Abstract: A novel carboxylic acid compound having a condensed ring; which is represented by the formula (I) ##STR1## wherein each symbol is as defined in the specification, a pharmacologically acceptable salt thereof, a pharmaceutical composition thereof and pharmaceutical use thereof. The novel carboxylic acid compound having a condensed ring and pharmacologically acceptable salt thereof of the present invention have superior GPIIb/IIIa antagonism in mammals inclusive of human; can be administered orally; have long life in blood and low toxicity; and show less side-effects. Accordingly, they are extremely useful for the prophylaxis and treatment of thrombotic diseases and other diseases.

Abstract: An agent for the prophylaxis and treatment of immune-related diseases, in particular, immunosuppressant, an agent for the prophylaxis and treatment of allergic diseases, an agent for the prophylaxis and treatment of eosinophil-related diseases and an eosinophilia inhibitor, comprising, as an active ingredient, a series of triazole derivatives of the following formula (I) ##STR1## or the following formula (III) ##STR2## wherein each symbol is as defined in the specification, or a pharmaceutically acceptable salt thereof. A novel monocyclic or bicyclic triazole derivative. The agent for the prophylaxis and treatment of immune-related diseases, in particular, immunosuppressant, the agent for the prophylaxis and treatment of allergic diseases, the agent for the prophylaxis and treatment of eosinophil-related diseases, the eosinophilia inhibitor and the novel triazole derivative of the present invention all, have superior eosinophilia-inhibitory action and lymphocyte activation-inhibitory action.

Abstract: A container filled with infusion liquids useful for preparation of an infusion liquid containing sugars, amino acids, electrolytes, a fat emulsion and vitamins. A container having two compartments which are separated from each other by a separation means, which contains an infusion liquid comprising a fat emulsion, sugars and specific vitamins in the first compartment and an infusion liquid comprising amino acids, electrolytes and other specific vitamins in the second compartment. An infusion preparation containing sugars, amino acids, electrolytes, a fat emulsion and vitamins can be obtained easily and aseptically upon use, by simply removing a separation means and mixing the infusion liquids included in the first and second compartments.

Abstract: A method for decoloring a recombinant human serum albumin by treating the albumin with a reducing agent is disclosed. Also, a method for decoloring a recombinant human serum albumin by treating the albumin with a method removing free polysaccharides with a cation exchanger followed by heat treatment is disclosed. The present invention provides a recombinant human serum albumin, coloring of which is fully suppressed by preventing binding of certain coloring components, which are contained in the raw materials or contaminants secreted by a microorganism, to human serum albumin so as not to cause coloring of the human serum albumin.

Abstract: A mutant AOX2 promoter wherein 1 to 3 oligonucleotide(s) GATAGGCTATTTTTGTCGCATAAAT (SEQUENCE ID NO: 2) is (are) added in the normal direction, the reverse direction or in both the normal and reverse directions at the 5' end side of a partial DNA fragment of a wild-type AOX2 promoter, a vector carrying the promoter, a transformant into which the vector has been introduced and a method for producing a heterologous protein, comprising culture of the transformant. The mutant AOX2 promoter of the present invention has a markedly enforced promoter activity as compared with wild-type AOX2 promoters. Accordingly, the promoter of the present invention is highly utilizable as a promoter to be carried by a vector capable of expressing a heterologous protein. The vector of the present invention can efficiently express and produce various useful heterologous proteins in hosts.

Abstract: An antimicrobial composition comprising AIT and a polyhydric alcohol which may have aldehyde group or ketone group; an antimicrobial composition comprising a surfactant and said composition; a method for treating microorganisms; and a method for retaining freshness of vegetables, etc., both of which methods comprising treating the target substances such as perishables with the composition of the present invention or an aqueous solution containing said composition.

Abstract: A circulatory disorder improving agent comprising, as an active ingredient, a dihydropyridine derivative of the formula (I) ##STR1## or an acid addition salt thereof. Said circulatory disorder improving agent is particularly useful as an organ circulation disorder improving agent or peripheral circulation improving agent.

Abstract: A recombinant human serum albumin (rHSA) pharmaceutical preparation is sterilized by subjecting a pharmaceutical preparation of rHSA obtained by gene manipulation techniques packed in a container in an administration unit to heat treatment at 50.degree. to 80.degree. C. for 30 minutes or more. By the disclosed method, rHSA having high safety can be provided since microorganisms contaminated in rHSA pharmaceutical preparations die as a result of the sterilization method of the present invention.

Abstract: Provision of a succinamic acid compound of the formula (1) ##STR1## wherein R.sup.1 is an alkyl or a lower alkenyl and R.sup.2 is an optionally esterified carboxyl, a pharmaceutically acceptable salt thereof, an agent for the prophylaxis and/or treatment of the complications of diabetes, comprising, as an active ingredient, the succinamic acid compound or a pharmaceutically acceptable salt thereof, an aldose reductase inhibitor comprising, as an active ingredient, the succinamic acid compound or a pharmaceutically acceptable salt thereof, and a method for producing the succinamic acid compound or a pharmaceutically acceptable salt thereof. The novel succinamic acid compounds of the formula (1) of the present invention and pharmaceutically acceptable salts thereof have a strong aldose reductase activity-inhibitory in mammals such as human, and show superior safety.

Abstract: A mutant AOX2 promoter obtained by mutating a sequence of natural AOX2 promoter in a manner comprising at least one of the three mutation modes of (1) a region extending upstream from nucleotide 1187 inclusive and comprising at least nucleotides 845-960 is deleted, (2) nucleotide(s) is(are) replaced in region(s) in nucleotides 1274-1314, and (3) new oligonucleotide(s) is (are) inserted in region(s) in nucleotides 1274-1314, a vector carrying said mutant AOX2 promoter, a transformant into which said vector has been introduced, and a method for producing a heterologous protein, which comprises cultivating said transformant. The promoter of the present invention has remarkably enhanced activity as compared with natural AOX2 promoter, and is highly useful as a promoter to be carried in an expression vector allowing heterologous protein expression. In addition, the vector and the transformant of the invention can efficiently express and produce various useful heterologous proteins.

Abstract: A pyridothiazineacetic acid compound of the formula (I) ##STR1## wherein each symbol is as defined in the specification, a pharmaceutically acceptable salt thereof, production thereof, and a pharmaceutical composition, an aldose reductase inhibitor and a preparation for the prevention and treatment of the complications of diabetes, containing the same.The pyridothiazineacetic acid compound and a pharmaceutically acceptable salt thereof of the present invention have an aldose reductase inhibitory action and are superior in safety. Accordingly, they are useful as a preparation for the prevention and treatment of the complications of diabetes, such as faulty union of corneal injury, cataract, neurosis, retinopathy and nephropathy, particularly, cataract and neurosis. In addition, the production method of the present invention enables efficient production of said pyridothiazineacetic acid compound.

Abstract: Disclosed is an infusion preparation for nutrient supply use. It comprises a sugar, amino acids, electrolytes and a fat emulsion. It has an excellent shelf life without causing precipitation, denaturation and the like in spite of the simultaneous presence of these components. Also disclosed is a container filled with infusion liquids comprising a first and a second compartments separated from each other by a separation means, wherein an infusion liquid containing a fat emulsion and a sugar is included in the first compartment and another infusion liquid containing amino acids and electrolytes is included in the second compartment. Further disclosed are an infusion preparation comprising a fat emulsion and a sugar, and an infusion preparation comprising amino acids and electrolytes.

Abstract: A quinoline compound represented by the formula (1) or a salt thereof: ##STR1## wherein the definition of each substituents are described in the specification, which have angiotensin II antagonism and hypotensive action and are useful as an agent for the prevention and treatment of cardiovascular system diseases such as hypertension, heart failure and the like.

Abstract: The object of the present invention is to provide a process for preparing a drug-containing liposome composition in which (1) a drug to be included into liposomes, particularly a physiologically active protein having a molecular weight of from 500 to 100,000, can be prevented from decomposition and (2) a high rate of drug inclusion can be attained; (3) the resulting liposome composition can be subcutaneously or intramuscularly administered and (4) makes contribution to sustained release of the drug. The process comprises (1) dissolving a lipid in a first organic solvent, (2) adding a drug-containing aqueous solution to the lipid solution, followed by emulsifying to obtain an emulsion, (3) mixing the emulsion at a low temperature with a second organic solvent in which the lipid is sparingly soluble, (4) collecting the precipitated fraction, and (5) suspending the precipitated fraction in an aqueous solvent.

Abstract: The present invention relates to 1,8-naphthyridin-2-one derivatives, pharmaceutically acceptable acid addition salts and therapeutic agents comprising said compound as an active ingredient, which are used for the diseases such as circulatory diseases and respiratory diseases (e.g. hypertension, renal failure, heart failure, angina pectoris, myocardial infarction, arteriosclerosis, romsoongiitis obliterans, aortitis syndrome, bronchial asthma and peripheral diseases such as peripheral circulatory disorders), central nervous system diseases (e.g. depression, degradatior of central nervous function after cerebrovascular obliteration, cerebrovascular dementia, senile dementia, Alzheimer dementia and memory learning function disorders), various inflammations, and obesity.

Abstract: A method for highly purifying human serum albumin (HSA), which comprises bringing a fraction containing HSA produced by genetic engineering into contact with a chelating chromatography carrier bound with copper ions, and eluting the HSA adsorbed by the carrier with a buffer containing ammonium chloride as an atagonist and having a pH of about 5-7.According to the method of the present invention, a component derived from yeast, which cannot be sufficiently removed by conventional purification methods for HSA produced by genetic engineering, can be removed from HSA produced by genetic engineering, and a highly purified HSA can be provided.

Abstract: A methylotrophic and glucotrophic mutant strain capable of producing a heterologous protein and a method for producing a heterologous protein, comprising culture of the mutant strain. The mutant strain of the present invention can be grown in a medium containing both methanol and glucose, with the effect that the growth of the strain and production of a heterologous protein proceed at the same time. Accordingly, a heterologous protein can be produced in a large amount in a short time.

Abstract: A 1,4-benzoxazine-2-acetic acid compound of the formula (I) ##STR1## wherein each symbol is as defined in the specification, a pharmaceutically acceptable salt thereof, a method for production thereof, and a pharmaceutical composition, an aldose reductase inhibitor and an agent for the prevention and/or treatment of the complications of diabetes, which contain the same. The compound (I) of the present invention and pharmaceutically acceptable salts thereof have aldose reductase inhibitory action and are superior in safety. Accordingly, they are useful as an agent for the prevention and/or treatment of the complications of diabetes such as faulty union of corneal injury, cataract, neurosis, retinopathy and nephropathy, in particular, cataract and neurosis.

Abstract: A novel carboxylic acid compound having a condensed ring, which is represented by the formula (I) ##STR1## wherein each symbol is as defined in the specification, a pharmacologically acceptable salt thereof, a pharmaceutical composition thereof and pharmaceutical use thereof. The novel carboxylic acid compound having a condensed ring and pharmacologically acceptable salt thereof of the present invention have superior GPIIb/IIIa antagonism in mammals inclusive of human; can be administered orally; have long life in blood and low toxicity; and show less side-effects. Accordingly, they are extremely useful for the prophylaxis and treatment of thrombotic diseases and other diseases.

Abstract: A process for producing recombinant human serum albumin (HSA) which comprises culturing an HSA producing host prepared by gene manipulation techniques at a temperature of from 21.degree. to 29.degree. C. Culturing the HSA producing host under such a specified temperature condition makes it possible to increase productivity of HSA production, improve the growth yield of an HSA producing host, and reduce the degree of coloring in the HSA preparation.