucleic acid construct is provided that encodes two or more or a plurality of spacer sequences separated by restriction endonuclease recognition site. A plurality of such nucleic acid sequences are provided as a library for making guide RNAs for use with CRISPR/Cas systems.

Abstract: The present invention relates to a modified T regulatory cell (Treg) in which the level of microRNA miR-142-5p (CAUAAAGUAGAAAGCACUACU) or a variant thereof is increased or decreased. Therapeutic uses of said modified Tregs are also provided, in particular in the treatment of autoimmune diseases and cancer. Populations of said Tregs and methods of preparing such Tregs are also provided.

Abstract: The invention relates, in part, to compounds, compositions, and methods to assess molecular characteristics papillary microcarcinoma (PMC) of the thyroid and indicators of indolent compared to aggressive PMC of the thyroid. In addition, the invention relates, in part, to methods of assessing characteristics of microRNAs associated with PMC of the thyroid.

Abstract: The present application provides methods for preparing soluble lipidated ligand agents comprising a ligand entity and a lipid entity, and in some embodiments, provides relevant parameters of each of these components, thereby enabling appropriate selection of components to assemble active agents for any given target of interest.

Abstract: Provided herein, in some embodiments, are methods, compositions and kits for controlling nucleation and assembly of molecular nanostructures, microstructures and macrostructures.

Abstract: A method and system for imaging a body using a magnetic resonance imaging (MRI) apparatus, including motion tracking of a target object of the body using MRI by generating an MRI image of a region of interest of the body by performing a weighted combination of a signal received by each coil of an MRI apparatus during an MRI scan.

Abstract: A textile actuator and harness system can include a harness configured to be worn with a portion extending across a wearer's joint. The harness comprises a substantially inextensible section and at least two mounting locations spaced for positioning across the joint, with at least one located along the substantially inextensible section of the harness. A textile envelope defines a chamber and is made fluid-impermeable by (a) a fluid-impermeable bladder contained in the textile envelope and/or (b) a fluid-impermeable structure incorporated into the textile envelope. The textile envelope is secured to the harness at each mounting location, and the textile envelope has a pre-determined geometry configured to produce assistance to the joint due to inflation of the textile envelope during a relative increase in pressure inside the chamber.

Abstract: The present invention provides compositions and methods that modulate the immune system in a subject.

Abstract: A method of identifying a subject having a bacterial infection, which includes discriminating said subject from a subject having a viral infection or an inflammatory disease. Also provided is a gene signature employed in the method and to a bespoke gene chip for use in the method. Further provided are probes and/or primers specific to genes in a signature of the present disclosure.

Abstract: The present invention provides, inter alia, compositions including at least one pliable layer comprising a plurality of silk fibroin nanofibrils, and at least one rigid layer comprising a plurality of mineral crystals, wherein each rigid layer is associated with at least one pliable layer, as well as methods for the production and use thereof.

Abstract: A conditionally replicating adenovirus were generated that can specifically replicate and express therapeutic genes in neuroendocrine tumors. The promoter-specific expression of the adenoviruses is regulated upstream by an INSM1 (insulinoma-associated-1) promoter that is silent in normal adult tissues but active in developing neuroendocrine cells and neuroendocrine tumors. By placing the I NSM 1-promoter with an insulator and two copies of neuronal restrictive silencer elements in an adenoviral vector, the construct can retain tumor specificity and drive expression of a mutated adenovirus E1A gene (?24E1A) and the herpes simplex virus thymidine kinase gene. The I NSM1-promoter-driven viruses could replicate specifically in the I NSM1-positive cells and I NSM1-specific HSV-tk expression in combination with ganciclovir treatment displayed dose-dependent tumor cell-specific killing in insulinomas.

Abstract: The present disclosure provides, in some embodiments, compositions, kits, systems, and methods for reducing bacteria on a surface (e.g., a medical device) and preventing and/or treating a bacterial infection (e.g., urinary tract infection) in a subject using IdsD protein or a fragment thereof.