Patents Assigned to Counsel of Scientific and Industrial Research
  • Patent number: 9206201
    Abstract: Compounds with unique liphagane meroterpenoid scaffold having boronic acid functionality in the skeleton are described (formula 1) together with pharmacological potential of these compounds as anticancer agents. A method of preparation and inhibiting the activity of phosphoinositide-3-kinase (PI3K-alpha and beta) has been presented. In particular, the invention describes a method of inhibiting PI3K isoforms, wherein the compounds are novel structures based on liphagane scaffold with unique boronic acid functionality. The methods and uses thereof are described herein this invention.
    Type: Grant
    Filed: March 18, 2013
    Date of Patent: December 8, 2015
    Assignee: Counsel of Scientific & Industrial Research
    Inventors: Ram Asrey Vishwakarma, Sanghapal Damodhar Sawant, Parvinder Pal Singh, Abid Hamid Dar, Parduman Raj Sharma, Ajit Kumar Saxena, Amit Nargotra, Anjaneya Aravind Kumar Kolluru, Ramesh Mudududdla, Asif Khurshid Qazi, Aashiq Hussain, Nayan Chanauria
  • Patent number: 9133089
    Abstract: A process for synthesis of sulfonated, arylated 3-pentadecyl phenol (cross linking catalyst) of formula I starting from Cashew Nut Shell Liquid. Formula I wherein R is benzenesulfonic acid; X is —SO3H, where n is 0 or 1; wherein the process steps comprises hydrogenating cardanol with 5% Pd/C in presence of lower alcoholic solvent at 70° C. under 600 psi hydrogen pressure to obtain 3-pentadecyl phenol; arylating 3-pentadecyl phenol to obtain 3-pentadecyl diphenyl ether; and sulfonating the 3-pentadecyl diphenyl ether to obtain compound of formula I.
    Type: Grant
    Filed: December 5, 2012
    Date of Patent: September 15, 2015
    Assignee: Counsel of Scientific & Industrial Research
    Inventors: Prakash Purushottam Wadgaonkar, Bhimrao Dhondiba Sarwade, Bhausaheb Vilas Tawade
  • Patent number: 8557754
    Abstract: A composition of biodegradable gear oil that mainly contains modified nontauedible vegetable oils. Mono-esters are hydrogenated, epoxidized or aryl alkylated or mixture thereof, and C7 to C12 primary alcohol. In addition to chemically modified non-edible vegetable oils, the composition also contains an additive pack, which comprises at least one: antioxidant, an extreme pressure additive, an anti foaming agent, a pour point depressant, a corrosion inhibitor and a detergent-dispersant additive. The product of this invention has utility as industrial and automotive gear oil GL 4 grade. The compositions are significantly biodegradable, eco-friendly, reduce use of petroleum, have lower cost than synthetic oil, are miscible in mineral & synthetic fluids and safe to use due to higher flash point.
    Type: Grant
    Filed: March 5, 2009
    Date of Patent: October 15, 2013
    Assignee: Counsel of Scientific & Industrial Research
    Inventors: Arun Kumar Singh, Aruna Chamoli
  • Patent number: 7427686
    Abstract: The present invention relates to compounds of the formula I in which substituents R2 and R3 are arranged in trans-configuration: wherein: R1 is H or C1-C6 alkyl; C3-C7 cycloalkyl; R2 is phenyl, optionally substituted with 1 to 5 substituents independently selected from the group comprising OH, C1-C6-alkyl, halogen, nitro, cyano, SH, SR4, trihalo-C1-C6-alkyl, C1-C6-alkoxy and phenyl, wherein R4 is C1-C6 alkyl; R3 is phenyl substituted with OR5 wherein R5 has the formula (II), (III) or (IV) wherein Y is chosen from NHR4, NR42, NHCOR4, NHSO2R4, CONHR4, CONR4, CONR42, COOH, COOR4, SO2R4, SOR4, SONHR4, SONR42, a C3-C7 heterocyclic ring, saturated or unsaturated, containing one or two heteroatoms independently selected from the group consisting of O, S and N, optionally being substituted with 1 to 3 substituents independently selected from the group comprising H, OH, halogen, nitro, cyano, SH, SR4, trihalo-C1-C6-alkyl, C1-C6-alkyl and C1-C6-alkoxy, preferably NHR4, NR24, or a nitrogen heterocycle, wh
    Type: Grant
    Filed: September 30, 2003
    Date of Patent: September 23, 2008
    Assignee: Counsel of Scientific and Industrial Research
    Inventors: Sangita, Atul Kumar, Man Mohan Singh, Suprabhat Ray, Girish Kumar Jain
  • Patent number: 7083587
    Abstract: The present invention provides a blood transfusion system having valve circuit, for transfusion of blood to a patient, said system comprising a Y-Shaped connector comprising of three arm [7, 16(a) and 16(b)] and a junction (9), wherein arm 7 is connected to the patient at its one end and to the junction (9) at its other end, arm 16(a) is connected to the junction (9) at its one end and to a waste-blood suction syringe (10) at its other end through a valve (11), an outlet is being provided in the arm 16(a) between the valve 11 and the waste-blood suction syringe for dispensing the waste blood, arm 16(b) is connected to the junction (9) at its one end and to a fresh-blood supplying syringe (13) at its other end through a valve (14), a fresh-blood supplying means is being connected in the arm 16(b) between the valve 14 and the fresh-blood supplying syringe through a valve (15), and syringes (10 and 13) are being operated synchronously.
    Type: Grant
    Filed: March 22, 2002
    Date of Patent: August 1, 2006
    Assignee: Counsel of Scientific and Industrial Research
    Inventors: Kashi Das Chattopadhyay, Sanjeev Verma, Pirthi Raj, Jitender Gupta
  • Patent number: 6669944
    Abstract: Accordingly the present invention provides a process for the preparation an alcoholic extract with Carotenoids, UV absorption, antibacterial and pH indicating properties from a deep-sea bacterium which comprises a method for growing the cells in a medium with salinity ranging from 1.5 to 3% for 3-4 days at 28+/−2° C. and harvesting them to prepare an extract which shows the properties of carotenoids (yellow/orange coloration), UV absorption, antibacterial and pH indicator properties.
    Type: Grant
    Filed: April 3, 2001
    Date of Patent: December 30, 2003
    Assignee: Counsel of Scientific & Industrial Research
    Inventors: Ponnapakkam Adikesavan Loka Bharathi, Shanta Nair, Dorairajasingham Chandramohan
  • Patent number: 6200570
    Abstract: The invention provides a herbal formulation useful as a therapeutic and cosmetic applications for the treatment of general skin disorders, the composition comprising at least two or more plant extracts in the form of oil or powder or mixtures thereof, the plant extracts being selected from the group consisting of Gymnena sylvestrae water extract 3 to 6 wt. %; Tridax procumbens water extract 3 to 6 wt. %; its methanolic extract 4 to 6 wt. %, Allium sativum oil hexane extract 1 to 3 wt. %; dried juice of Aloe vera 2 to 6 wt. %; Gum Olibanum powder in the natural form 4 to 7 wt. %; Gum Olibanum resinoid organic solvent extract 3 to 8 wt. %; and resinoid free Gum Olibanum meal 5 to 10 wt. %., optionally, including any drug having anti-inflammatory and wound healing property or mixture thereof, the drug being selected from the group consisting of Disclofenac sodium 1-3 wt. %, Salicyclic acid 1 to 4 wt. %, Piroxicam 1 to 2 wt. %, Turmeric powder 0.1 to 1 wt.
    Type: Grant
    Filed: November 25, 1998
    Date of Patent: March 13, 2001
    Assignee: Counsel of Scientific and Industrial Research
    Inventors: Prakash Vaman Rao Diwan, Bhamidipalli Subrahmanya Sitaramam, Sistla Ramakrishna, Kondapuram Vijaya Raghavan
  • Patent number: 6180345
    Abstract: An improved process for simultaneous preparation of sex specific and gender-neutral semisynthetic amplicons obtained by amplifying sequences of synthetic oligonucleotide primers identified as SEQ ID NOS:4 to 7 (5′GGATCCCTATlAGTG 3′; 5′GGATCCCITTTGCACTC 3′; 5CGAAATCGGTAGACGATACG3′ and 5′GGGGATAGAGGGACTTGAAC 3′) useful for sex determination, said process comprising isolating nucleic acids from any part of a papaya plant by conventional methods, amplifying the said nucleic acids in a conventional Random Amplification of polymorphic DNA Polymerase Chain Reaction (RAPD-PCR), resolving the amplified products by conventional electrophoresis method, eluting the sex specific, double stranded amplified product from the gel piece by known methods, cloning the said product in a known vector by conventional methods, sequencing the said cloned product by known methods, synthesizing the single stranded chains of synthetic oligonucleotides by known method based on the said sequence d
    Type: Grant
    Filed: February 26, 1999
    Date of Patent: January 30, 2001
    Assignee: Counsel of Scientific & Industrial Research
    Inventors: Prabhakar K. Ranjekar, Anjali S. Parasnis, Vidya S. Gupta