Abstract: The present invention includes methods of treatment and/or prevention of fibrosis and of diseases associated with fibrosis by administering an, agent being selected from among: a combination of: miR-34b or a precursor or a mimic or a functional derivative thereof and miR-34c or a precursor or a mimic or a functional derivative thereof; or miR-34b or a precursor or a mimic or a functional derivative thereof or miR-34c or a precursor or a mimic or a functional derivative thereof.

Abstract: The present invention provides compositions and methods for the treatment or prevention of a neurological disease or disorder of the central nervous system (e.g., a storage disorder, lysosomal storage disorder, neurodegenerative disease, etc.) by reconstitution of brain myeloid cell and microglia upon transplantation of hematopoietic cells enriched in microglia reconstitution potential. The invention also provides compositions and methods for ablating and reconstituting microglia.

Abstract: An enveloped viral particle producer or packaging cell, wherein the cell is genetically engineered to decrease expression of MHC-I on the surface of the cell.

Abstract: A gene vector comprising a miRNA sequence target.

Abstract: The present invention provides compositions and methods for the treatment or prevention of a lysosomal disease or disorder involving increasing the level, expression, or activity of a metallothionein polypeptide or polynucleotide in the subject.

Abstract: An RNA interference (RNAi) strategy is provided based on use of artificial microRNA (amiR) to reduce NKCC1 expression. In particular, a method is provided that achieves neuron-specific expression of specific amiR against NKCC1 by using a human Synapsin promoter to drive transgene expression.

Abstract: A gene vector for use in gene therapy comprising at least one miRNA sequence target operably linked to a nucleotide sequence having a corresponding miRNA in a hematopoietic progenitor cell (HSPC) or hematopoietic stem cell (HSC) which prevents or reduces expression of the nucleotide sequence in a HSPC or HSC but not in a differentiated cell.

Abstract: Use of (i) an anti-CD3 antibody, (ii) an anti-CD56 antibody, (iii) an anti-CD14 antibody, (iv) an anti-CD38 antibody, (v) an anti-CD45 antibody, (vi) an anti-CD90 antibody, (vii) an anti-CD135 antibody, (viii) an anti-CD10 antibody, (ix) an anti-CD11c antibody, (x) an anti-CD19 antibody, (xi) an anti-CD34 antibody, (xii) an anti-CD45RA antibody, (xiii) an anti-CD7 antibody, (xiv) an anti-CD71 antibody, (xv) an anti-CD41/CD61 complex antibody or an anti-CD41 antibody and/or an anti-CD61 antibody (xvi) an anti-CD33 antibody and/or an anti-CD66b antibody, for identifying hematopoietic cell subtypes in an isolated sample, determining the relative frequency of hematopoietic cell subtypes in an isolated sample and/or quantifying the number of cells within hematopoietic cell subtypes in an isolated sample, wherein each of (i) to (xvi) is labelled with a different fluorochrome, wherein when (xvi) is an anti-CD33 antibody and an anti-CD66b antibody, the anti-CD33 antibody and anti-CD66b are labelled with the same fluo

Abstract: The present invention relates to agents capable to inhibit miR-181, for use in treatment and/or prevention of mitochondrial disorders including mitochondrial diseases with eye and/or brain involvement and neurodegeneration affecting eye and/or brain associated with mitochondrial dysfunction.

Abstract: The present invention relates to a method of integrating an exogenous DNA sequence into a genome of a cell comprising contacting the cell with: a) a donor nucleic acid comprising: —at least one STOP codon and a translation initiation sequence (TIS) or —a ribosomal skipping sequence, and —said exogenous DNA sequence wherein said donor nucleic acid is flanked at 5? and 3? by inverted targeting sequences; b) a complementary strand oligonucleotide homologous to the targeting sequence and c) a nuclease that recognizes the targeting sequence.

Abstract: The present invention relates to heterocyclic nitrogen compounds, use thereof as a medicament and pharmaceutical compositions thereof. Furthermore, the invention provides combinations of compounds of general formula (I) with therapeutic agents, such as correctors, potentiators and amplifiers of dysfunctional proteins.

Abstract: The present disclosure relates to a genetically modified dendritic cell or precursor thereof expressing at least one anti-gen-derived peptide and at least one immuno-modulatory molecule, its medical use and method of preparation. The invention also relates to an in vitro method to produce IL-10-producing CD49b+LAG-3+ Tr1 cells or antigen-specific FOXP3+ T cells and relative medical uses and pharmaceutical compositions.

Abstract: The present invention relates to proteins consisting of an artificial DNA-binding domain (DBD) and related molecules and uses thereof. In particular, the proteins are ZF-DBD or TALE-DBD and are used for the treatment of eye disorders caused by gain of function mutation. The disorder may be ADRP, in particular ADRP caused by mutation in the rhodopsin gene. The present invention also relates to a method to identify cis-regulatory elements and to modulate them via DBDs.

Abstract: The present invention relates to the treatment and/or prevention of a retinal disease by using a polynucleotide promoter wherein the polynucleotide or a variant thereof consists of the sequence (hRHOs-wt;?SEQ?ID?NO.?1) TCCTCCTAGTGTCACCTTGGCCCCTCTTAGAAGCCAATTAGGCCCTCAG TTTCTGCAGCGGGGATTAATATGATTATGAACACCCCCAATCTCCCAGA TGCTGATTCAGCCAGGAGCTTAGGAGGGGGAGGTCACTTTATAAGGGTC TGGGGGGGTCAGAACCCAGAGTCATCCAGCTGGAGCCCTGAGTGGCTGA GCTCAGGCCTTCGCAGCATTCTTGGGTGGGAGCAGCCACGGGTCAGCCA CAAGGGCCACAGCC? wherein the fragment TGAACACCCCCAATCTCCCAGATGCT which is the sequence from nucleotide 77 to nucleotide 102 of SEQ ID NO. 1, is substituted. The invention is also directed to the use of relative vector, vector systems, host cells and pharmaceutical compositions.

Abstract: In various embodiments methods are provided for the treatment or prophylaxis of liposomal storage diseases. In certain embodiments the methods involve administering to a subject in need thereof one or more molecular tweezers that inhibit protein aggregation.

Abstract: An enveloped viral particle producer or packaging cell, wherein the cell is genetically engineered to decrease expression of MHC-I on the surface of the cell.

Abstract: Use of (i) an anti-CD3 antibody, (ii) an anti-CD56 antibody, (iii) an anti-CD14 antibody, (iv) an anti-CD38 antibody, (v) an anti-CD45 antibody, (vi) an anti-CD90 antibody, (vii) an anti-CD135 antibody, (viii) an anti-CD10 antibody, (ix) an anti-CD11c antibody, (x) an anti-CD19 antibody, (xi) an anti-CD34 antibody, (xii) an anti-CD45RA antibody, (xiii) an anti-CD7 antibody, (xiv) an anti-CD71 antibody, (xv) an anti-CD41/CD61 complex antibody or an anti-CD41 antibody and/or an anti-CD61 antibody (xvi) an anti-CD33 antibody and/or an anti-CD66b antibody, for identifying hematopoietic cell subtypes in an isolated sample, determining the relative frequency of hematopoietic cell subtypes in an isolated sample and/or quantifying the number of cells within hematopoietic cell subtypes in an isolated sample, wherein each of (i) to (xvi) is labelled with a different fluorochrome, wherein when (xvi) is an anti-CD33 antibody and an anti-CD66b antibody, the anti-CD33 antibody and anti-CD66b are labelled with the same fluo

Abstract: A method of preparing a therapeutic cell population for clinical use from a starting population of cells comprising haematopoietic stem cells, said method comprising separating a population of cells that substantially do not express CD38 but which express CD34 from the starting population of cells, and transducing the separated cell population with a vector to obtain the therapeutic cell population.

Abstract: The present invention provides compositions and methods for the treatment or prevention of a neurological disease or disorder of the central nervous system (e.g., a storage disorder, lysosomal storage disorder, neurodegenerative disease, etc.) by reconstitution of brain myeloid cell and microglia upon transplantation of hematopoietic cells enriched in microglia reconstitution potential. The invention also provides compositions and methods for ablating and reconstituting microglia.

Abstract: The present invention relates to constructs, vectors, relative host cells and pharmaceutical compositions which allow an effective gene therapy, in particular of genes larger than 5 Kb.